CN116217685A

CN116217685A - Method for obtaining tobacco with leaf shape changed and low nicotine content by knocking out tobacco NtLNP1 gene and application

Info

Publication number: CN116217685A
Application number: CN202310004217.9A
Authority: CN
Inventors: 孔维松; 向海英; 宋春满; 曾婉俐; 薛朝阳; 杨国荣; 许力; 许�永; 邓乐乐; 米其利; 高茜
Original assignee: China Tobacco Yunnan Industrial Co Ltd
Current assignee: China Tobacco Yunnan Industrial Co Ltd
Priority date: 2023-01-03
Filing date: 2023-01-03
Publication date: 2023-06-06

Abstract

The invention discloses a method for knocking out tobacco NtLNP1 gene to obtain tobacco with changed leaf shape and low nicotine content and application thereof. A gene related to nicotine anabolism and leaf shape regulation of tobacco, which is a NtLNP1 gene. The CRISPR/Cas9 editing vector for knocking out the NtLNP1 gene is constructed by a CRISPR/Cas9 mediated gene editing technology, and an edited plant for knocking out the NtLNP1 gene is obtained after editing material creation and molecular detection identification. The leaf shape of the edited plant was oval, and was significantly changed from the control leaf shape. The detection by gas chromatography-mass spectrometry shows that the nicotine content of leaves in the bud period of the NtLNP1 gene knockout editing plant is obviously lower than that of a control plant. The application provides genetic materials and theoretical basis for the function research of the nicotine metabolic gene of the tobacco and the directional improvement of new tobacco varieties with adjustable nicotine content.

Description

Method for obtaining tobacco with leaf shape changed and low nicotine content by knocking out tobacco NtLNP1 gene and application

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a method for knocking out tobacco NtLNP1 genes to obtain tobacco with changed leaf shape and low nicotine content and application thereof.

Background

In recent years, a number of important genes related to nicotine synthesis, transport and transformation have been cloned successively, and have produced an important pushing effect on the study of nicotine anabolism mechanism and the genetic breeding work of tobacco. From the 30s of the 20 th century, it was found in 1969 that nicotine levels were controlled by two unlinked gene loci, termed Nic1 and Nic2 after 1994, and a number of studies demonstrated that these two loci control gene expression associated with nicotine biosynthesis. Studies with the condensation reaction of the Guan Yanjian pyrrolidine ring moiety and the pyridine ring moiety show that the PIP family member isoflavone reductase gene a622 of NADPH dependent reductase and its homologous genes are involved in this process, as are the berberine bridging enzyme family member BBL genes. The synthesis of nicotine is regulated by a variety of factors, and plant hormones known to be involved in the regulation of nicotine metabolism mainly include jasmonic acid, auxin and ethylene, wherein auxin and ethylene are negative regulators of nicotine synthesis, and research is focused on the regulation of the jasmonic acid signal pathway. The jasmonic acid pathway regulatory factors COI1 and JAZ proteins of tobacco are proved to be nicotine synthesis regulatory factors, and at present, transcription factors regulating nicotine synthesis, such as homologous genes of ERF transcription factor family members JAP1, ERF32 and ORC1, and the like, bHLH transcription factor family members bHLH1/2 and MYC, and the like, are also identified, and meanwhile, the transcription factors can influence nicotine metabolic processes through mutual regulation.

Although the nicotine metabolic pathway of tobacco is basically clear and most of the metabolic steps have some functional genes separated and identified, the homologous genes of these functional genes in tobacco are far from fully discovered, and especially common tobacco is a polyploid plant, and about 5 homologous genes are present in each gene, so that a great deal of work is still needed to be carried out for the study of the nicotine metabolic functional genes.

Disclosure of Invention

The invention aims to solve the technical problem of providing a method for knocking out a tobacco NtLNP1 gene to obtain tobacco with changed leaf shape and low nicotine content and application thereof, and provides germplasm resources for researching the function of a tobacco nicotine metabolic gene and directionally improving cultivated tobacco varieties.

The technical problems to be solved by the invention are realized by the following technical scheme:

a gene related to tobacco nicotine anabolism and leaf shape regulation is a NtLNP1 gene, and the sequence of the gene is SEQ ID No.1.

