CN112280867A - Early warning method for liver cancer, detection kit for early warning and detection method - Google Patents
Early warning method for liver cancer, detection kit for early warning and detection method Download PDFInfo
- Publication number
- CN112280867A CN112280867A CN202011361755.6A CN202011361755A CN112280867A CN 112280867 A CN112280867 A CN 112280867A CN 202011361755 A CN202011361755 A CN 202011361755A CN 112280867 A CN112280867 A CN 112280867A
- Authority
- CN
- China
- Prior art keywords
- elf
- rassf1a
- gstp1
- liver cancer
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an early warning method for liver cancer, a detection kit for early warning and a detection method, and belongs to the technical field of biology. The early warning method comprises the steps of detecting the DNA methylation levels of RASSF1A, ELF, p16 and GSTP1 genes in a peripheral blood sample by a PCR method, calculating the risk value of suffering from liver cancer, and early warning according to the calculation result; the calculation formula is as follows: y-1.208163-0.00653 xct (RASSF1A) -0.00751 xct (elf) -0.00555 xct (p16) -0.00457 xct (GSTP 1); y is greater than or equal to 0.3177, and is judged as high risk, Y is less than 0.3177, and is judged as low risk. The polygenic methylation combined detection kit for early warning of liver cancer comprises a DNA methylation detection reagent for specifically detecting RASSF1A, ELF, p16 and GSTP1 genes in a peripheral blood sample, and an endogenous gene and endogenous gene detection reagent. The high-risk early warning result has high conformity with the clinical diagnosis result, has good application prospect for early liver cancer diagnosis, and increases the survival rate and the cure rate of liver cancer patients.
Description
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to an early warning method for liver cancer, a detection kit for early warning and a detection method.
Background
Hepatocellular Carcinoma (HCC), a high mortality primary liver cancer, is one of the most common malignancies worldwide, especially in asia, africa and southern europe. Worldwide, hundreds of thousands of people die of liver cancer every year. The World Health Organization (WHO) specifies: if the cancer patient can be found early, the cure rate can reach 80%. Therefore, the early diagnosis of liver cancer has great significance for the treatment effect and the life quality of liver cancer patients.
In the prior art, the early screening and diagnosis methods of liver cancer are mainly divided into imaging examination and biochemical detection. Among them, the biochemical detection mainly using the detection of alpha-fetoprotein (AFP) as a tumor marker has sensitivity and specificity far from meeting the requirements of clinical diagnosis due to the influence of physiological factors and individual differences, and tissue biopsy has certain traumatism and low patient acceptance. The PET-CT-based imaging examination is harmful to human body due to radiation, expensive, and susceptible to subjective factors such as the experience, manipulation, and fineness of the examiner. Therefore, the prior art has poor effects in early prediction and diagnosis of liver cancer, and an economic, rapid and effective early screening method for liver cancer is still urgently needed to be established.
Molecular detection methods targeting genes have been shown to possess higher sensitivity and specificity compared to imaging examination and biochemical detection methods. Research shows that abnormal methylation of various gene promoters exists in liver cancer tissues, and DNA methylation disorder of the gene promoter regions directly influences cell cycles and signal transduction pathways and is closely related to the occurrence and development of liver cancer. Circulating Tumor DNA (ctDNA) carries molecular genetic changes consistent with primary liver cancer tissues and can be obtained from peripheral blood samples. From the clinical point of view, the peripheral blood sample is easy to obtain, and the molecular diagnosis sensitivity and specificity are high. The DNA methylation degree of peripheral blood circulation tumors can provide important information for early screening of liver cancer; meanwhile, the abnormal methylation levels of a plurality of genes are jointly detected, so that the early warning accuracy of the liver cancer is improved, and the early warning method has great significance for early diagnosis and treatment of the liver cancer. Therefore, the method can perform early warning of liver cancer according to the methylation levels of a plurality of genes in peripheral blood circulation, has low cost, good specificity, high sensitivity and simple and convenient operation, and becomes a problem to be solved by technical personnel in the field.
Disclosure of Invention
The invention aims to provide an early warning method for liver cancer, and solves the problems of poor sensitivity and specificity and high cost of early screening and early warning of liver cancer in the prior art.
The invention also aims to provide a polygene methylation combined detection kit for early warning of liver cancer.