Preferably, the sequence of the NtLNP1 gene is translated to encode a protein having the sequence of SEQ ID No.2.

A method of knocking out tobacco NtLNP1 gene to obtain leaf shape altered and reduced nicotine content tobacco, the knocking out being by CRISPR/Cas9 system knocking out tobacco NtLNP1 gene, the method comprising the steps of:

(1) Designing a sgRNA guide sequence and constructing a sgRNA expression vector;

(2) Obtaining a T0 generation editing material through genetic transformation;

(3) The T0 generation plant is subjected to selfing homozygosity to obtain a homozygously edited material;

(4) And (5) planting the homozygous untagged material, and observing the characters of the homozygous untagged material.

Preferably, in step (1), the CRISPR/Cas9 system employs a sgRNA sequence of ATATCCATCCATTCAAGCGATGG, and the sgRNA sequence employs a primer sequence of:

the upstream primer sgRNA-F: GATTGATATCCATCCATTCAAGCGA;

the downstream primer sgRNA-R: AAACCTCGCTTGAATGGATGGATAT.

Preferably, the step (1) specifically comprises:

designing an sgRNA guide sequence, annealing an upstream primer sgRNA-F and a downstream primer sgRNA-R to form a double chain, and performing restriction enzyme digestion on a CRISPR/Cas9 vector pORE-Cas9 by using restriction enzyme BsaI-HF; connecting the double-stranded product formed by annealing with the carrier skeleton cut by enzyme by using T4 ligase; and (3) converting the connection product into competent cells of escherichia coli, detecting to obtain positive clones, and extracting the recombinant plasmid to obtain the CRISPR-Cas9 expression vector.

Preferably, the step (2) specifically comprises:

and soaking and infecting tobacco leaf discs with agrobacterium tumefaciens LBA4404 bacterial liquid carrying a CRISPR/Cas9-sgRNA expression vector, obtaining a T0 generation plant, performing target editing detection to obtain a plant edited by the NtLNP1 gene, and harvesting to obtain a T0 generation seed.

Preferably, the step (3) specifically comprises:

and carrying out selfing homozygous propagation planting on the T0 generation seeds, carrying out target editing detection to obtain plants subjected to homozygous editing on the NtLNP1 genes, and collecting the seeds to obtain the T1 generation seeds.

Use of a gene related to anabolism and leaf shape regulation of tobacco nicotine in creating new varieties of tobacco with altered leaf shape and reduced nicotine content.

Use of a method for knocking out the NtLNP1 gene of tobacco to obtain a tobacco with altered leaf shape and reduced nicotine content in creating a new variety of tobacco with altered leaf shape and reduced nicotine content.

Preferably, the length of the waist leaf of the new tobacco variety plant created by knocking out the tobacco NtLNP1 gene is obviously shorter than that of a control plant, the width of the waist leaf is wider than that of the control plant, the leaf shape is changed from oblong to elliptical, the leaf shape is short and wide, and the length-width ratio of the waist leaf is smaller than that of the control plant; meanwhile, the nicotine content of leaves 7 days after topping of the new plant with the NtLNP1 gene knocked out is lower than that of a control plant.

The technical scheme of the invention has the following beneficial effects:

the invention constructs a CRISPR/Cas9 editing vector for knocking out the NtLNP1 gene by a CRISPR/Cas9 mediated gene editing technology, and obtains a safflower Dajinyuan editing plant with the NtLNP1 gene knocked out after editing material creation and molecular detection and identification.

The leaf shape of the tobacco nicotine metabolism related gene NtLNP1 and the NtLNP1 gene knockout editing plant provided by the invention is elliptical, and is obviously changed compared with the leaf shape of a control leaf shape (oblong shape).

According to the tobacco nicotine metabolism related gene NtLNP1 provided by the invention, through gas chromatography-mass spectrometry combined detection, the leaf nicotine content of the NtLNP1 gene knockout editing plant in the bud period is obviously lower than that of a control plant.