The invention also aims to provide a method for detecting the DNA methylation level of RASSF1A, ELF, p16 and GSTP1 genes in a peripheral blood sample by using the multi-gene methylation combined detection kit.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
the early warning method for liver cancer provided by the invention detects the DNA methylation levels of RASSF1A, ELF, p16 and GSTP1 genes in a peripheral blood sample by a PCR method, calculates the risk value of suffering from liver cancer, and carries out early warning according to the calculation result; the calculation formula is as follows:
Y＝1.208163-0.00653×Ct(RASSF1A)-0.00751×Ct(ELF)-0.00555×Ct(p16)-0.00457×Ct(GSTP1)；
when Y is greater than or equal to 0.3177, it is judged to have high risk of liver cancer, and when Y is less than 0.3177, it is judged to have low risk of liver cancer.
In some embodiments of the invention, the Ct (RASSF1A) represents the level of amplification of RASSF1A after calibration with an endogenous reference,
the Ct (ELF) represents the corrected amplification level of ELF by endogenous reference,
the Ct (p16) represents the calibrated amplification level of p16 with endogenous reference,
the Ct (GSTP1) represents the level of amplification of GSTP1 after calibration by endogenous reference.
The DNA methylation level of RASSF1A, ELF, p16 and GSTP1 genes in the peripheral blood sample can be detected by a detection reagent and/or a kit in the prior art, and can also be detected by the multi-gene methylation combined detection kit. Preferably, the multi-gene methylation combined detection kit is used for detection.
The polygenic methylation combined detection kit for early warning of liver cancer comprises a DNA methylation detection reagent for specifically detecting RASSF1A, ELF, p16 and GSTP1 genes in a peripheral blood sample. In some embodiments of the present invention, the detection kit further comprises an endogenous gene and an endogenous gene detection reagent.
The endogenous gene of the invention can be selected from genes reported in the prior art and can be used as an internal reference.
Preferably, the endogenous gene is β -actin or RPPH.
Preferably, the detection kit is a fluorescent PCR detection kit.
In some embodiments of the invention, the reagent for detecting methylation level comprises a DNA primer pair and a probe for Methylation Specific PCR (MSP) amplification of promoter regions of RASSF1A, ELF, p16 and GSTP1 genes
In some embodiments of the invention, the nucleotide sequence of the amplification primer pair of RASSF1A is:
a forward primer GGGTTTTGCGAGAGCGCG, shown as SEQ ID NO: 1;
a reverse primer GCTAACAAACGCGAACCG, shown as SEQ ID NO. 2;
the probe nucleotide sequence aiming at RASSF1A is GCTCTTCCCAGCGCGCTCA, as shown in SEQ ID NO. 3; preferably, the probe for RASSF1A is attached to a fluorophore; more preferably, the probes directed to RASSF1A are labeled with FAM fluorescein.
In some embodiments of the invention, the nucleotide sequence of the amplification primer pair of the ELF is:
a forward primer GGCGAGTGGTTTTTGATAAAATTATAAAT, shown as SEQ ID NO. 4;
reverse primer ACATACCACGATTACCGAACCCGAA, shown as SEQ ID NO. 5;
the nucleotide sequence of the probe aiming at the ELF is CGGCACTCGTACGTCAACCGCG, and is shown as SEQID NO. 6; preferably, the probe for ELF is attached with a fluorophore; more preferably the probe for ELF is labelled with HEX fluorescein.
In some embodiments of the invention, the nucleotide sequence of the amplification primer pair of p16 is:
forward primer TTATTAGAGGGTGGGGCGGATCGC, shown as SEQ ID NO. 7;
a reverse primer GACCCCGAACCGCGACCGTAA, shown as SEQ ID NO. 8;
the probe nucleotide sequence aiming at p16 is ACCGCGTAGCTCAGTCCTTA, as shown in SEQ ID NO. 9; preferably, the probe for p16 is attached with a fluorophore; more preferably the probe for p16F is labeled CY5 fluorescein.
In some embodiments of the invention, the nucleotide sequence of the amplification primer pair of GSTP1 is:
a forward primer TTCGGGGTGTAGCGGTCGTC, shown as SEQ ID NO: 10;
reverse primer GCCCCAATACTAAATCACGACG, shown as SEQ ID NO: 11;
the nucleotide sequence of the probe aiming at GSTP1 is ACCGGGTCGCATGGGCCAATCG, and is shown as SEQ ID NO. 12; preferably, the probe for GSTP1 is attached to a fluorophore; more preferably, the probe directed to GSTP1 is labeled with ROX fluorescein.
In some embodiments of the invention, the endogenous gene is RPPH and the nucleotide sequence of the amplification primer pair is:
a forward primer: TCATCAGTGGGGCCACGA, as shown in SEQ ID NO: 13;
reverse primer: CTGTTAGGGCCGCCTCTGGC, as shown in SEQ ID NO: 14;
the nucleotide sequence of the probe for RPPH is TGCGTCCTGTCACTCCACTCCCATGT, as shown in SEQ ID NO. 15; preferably, the probe for RPPH is linked to a fluorophore; more preferably, the probe for RPPH is labeled with AlexaFluor680 fluorescein.
The invention relates to a method for detecting DNA methylation of human RASSF1A, ELF, p16 and GSTP1 genes for non-diagnosis and treatment purposes, which comprises the following steps:
s1, carrying out bisulfite treatment on a sample to be detected to obtain a bisulfite modified sample to be detected;
s2, detecting the sample to be detected obtained in the S1 by adopting the PCR detection kit to obtain the DNA methylation levels of the human RASSF1A, ELF, p16 and GSTP1 genes.
Compared with the prior art, the invention has the following beneficial effects:
the early warning method for liver cancer of the invention calculates the risk value by detecting the DNA methylation level of four genes of RASSF1A, ELF, p16 and GSTP1 in peripheral blood, thereby being used for early warning of liver cancer risk, and has the advantages of simple operation, low cost, high sensitivity, accurate result and high conformity between the high-risk warning result and the clinical diagnosis result. Has good application prospect for diagnosing early liver cancer, can improve the sensitivity and specificity of liver cancer diagnosis and increase the survival rate and cure rate of liver cancer patients.
The kit constructed by adopting the multi-target simultaneous detection technology has good specificity and high sensitivity, and provides powerful support for the early warning method of liver cancer.
The invention adopts peripheral blood as a detection sample, the sample is easy to obtain, the molecular detection process is standardized, the establishment of a low-cost and high-flux systematic detection platform is facilitated, the defects of high price, dependence on professional operation, low sensitivity, low specificity and the like in the prior art can be overcome, and the method is suitable for popularization and scale in common laboratories.
Drawings
FIG. 1 is a diagram of ROC curve analysis.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The kit for extracting and converting the free DNA of the blood plasma in the embodiment of the invention is provided by the science and technology limited of the Saan Tianlong.
Example 1
The embodiment discloses a method for detecting DNA methylation of RASSF1A, ELF, p16 and GSTP1 genes in a peripheral blood sample by using the detection kit, which specifically comprises the following steps:
1. separation and preservation of plasma samples: extracting 10mL of peripheral blood of a detected object into an anticoagulation blood collection tube, centrifuging at 3000rpm for 10min to divide the sample into three layers of plasma, white blood cells and red blood cells, taking out the uppermost layer of plasma in the anticoagulation tube into a new centrifugal tube by a liquid transfer device, marking, and storing at 80 ℃.
2. Plasma free dna (cfdna) extraction: plasma free DNA extraction and transformation kit extraction are adopted, and all operations are strictly operated according to kit instructions.
cfDNA transformation: and (3) carrying out bisulfite modification and purification on the extracted cfDNA by adopting a plasma free DNA extraction and conversion kit, and strictly operating according to the kit instruction. Taking 80 mu L of cfDNA extraction product, adding 220 mu L of methylation treatment reagent, and placing on a PCR instrument to complete methylation treatment according to the following conditions: 98 deg.C, 10min, 80 deg.C, 45 min. And (3) eluting and purifying the cfDNA modified by the bisulfite by using a DNA purification column and an elution reagent attached to the kit. After treatment, the methylated/unmethylated C bases were C/U bases, respectively, after bisulfite treatment and C/T bases, respectively, after PCR amplification.