In conclusion, the CRISPR/Cas9 mediated gene editing technology is utilized to knock out the NtLNP1 gene to obtain editing materials with reduced nicotine content and changed leaf shape, so that genetic materials and theoretical basis are provided for the functional research of the nicotine metabolic genes of tobacco and the directional improvement of new tobacco varieties with adjustable and controllable nicotine content.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description, serve to explain the principles of the invention.

FIG. 1 is a comparison of the main agronomic traits of the edited plants of the present invention versus a control (unedited).

FIG. 2 is a comparison of leaf shapes of edited plants of the present invention with control (unedited).

FIG. 3 is an annotation of the up-regulated differential gene KEGG of the edited plants of the invention versus the control (unedited).

FIG. 4 is a schematic representation of the present invention editing plants and control (unedited) downregulated differential gene KEGG annotation.

Detailed Description

Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that: the relative arrangement of the components and steps, numerical expressions and numerical values set forth in these embodiments do not limit the scope of the present invention unless it is specifically stated otherwise.

All experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the following examples were commercially available unless otherwise specified.

EXAMPLE 1 acquisition of the NtLNP1 Gene

The whole strain of the cultivated strain tobacco safflower Dajinyuan is used as an experimental material, the total RNA of the tobacco root is extracted by using an RNA extraction kit, and is reversely transcribed into cDNA for standby use:

extracting total RNA of tobacco according to the instruction of the plant RNA extraction kit.

1 μg total RNA extracted from leaf for reverse transcription was as follows:

Total RNA 1μg；

Oligo(dT)(10μM) 1.5μL；

ddH ₂ O up to 15μL。

mixing the above systems, placing in PCR, maintaining at 70deg.C for 5min, removing, immediately placing on ice for 5min, and adding the following reagents:

placing the above system into a PCR instrument, keeping temperature at 42deg.C for 65min, 65deg.C for 10min, and 4deg.C, and storing in a refrigerator at-20deg.C.

By a homology comparison method, referring to the sequence of the Arabidopsis gene and the sequence of the known tobacco part gene, the amplification primer sequence is designed as follows:

F：5’-ATGACACTAAGCAAGTACTTTTAC-3’(SEQ ID No.3)；

R：5’-TCAAAGACTTTGATAGAGTTCC-3’(SEQ ID No.4)。

PCR amplification was performed using the cDNA prepared as described above as a template and the above primers:

amplification system (50 μl):

and (3) carrying out PCR amplification after uniformly mixing and centrifuging, wherein the PCR reaction conditions are as follows: 30 cycles of 95℃10sec,52℃30sec,72℃2 min; 72 ℃ for 10min; hold at 25 ℃.

And (3) purifying and sequencing the amplified product to obtain a gene NtLNP1 sequence related to tobacco nicotine metabolism, wherein the base sequence of the gene is shown as SEQ ID No.1 and totally comprises 1263 bases. After the gene sequence is translated, the coded protein sequence is shown as SEQ ID No.2, and comprises 420 amino acid residues, and further, the comparison analysis shows that the protein contains a sequence with high homology and is highly conserved.

EXAMPLE 2 construction of expression vectors

The present invention further constructs a CRISPR/Cas9 vector using the nicotine metabolism related gene NtLNP1 obtained in example 1.

(1) Design and synthesis of sgRNA sequence of NtLNP1 gene:

the on-line software CRISPR-P2.0 (http:// cbi. Hzau. Edu. Cn/CRISPR /) is used for designing the sgRNA guide sequence, and the guide sequence with higher score and positioned at the proper position of the NtLNP1 gene sequence is selected. The sgRNA sequences selected in this application are: ATATCCATCCATTCAAGCGATGG (SEQ ID No. 5).

(2) Forward and reverse primers of sgRNA sequences were designed and submitted to synthesis by design company: the upstream primer sgRNA-F: GATTGATATCCATCCATTCAAGCGA (SEQ ID No. 6) and the downstream primer sgRNA-R: AAACCTCGCTTGAATGGATGGATAT (SEQ ID No. 7);

(3) Primer annealing: the synthesized target sequence primers (upstream primer and downstream primer) were sterilized with ddH ₂ O is diluted to 100 ng/. Mu.L, then 5. Mu.L of each of the upstream and downstream primers is taken and mixed into a PCR tube uniformly, and the mixture is placed on a PCR instrument for annealing, so that the upstream and downstream Oligo single chains are annealed to form double chains.