4. And (3) selecting a target gene amplification primer pair: in order to prepare a detection reagent suitable for simultaneously detecting methylated DNA of human RASSF1A, ELF, p16 and GSTP1 genes, the sequence of an amplification region of each gene is respectively selected and a corresponding primer sequence is designed, wherein the primer sequences of the genes are respectively shown in Table 1;
TABLE 1
5. The RASSF1A, ELF, p16 and GSTP1 gene multiple methylation specific PCR reagent formula is shown in Table 2
Shown in the figure:
TABLE 2
| Reagent | Final concentration |
| HS Taq | 0.5-1.5U/40μl |
| 10×Buffer | 1 |
| MgCl2 | 1-3.5mM |
| dNTP | 100-300μM |
| RASSF1A-F | 0.1-0.3μM |
| RASSF1A-R | 0.1-0.3μM |
| RASSF1A-P | 0.1-0.3μM |
| ELF-F | 0.1-0.3μM |
| ELF-R | 0.1-0.3μM |
| ELF-P | 0.1-0.3μM |
| p16-F | 0.1-0.3μM |
| p16-R | 0.1-0.3μM |
| p16-P | 0.1-0.3μM |
| GSTP1-F | 0.1-0.3μM |
| GSTP1-R | 0.1-0.3μM |
| GSTP1-P | 0.1-0.3μM |
| RPPH-F | 0.1-0.3μM |
| RPPH-R | 0.1-0.3μM |
| RPPH-P | 0.1-0.3μM |
| Template DNA | 20μl |
| Deionized water | Make up to 40. mu.l |
The multiplex methylation-specific PCR amplification program of RASSF1A, ELF, p16 and GSTP1 genes is shown in Table 3:
TABLE 3
Ct value calibration method: under the condition of the same reaction system and the same amplification efficiency, the Ct of the target gene is normalized by the expression quantity of the endogenous gene to obtain the Ct value of the target gene after normalization, wherein the calculation formula is as follows:
Ctnormalization＝25-(CtEndogenous gene-CtTarget gene)
Example 2
The embodiment discloses an establishment experiment of the early warning method.
1. Experiment grouping
1.1 training set: 100 peripheral blood samples of patients who were treated for liver disease indirectly between 2018 and 2018, month 1 and month 7.
1.2 verification group: 100 peripheral blood samples of patients who were treated for liver disease indirectly between 2018 and 2019, month 4.
2. Detection of DNA methylation levels of RASSF1A, ELF, p16, and GSTP1 genes in peripheral blood samples: the assay was performed as in example 1.
3. And (3) detection results:
the training group samples comprise peripheral blood samples of patients (40 patients), patients (30 patients), patients (20 patients) without liver fibrosis and normal people (10 patients) with clinical pathological diagnosis of liver cancer, liver cirrhosis and liver fibrosis. The methylation levels of RASSF1, ELF, P16 and GSTP1 genes in the test training set were determined according to the method of example 1, and the methylation detection Ct values of the genes of liver cancer patients, liver cirrhosis patients and chronic patients without liver fibrosis are shown in tables 4, 5, 6 and 7, and the methylation ratios of the genes are shown in Table 8:
TABLE 4
TABLE 5
TABLE 6
TABLE 7
TABLE 8
Formula 6 establishes the determination of the risk threshold:
ROC curve analysis was performed on the training set data, and the results are shown in FIG. 1, giving the formula:
Y＝1.208163-0.00653×Ct(RASSF1A)-0.00751×Ct(ELF)-0.00555×Ct(p16)-0.00457×Ct(GSTP1)；
by ROC curve analysis, the detection sensitivity of the method is 92.5%, the specificity is 93.3%, and the risk threshold is 0.3177.
That is, the methylation level of RASSF1, ELF, P16 and GSTP1 genes is detected to indicate that the threshold value of the risk of suffering from liver cancer is more than 0.3177.
7. Verification group testing and evaluation
The methylation levels of RASSF1, ELF, P16 and GSTP1 genes in the test and verification groups are detected according to the method of example 1, and the risk values are calculated according to the formula Y (1.208163-0.00653 XCt (RASSF1A) -0.00751 XCt (ELF) -0.00555 XCt (P16) -0.00457 XCt (GSTP1), and the results are shown in tables 9-12, wherein the risk values Y of patients clinically diagnosed with liver cancer or at risk of liver cancer are all more than 0.3177. The test results of the verification group show that the risk value is calculated according to the formula of the invention by detecting the DNA methylation level of RASSF1, ELF, P16 and GSTP1 genes, and the early warning of liver cancer can be effectively realized.