The annealing procedure of the PCR instrument is as follows: 95℃for 2min, -0.1 ℃/8s, annealed to 25℃and the annealed product diluted to 10 ng/. Mu.L with 90. Mu.L sterile water.

(4) Enzyme digestion and ligation

a. The CRISPR/Cas9 vector, port-Cas 9 (supplied by university of southwest) was digested with restriction enzyme BsaI-HF.

Enzyme cleavage System (50. Mu.L):

and (3) performing enzyme digestion at 37 ℃ overnight, performing agarose gel electrophoresis at 1.5%, cutting a target fragment strip, and recovering a framework fragment by using a gel recovery kit.

b. Connection

And (3) connecting the double-chain product formed by annealing with the carrier framework which is cut by the enzyme.

Ligation system (10 μl):

the connection conditions are as follows: the connection was carried out at 16℃for 2 hours.

(5) Transformation of E.coli:

a. Trans-T1 competent cells were removed from-80℃and frozen and thawed on ice, and divided into 50. Mu.L/serving;

b. after the competent cells are melted, 10 mu L of the connection product is added into the competent cells, and the mixture is gently mixed and ice-bathed for 10min;

c. after ice bath, placing the mixture into a water bath kettle at 42 ℃ for heat shock for 90s, and rapidly placing the competence back on ice for standing for 2min.

d. mu.L of the transformation product was uniformly spread on LB solid medium containing 16mg/L kanamycin, and cultured in a bacterial incubator at 37℃for 12 hours.

(6) Positive clone screening:

a. when the flat plate grows out of the monoclonal, E.coli monoclonal is selected and put into a kanamycin LB liquid culture medium containing 50mg/L, and shaking is carried out on a shaking table at 37 ℃ overnight;

b. taking part of bacterial liquid to carry out bacterial liquid PCR, and detecting whether positive cloning exists through nucleic acid electrophoresis;

c. and extracting the escherichia coli plasmid from the remaining part of the bacterial liquid which is detected to be positive clone. The plasmid was sent to Nostoc origin for sequencing to confirm the correctness of the positive clones.

Example 3T0 Generation plant acquisition and detection

(1) Transformation of Agrobacterium

The CRISPR/Cas9-NtLNP1 editing vector plasmid constructed in the previous step is used for genetic transformation and tissue culture by taking safflower Dajinyuan as an example to obtain a plant with the gene NtLNP1 related to tobacco nicotine metabolism knocked out and edited, and the related experimental process is briefly described as follows.

And (3) after the surfaces of the tobacco seeds are disinfected, dibbling the tobacco seeds on an MS culture medium, growing until 4 cotyledons (15-20 d) are grown, transferring the cotyledons into a culture bottle containing an MS solid culture medium, and continuously culturing for 35-40d at the temperature of 25+/-1 ℃ under the condition that the illumination intensity is 30-50 mu mol/(m 2 s) and the illumination time is 16h/d for standby.

The plasmid with correct sequence is transformed into agrobacterium, and the specific steps are as follows:

(1) LBA4404 stored at-80℃was removed and competent Agrobacterium cells were electrotransformed and frozen and thawed on ice.

(2) When the competence was just thawed, 2 μl of CRISPR/Cas9-NtLNP1 editing vector plasmid was added, mixed well and placed on ice.

(3) Transferring the uniformly mixed competence into a precooled electric rotating cup, placing the electric rotating cup into an electric rotating instrument for conversion, adding 1mL of YEB liquid culture medium and conversion liquid for mixing after conversion is finished, and placing the mixture into a shaking table at 28 ℃ for culturing at 200rpm for 1.5-2h.

(4) The medium was centrifuged at 8,000rpm, the supernatant was discarded, and 200. Mu.L of YEB liquid medium was used to suspend the cells, which were spread on YEB solid medium containing 50mg/L rifampicin, 50mg/L streptomycin and 50mg/L kanamycin, and inverted dark culture was performed at 28℃for 2-3d.