TABLE 9
Watch 10
TABLE 11
TABLE 12
Finally, it should be noted that: the above embodiments are only preferred embodiments of the present invention to illustrate the technical solutions of the present invention, but not to limit the technical solutions, and certainly not to limit the patent scope of the present invention; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention; that is, the technical problems to be solved by the present invention, which are not substantially changed or supplemented by the spirit and the concept of the main body of the present invention, are still consistent with the present invention and shall be included in the scope of the present invention; in addition, the technical scheme of the invention is directly or indirectly applied to other related technical fields, and the technical scheme is included in the patent protection scope of the invention.
SEQUENCE LISTING
<110> Saian Tianlong science and technology Co., Ltd
<120> early warning method for liver cancer, detection kit for early warning, and detection method
<130> 20201127
<160> 15
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213> Artificial Synthesis
<400> 1
gggttttgcg agagcgcg 18
<210> 2
<211> 18
<212> DNA
<213> Artificial Synthesis
<400> 2
gctaacaaac gcgaaccg 18
<210> 3
<211> 19
<212> DNA
<213> Artificial Synthesis
<400> 3
gctcttccca gcgcgctca 19
<210> 4
<211> 29
<212> DNA
<213> Artificial Synthesis
<400> 4
ggcgagtggt ttttgataaa attataaat 29
<210> 5
<211> 25
<212> DNA
<213> Artificial Synthesis
<400> 5
acataccacg attaccgaac ccgaa 25
<210> 6
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 6
cggcactcgt acgtcaaccg cg 22
<210> 7
<211> 24
<212> DNA
<213> Artificial Synthesis
<400> 7
ttattagagg gtggggcgga tcgc 24
<210> 8
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 8
gaccccgaac cgcgaccgta a 21
<210> 9
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 10
ttcggggtgt agcggtcgtc 20
<210> 11
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 11
gccccaatac taaatcacga cg 22
<210> 12
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 12
accgggtcgc atgggccaat cg 22
<210> 13
<211> 18
<212> DNA
<213> Artificial Synthesis
<400> 13
tcatcagtgg ggccacga 18
<210> 14
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 14
<210> 15
<211> 26
<212> DNA
<213> Artificial Synthesis
<400> 15
tgcgtcctgt cactccactc ccatgt 26
Claims (10)
1. An early warning method for liver cancer is characterized in that the DNA methylation level of RASSF1A, ELF, p16 and GSTP1 genes in a peripheral blood sample is detected by a PCR method, the risk value of suffering from liver cancer is calculated, and warning is carried out according to the calculation result; the calculation formula is as follows:
Y＝1.208163-0.00653×Ct(RASSF1A)-0.00751×Ct(ELF)-0.00555×Ct(p16)-0.00457×Ct(GSTP1)；
when Y is greater than or equal to 0.3177, it is judged to have high risk of liver cancer, and when Y is less than 0.3177, it is judged to have low risk of liver cancer.
2. The method of claim 1, wherein the Ct (RASSF1A) represents the amplification level of RASSF1A after calibration by endogenous reference,
the Ct (ELF) represents the corrected amplification level of ELF by endogenous reference,
the Ct (p16) represents the calibrated amplification level of p16 with endogenous reference,
the Ct (GSTP1) represents the level of amplification of GSTP1 after calibration by endogenous reference.
3. The kit is characterized by comprising a DNA methylation detection reagent for specifically detecting RASSF1A, ELF, p16 and GSTP1 genes in a peripheral blood sample.
4. The detection kit according to claim 3, further comprising an endogenous gene and an endogenous gene detection reagent; (ii) a Preferably, the endogenous gene is β -actin or RPPH; preferably, the detection kit is a fluorescent PCR detection kit.
5. The test kit of claim 3 or 4, wherein the DNA methylation detection reagent comprises a DNA primer pair and a probe for Methylation Specific PCR (MSP) amplification of promoter regions of RASSF1A, ELF, p16 and GSTP1 genes.