(2) Infection of callus

(1) In ultra-clean workPreparation of tobacco leaf discs in a bench square leaf discs with side length of 1 cm. Agrobacterium colony-forming suspension containing CRISPR/Cas9-NtLNP1 editing vector was prepared with MS liquid (OD ₆₀₀ ＝0.6-0.8)。

(2) And soaking and infecting tobacco leaf discs for 10min by using suspension agrobacterium liquid.

(3) The leaf discs were placed on MS solid medium containing 2.0mg/L NAA+0.5 mg/L6-BA, at 28℃in the dark, and co-cultured for 3d.

(4) Subculturing was performed and placed on MS solid medium containing 2.0mg/L NAA+0.5 mg/L6-BA+250 mg/LCb+50mg/L Kan.

The culture conditions are as follows: culturing at 28deg.C for 16h/d with light intensity of 30-50 μmol/(m2.s), culturing at 25deg.C in dark for 8h/d, culturing for 45-60d until differentiation bud forms, and changing differentiation culture medium for 3-4 times every 7-10 d; culturing until differentiation buds are formed; cutting off the callus formed by the existing differentiation buds, placing the callus on an MS culture medium containing 500mg/L carbenicillin and 50mg/L kanamycin for culture, and culturing for 8-14 days when the differentiation buds on the callus grow to 2-4cm high under the condition consistent with the differentiation culture condition; rooting and culturing regenerated plants, cutting off differentiated buds, inserting the cut off differentiated buds into an MS culture medium containing 500mg/L of carbenicillin and 50mg/L of kanamycin for rooting and culturing, wherein the culture conditions are consistent with the differentiation culture conditions, culturing for 20-30d, regenerating and transplanting the regenerated plants to a flowerpot for culturing, sampling leaves of the transformed plants, and carrying out molecular detection on the large genes, wherein the detection primers are as follows: the upstream primer NtLNP1-F: TGGCATCACGATCGTATCCAG (SEQ ID No. 8) and the downstream primer NtLNP1-R: GCGTTGTTTCTTGGTGGAACTT (SEQ ID No. 9).

Example 4 acquisition of homozygous editing Material

The T0 generation seed is subjected to selfing homozygous propagation according to 23 times, when the plant grows to 5-6 leaves, the leaves of the single plant are sampled, and the large gene is sent for molecular detection, wherein the detection primers are as follows: the upstream primer NtLNP1-F: TGGCATCACGATCGTATCCAG (SEQ ID No. 8) and the downstream primer NtLNP1-R: GCGTTGTTTCTTGGTGGAACTT (SEQ ID No. 9) to confirm that plants in which homozygous editing of the NtLNP1 gene occurs are obtained, and then the T1 generation seeds in which homozygous editing of the NtLNP1 gene occurs are harvested.

Example 5 Material planting and trait investigation

The plant seeds determined to be homozygous knocked out by the molecular detection in the example 4 are cultivated in a potting mode for propagation and planting, 60 plants are planted, topping is carried out in the full bloom stage, and the characteristic indexes such as plant height, waist leaf length, waist leaf width, stem circumference, pitch and the like are measured and analyzed by referring to YCT 142-2010 tobacco agronomic character investigation and measurement method 7 days after topping.

The tobacco plants 7 days after topping are subjected to statistics analysis, wherein index data such as plant height, waist leaf length, waist leaf width, stem circumference, effective leaf number and pitch of 10 tobacco plants are collected.

The results show that the plant height, the leaf number, the stem circumference, the pitch and the like of the plant homozygous for the NtLNP1 gene are obviously different from those of the control safflower Dajinyuan, the waist leaf length is obviously shorter than that of the control, the waist leaf width is obviously wider than that of the control, and the plant homozygous for the NtLNP1 gene is obviously characterized by changed leaf shape from oblong to elliptical, has the characteristics of short and wide, and the waist leaf length-width ratio is 2.07 (control 2.40). The control and NtLNP1 gene homozygously edit the major trait pairs of tobacco plants such as shown in figure 1 and leaf pairs such as shown in figure 2.