6. The R detection kit according to claim 5, wherein the nucleotide sequence of the amplification primer pair of RASSF1A is:
a forward primer GGGTTTTGCGAGAGCGCG;
a reverse primer GCTAACAAACGCGAACCG;
the probe nucleotide sequence for RASSF1A is GCTCTTCCCAGCGCGCTCA; preferably, the probe for RASSF1A is attached to a fluorophore; more preferably, the probes directed to RASSF1A are labeled with FAM fluorescein.
7. The detection kit of claim 5, wherein the nucleotide sequence of the amplification primer pair of ELF is:
a forward primer GGCGAGTGGTTTTTGATAAAATTATAAAT;
a reverse primer ACATACCACGATTACCGAACCCGAA;
the probe nucleotide sequence for ELF is CGGCACTCGTACGTCAACCGCG; preferably, the probe for ELF is attached with a fluorophore; more preferably the probe for ELF is labelled with HEX fluorescein.
8. The PCR detection kit as claimed in claim 5, wherein the nucleotide sequence of the amplification primer pair of p16 is:
a forward primer TTATTAGAGGGTGGGGCGGATCGC;
reverse primer GACCCCGAACCGCGACCGTAA:
the probe nucleotide sequence aiming at p16 is ACCGCGTAGCTCAGTCCTTA; preferably, the probe for p16 is attached with a fluorophore; more preferably the probe for p16F is labeled CY5 fluorescein.
9. The PCR detection kit as claimed in claim 5, wherein the nucleotide sequence of the amplification primer pair of GSTP1 is:
a forward primer TTCGGGGTGTAGCGGTCGTC;
reverse primer GCCCCAATACTAAATCACGACG:
the nucleotide sequence of the probe against GSTP1 was ACCGGGTCGCATGGGCCAATCG; preferably, the probe for GSTP1 is attached to a fluorophore; more preferably, the probe directed to GSTP1 is labeled with ROX fluorescein.
10. A method for detecting DNA methylation of human RASSF1A, ELF, p16 and GSTP1 genes for non-medical purposes, which is characterized by comprising the following steps:
s1, carrying out bisulfite treatment on a sample to be detected to obtain a bisulfite modified sample to be detected;
s2, detecting the sample to be detected obtained in the S1 by using the PCR detection kit of any one of claims 2 to 9 to obtain the DNA methylation levels of the human RASSF1A, ELF, p16 and GSTP1 genes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011361755.6A CN112280867A (en) | 2020-11-27 | 2020-11-27 | Early warning method for liver cancer, detection kit for early warning and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011361755.6A CN112280867A (en) | 2020-11-27 | 2020-11-27 | Early warning method for liver cancer, detection kit for early warning and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112280867A true CN112280867A (en) | 2021-01-29 |
Family
ID=74425668
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011361755.6A Pending CN112280867A (en) | 2020-11-27 | 2020-11-27 | Early warning method for liver cancer, detection kit for early warning and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112280867A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113337608A (en) * | 2021-06-29 | 2021-09-03 | 中国医学科学院肿瘤医院 | Combined marker for early diagnosis of liver cancer and application thereof |
| CN113943814A (en) * | 2021-11-30 | 2022-01-18 | 苏州美汇医药技术有限公司 | Primer probe composition, kit and method for early screening of liver cancer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102628087A (en) * | 2012-04-25 | 2012-08-08 | 四川大学 | Early warning and screening reagent for liver cancer |
| CN110484621A (en) * | 2019-08-12 | 2019-11-22 | 江苏吉睿生物技术研究院有限公司 | A kind of method of liver cancer early warning |
-
2020
- 2020-11-27 CN CN202011361755.6A patent/CN112280867A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102628087A (en) * | 2012-04-25 | 2012-08-08 | 四川大学 | Early warning and screening reagent for liver cancer |
| CN110484621A (en) * | 2019-08-12 | 2019-11-22 | 江苏吉睿生物技术研究院有限公司 | A kind of method of liver cancer early warning |
Non-Patent Citations (2)
| Title |
|---|
| WENQING HUANG ET AL.: "Analysis of DNA Methylation in Plasma for Monitoring Hepatocarcinogenesis", 《GENETIC TESTING AND MOLECULAR BIOMARKERS》 * |
| 冉贵萍等: "血清GSTP1基因甲基化定量分析在肝细胞癌的早期诊断价值", 《国际检验医学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113337608A (en) * | 2021-06-29 | 2021-09-03 | 中国医学科学院肿瘤医院 | Combined marker for early diagnosis of liver cancer and application thereof |