EXAMPLE 6GC-MS detection

The edited plants grown in example 5 were used, followed by GC-MS testing of nicotine content in the leaves 7 days after topping of the NtLNP1 gene homozygous knockout material.

Selecting tobacco plants 7 days after topping, collecting 5 control (unedited) tobacco plant samples, and collecting leaves at the same leaf position; selecting tobacco plants 7 days after topping, and collecting tobacco plant samples of homozygous editing of 5 NtLNP1 genes; removing main ribs of the leaves, wrapping tinfoil paper with liquid nitrogen, preserving and transporting, preserving at ultralow temperature (-70 ℃) in a laboratory, freeze-drying, grinding and sieving.

Weighing 0.2g of sample in a 15mL centrifuge tube to be accurate to 0.1mg, adding 2.0mL of 5% sodium hydroxide solution, respectively adding 0.05mL of internal standard solution A (dimethyl quinoline solution, methanol preparation, methylene dichloride dilution to 1.0 mg/mL) and internal standard solution B (2, 2' -bipyridine-d 2 solution, methanol preparation, methylene dichloride dilution to 0.5 mg/mL), shaking and mixing uniformly, standing for 20min, adding 10.0mL of extraction solution (mixing methylene dichloride and methanol according to the volume ratio of 4:1), sealing, shaking and extracting at the speed of 2000r/min for 40min, centrifuging for 8min, transferring the lower organic phase into a chromatographic bottle, and performing GC-MS analysis.

The gas chromatography reference conditions were: chromatographic column: DB-35MS or equivalent column effect capillary chromatographic column, the specification is: 30mm (length) ×0.25mm (inner diameter) ×0.25m (film thickness); sample inlet temperature: 250 ℃; column flow rate: 1.0mL/min; nicotine sample injection volume: 1.0L, split sample introduction, and split ratio of 40:1; other alkaloid sample injection volumes: 2.0L, split sample introduction, wherein the split ratio is 10:1; heating program: the initial temperature is 100 ℃, and the temperature is kept for 3min; raising the temperature to 260 ℃ at a rate of 8 ℃/min and keeping the temperature for 10min.

Mass spectrometry reference conditions: transmission line temperature: 280 ℃; ionization mode: an electron bombardment source (EI); ionization energy: 70eV; ion source temperature: 230 ℃; solvent delay: 8min; the measurement method comprises the following steps: ion monitoring mode (SIM) scanning is selected.

Control (unedited) and NtLNP1 gene homozygous edited tobacco plants were compared for leaf nicotine content 7 days after topping (results are shown in table 1).

The results show that: the leaf nicotine content of the NtLNP1 gene knockout editing plant 7 days after topping is found to be significantly lower than that of the control plant through gas chromatography-mass spectrometry (GC-MS) combined detection. The method provides genetic materials and theoretical basis for the study of the functions of tobacco nicotine metabolism and leaf shape regulation genes and the study of new tobacco variety cultivation.

Table 1 shows alkaloid content (μg/g) of fresh tobacco leaves 7 days after topping of the edited plants of the invention and the control (unedited)

Example 7 transcriptome analysis

Collecting 10-13 leaf fresh tobacco leaves 7 days after topping, quick freezing with liquid nitrogen, and sending to sequencing company for RNA extraction, cDNA library construction and sequencing. After sequencing, the data is filtered, mainly by removing Reads with low quality of sequencing, repeat and containing linkers, to obtain clean Reads. High quality Clean Reads are the basis for downstream analysis. The clear Reads were aligned with the cultivated tobacco reference genome (https:// solgenomics. Net /) using TopHat2 to obtain positional information on the reference genome or gene, as well as sequence characterization information specific to the sequenced samples. TopHat2 is based on the alignment software Bowtie2, transcriptome sequencing Reads are aligned to genes, and splice junctions between exons are identified by analysis of the alignment.

GO functional enrichment analysis was performed on the differential gene set using clusteriprofile software. GO (Gene Ontology) is a comprehensive database describing gene function and can be divided into three parts, biological process (biological process) and cellular composition (cellular component) molecular function (Molecular Function). GO functional enrichment takes a padj less than 0.05 as the threshold for significance enrichment. From the GO enrichment analysis result, selecting the most obvious 30 terminators to draw a histogram for display, and if the number of the terminators is less than 30, drawing all the terminators.

The middle leaf transcriptome sequencing results 7 days after topping showed that the NtLNP1 gene homozygous edited tobacco plants were co-screened for 3319 Differentially Expressed Genes (DEGs) compared to the control, with 2516 up-regulated genes and 803 down-regulated genes. GO and KEGG functional enrichment assays were performed on up-and down-regulated DEGs, respectively. In the GO enrichment analysis, the differential genes were significantly enriched on 52 GO terminals, with "cell perithery", "cell wall" and "external encapsulating structure" enriched to the highest degree in up-regulated DEGs, and "nucleosome", "protein-DNA complex" and "DNA packaging complex" enriched to the highest degree in down-regulated DEGs. In the KEGG analysis, "Plant-pathogen interaction" was significantly enriched in the up-regulated genes, "statin, suberine and wax biosynthesis", "MAPK signaling pathway-Plant", "Nitrogen metabolism" was significantly enriched in the down-regulated genes. Enrichment analysis of DEGs showed that NtLNP1 may reduce the amount of nicotine synthesis by decreasing the biosynthesis of cutin, lignan and wax, decreasing MAPK cascade, and decreasing nitrogen metabolism (as shown in fig. 3, 4).

Although the present invention has been described with reference to the above embodiments, it should be understood that the present invention is not limited thereto, and that various changes and modifications may be made by those skilled in the art without departing from the spirit and scope of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. The gene related to tobacco nicotine anabolism and leaf shape regulation is characterized in that the gene related to tobacco nicotine anabolism and leaf shape regulation is a NtLNP1 gene, and the sequence of the gene is SEQ ID No.1.

2. The gene related to anabolism and leaf shape control of tobacco as recited in claim 1, wherein the sequence of the NtLNP1 gene is translated to encode a protein having the sequence of SEQ ID No.2.

3. A method of knocking out tobacco NtLNP1 gene to obtain a leaf shape altered and reduced nicotine content tobacco, wherein the knocking out is by CRISPR/Cas9 system knocking out tobacco NtLNP1 gene, the method comprising the steps of:

(2) Obtaining a T0 generation editing material through genetic transformation;

4. The method of claim 3, wherein in step (1), the CRISPR/Cas9 system employs the sgRNA sequence ATATCCATCCATTCAAGCGATGG as primer sequence:

the upstream primer sgRNA-F: GATTGATATCCATCCATTCAAGCGA;

the downstream primer sgRNA-R: AAACCTCGCTTGAATGGATGGATAT.

5. The method of obtaining tobacco with altered leaf shape and reduced nicotine content by knocking out the tobacco NtLNP1 gene according to claim 4, wherein step (1) is specifically:

6. A method of knocking out tobacco NtLNP1 gene to obtain a tobacco with altered leaf shape and reduced nicotine content according to claim 3, characterized in that step (2) is specifically:

7. A method of knocking out tobacco NtLNP1 gene to obtain a tobacco with altered leaf shape and reduced nicotine content according to claim 3, characterized in that step (3) is specifically:

8. Use of a gene related to anabolism of tobacco nicotine and to regulation of leaf shape according to any one of claims 1-2 for creating new varieties of tobacco with altered leaf shape and reduced nicotine content.

9. Use of a method of knocking out the tobacco NtLNP1 gene to obtain a tobacco with altered leaf shape and reduced nicotine content according to any one of claims 3-7 in the creation of a new variety of tobacco with altered leaf shape and reduced nicotine content.

10. The use according to claim 8 or 9, wherein the new variety of tobacco plants created by knocking out the tobacco NtLNP1 gene have significantly shorter waist leaf length than the control plants and have a waist leaf width that is wider than the control plants, the leaf shape changing from oblong to elliptical, the leaf shape being short and wide and the waist leaf aspect ratio being smaller than the control plants; meanwhile, the nicotine content of leaves 7 days after topping of the new plant with the NtLNP1 gene knocked out is lower than that of a control plant.