| CN113337608B (en) * | 2021-06-29 | 2022-08-02 | 中国医学科学院肿瘤医院 | Combined marker for early diagnosis of liver cancer and application thereof |
| CN113943814A (en) * | 2021-11-30 | 2022-01-18 | 苏州美汇医药技术有限公司 | Primer probe composition, kit and method for early screening of liver cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105671181B (en) | Gene marker, primer, probe and kit for detecting lung cancer | |
| EP3249051B1 (en) | Use of methylation sites in y chromosome as prostate cancer diagnosis marker | |
| CN110484624B (en) | Gastric cancer biomarker based on peripheral blood and detection method and application thereof | |
| CN107435062B (en) | Peripheral blood gene marker for discriminating benign and malignant pulmonary nodules and application thereof | |
| CN112280867A (en) | Early warning method for liver cancer, detection kit for early warning and detection method | |
| CN113337608B (en) | Combined marker for early diagnosis of liver cancer and application thereof | |
| CN109837344A (en) | The EphA7 nucleotide fragments and its detection method of a kind of methylation and application | |
| CN117512118A (en) | Primer probe composition, kit and method for detecting deletion mutation of 19 th exon of human EGFR gene | |
| CN116751865A (en) | Kit for detecting KMT2A-PTD fusion gene, method and application thereof | |
| CN111549137B (en) | Genetic molecular marker related to gastric cancer auxiliary diagnosis and application thereof | |
| CN108998528B (en) | Lung cancer diagnosis molecular marker lncRNA LINC00516, kit and application thereof | |
| CN114410795A (en) | Liver cancer early detection based on miRNA (micro ribonucleic acid) feature marker | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| US11807908B2 (en) | Genetic markers used for identifying benign and malignant pulmonary micro-nodules and the application thereof | |
| CN117701720B (en) | Cervical cancer CLIP3 gene methylation detection reagent and kit | |
| CN114134231B (en) | Brain glioma gene marker based on ecDNA and application thereof | |
| CN118685526B (en) | PCR primer probe combination and kit for diagnosing methylation of lung cancer genes and application of kit | |
| CN114395623B (en) | Gene methylation detection primer composition, kit and application thereof | |
| CN116287252B (en) | Application of long-chain non-coding RNA APCDD1L-DT in preparation of pancreatic cancer detection products | |
| CN117701721B (en) | Detection reagent and kit for methylation of SOX1-SEPTIN9-TAC1 gene of cervical cancer | |
| CN113528657B (en) | Composition for detecting esophageal cancer, kit and application thereof | |
| CN114634981B (en) | Liver cancer gene methylation detection primer probe combination, kit and application thereof | |
| CN111088358B (en) | Colorectal cancer molecular marker combination, application thereof, primer group and detection kit | |
| CN108676888B (en) | Reagent kit and system for predicting susceptibility of lung malignant tumor | |
| CN109295228B (en) | Kit for detecting lung cancer related mutant gene in plasma free DNA and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210513 Address after: Room 501, building 07, northwest Suzhou nano City, 99 Jinjihu Avenue, Suzhou Industrial Park, Suzhou 215120, Jiangsu Province Applicant after: SUZHOU TIANLONG BIOTECHNOLOGY Co.,Ltd. Address before: No.389, Zhuhong Road, economic and Technological Development Zone, Xi'an, Shaanxi 710018 Applicant before: XI'AN TIANLONG SCIENCE & TECHNOLOGY Co.,Ltd. |
|
| TA01 | Transfer of patent application right | ||
| CB02 | Change of applicant information |
Address after: Building NE-33, Northeast Area, Suzhou Nano City, No. 99, Jinjihu Avenue, Suzhou Industrial Park, Jiangsu 215123 Applicant after: SUZHOU TIANLONG BIOTECHNOLOGY Co.,Ltd. Address before: Room 501, building 07, northwest Suzhou nano City, 99 Jinjihu Avenue, Suzhou Industrial Park, Suzhou 215120, Jiangsu Province Applicant before: SUZHOU TIANLONG BIOTECHNOLOGY Co.,Ltd. |
|
| CB02 | Change of applicant information |