CN115896168A - Method for rapidly obtaining and cultivating nicotine transformed tobacco plant and application - Google Patents

Abstract

The invention discloses a method for quickly obtaining a tobacco nicotine transformant for cultivation and application thereof. The method for quickly obtaining and cultivating the tobacco nicotine transformation strain is characterized in that genes related to tobacco nicotine transformation are knocked out by using a CRISPR/Cas9 system, the genes are NtNCP1 and NtNCP2 genes, the sequence of the NtNCP1 gene is shown in SEQ ID No.1, and the sequence of the NtNCP2 gene is shown in SEQ ID No. 3. The tobacco NtNCP1 and NtNCP2 genes are knocked out simultaneously by using a CRISPR/Cas9 mediated gene editing technology to obtain an editing material with reduced nicotine content and increased nornicotine content, so that a genetic material and a theoretical basis are provided for the function research of a tobacco nicotine transformation gene and the directional improvement of a new tobacco variety regulated by nicotine content.

Description

Method for rapidly obtaining and cultivating nicotine transformed tobacco plant and application

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a method for quickly obtaining a nicotine transformant of a cultivated tobacco and application thereof.

Background

The tobacco alkaloid mainly comprises 4 main alkalis of nicotine, nornicotine, anatabine and anabasine, and the composition and content of the tobacco alkaloid are important for the quality and safety of tobacco leaves. The nicotine content of tobacco is above 94% and the proportion of nicotine reducing is not more than 2.5%. In the tobacco plant population of the cultivated varieties, some plants form nicotine demethylase due to gene mutation, and nicotine is demethylated under the action of the demethylase to form nornicotine, so that the content of the nornicotine is obviously increased, and the content of the nicotine is obviously reduced. Such plants are referred to as transformants. Nornicotine is susceptible to oxidation, acylation and nitrosation reactions to form myosmine, acyl nornicotine and nitrosonornicotine (NNN), the formation of which has a significant adverse effect on the flavor and safety of tobacco leaves.

At present, genes CYP82E5v2, CYP82E10 and CYP82E have been isolated and identified to catalyze the conversion of nicotine to nornicotine. Under normal cultivation conditions, part of tobacco plants can generate gene mutation to obtain nicotine transformants, but the mutant genes are difficult to determine through natural mutation, main agronomic characters are not changed, and breeding is difficult.

Disclosure of Invention

The invention aims to solve the technical problem of providing a method for quickly obtaining a tobacco nicotine transformation plant and application thereof, which provide a theoretical basis for researching the function of a tobacco nicotine transformation gene and directionally improving the variety of the tobacco to be cultivated.

The technical problem to be solved by the invention is realized by the following technical scheme:

a method for quickly obtaining a tobacco nicotine transformant for cultivation is characterized in that genes related to tobacco nicotine transformation are knocked out by using a CRISPR/Cas9 system, the genes are NtNCP1 and NtNCP2 genes, the NtNCP1 gene sequence is shown as SEQ ID No.1, and the NtNCP2 gene sequence is shown as SEQ ID No. 3.

Preferably, after the sequence of the NtNCP1 gene is translated, the sequence of the encoded protein is shown as SEQ ID No. 2.

Preferably, after the sequence of the NtNCP2 gene is translated, the sequence of the encoded protein is shown as SEQ ID No. 4.

Preferably, the method comprises the following steps:

(1) Creating an editing material in the T0 generation;

(2) The T0 generation plant is subjected to inbreeding homozygosis to obtain a homozygous editing material;

(3) Planting homozygous editing materials and observing characters;

(4) And detecting the alkaloid content of leaves 14 days after topping of NtNCP1 and NtNCP2 gene homozygous knockout materials by GC-MS, and calculating the nicotine conversion rate.

Preferably, in step (1), the sgRNA sequence used in the CRISPR/Cas9 system is TCATAATGCATATAGGTTGGAGG, and the primer sequence used in the sgRNA sequence is:

an upstream primer sgRNA-F: gattgtcatatatgcatatgg;

a downstream primer sgRNA-R: AAACCCAAACCTATATGCATTATGA.

Preferably, in the step (1),

the primer sequences adopted by the editing detection of the NtNCP1 target point are as follows:

the upstream primer NtNCP1-F: CCATCAGAAGCACCACAAA;

the downstream primer NtNCP1-R: TGCTCTGGTTCTTCGGCTAAG;

the primer sequences adopted by the editing detection of the NtNCP2 target point are as follows:

the upstream primer NtNCP2-F: CCATCAGAAGCACCACAAA;

the downstream primer NtNCP2-R: GCGTTTATTTGCTCCGGTTCTT.

Preferably, step (1) is specifically:

designing a sgRNA guide sequence, annealing an upstream primer sgRNA-F and a downstream primer sgRNA-R to form a double strand, and digesting a CRISPR/Cas9 vector pORE-Cas9 by using a restriction endonuclease BsaI-HF; connecting the double-chain product formed by annealing and the carrier skeleton which is well cut by enzyme by using T4 ligase; the ligation product is transformed into an escherichia coli competent cell, positive clone is obtained through detection, recombinant plasmid is extracted, and a CRISPR-Cas9 expression vector is obtained;

soaking and infecting a tobacco leaf disc with agrobacterium LBA4404 bacterial liquid carrying a CRISPR/Cas9-sgRNA expression vector to obtain a T0 generation plant, obtaining a plant with NtNCP1 and NtNCP2 genes simultaneously edited through target point editing and detection, and harvesting to obtain a T0 generation seed.

The step (2) is specifically as follows: carrying out selfing homozygous propagation planting on the T0 generation seeds, obtaining plants subjected to homozygous editing of NtNCP1 and NtNCP2 genes through target point editing detection, harvesting seeds to obtain T1 generation seeds, wherein the primer sequences adopted by the NtNCP1 and NtNCP2 target point editing detection are the same as the step (1).

An application of a tobacco nicotine transformation related gene in rapidly preparing a nicotine transformed plant, wherein the tobacco nicotine transformation related gene is an NtNCP1 gene and an NtNCP2 gene.

An application of a method for quickly obtaining and cultivating a tobacco nicotine transformant in preparing the tobacco nicotine transformant.

Preferably, the total amount of various alkaloids in leaves 14 days after the NtNCP1 and NtNCP2 genes are knocked out simultaneously and edited by the knock-out genes of the plants is close to that of the control plants, but the nicotine content is extremely lower than that of the control plants, the nicotine reduction content is extremely higher than that of the control plants, and the nicotine conversion rate is higher than 20%.

The technical scheme of the invention has the following beneficial effects:

according to the invention, a CRISPR/Cas9 editing vector for simultaneously knocking out tobacco NtNCP1 and NtNCP2 genes is constructed through a CRISPR/Cas9 mediated gene editing technology, and a safflower macrogol editing plant with the tobacco NtNCP1 and NtNCP2 genes simultaneously knocked out is obtained after editing material creation and molecular detection identification.

Compared with a control (unedited), the main agronomic characters of the tobacco plant with the NtNCP1 and NtNCP2 genes knocked out simultaneously have no obvious difference in characters such as plant height, waist leaf length, waist leaf width, stem girth and the like.

According to the genes NtNCP1 and NtNCP2 related to tobacco nicotine conversion, gas chromatography-mass spectrometry detection shows that the total alkaloid amount of leaves 14 days after the NtNCP1 and NtNCP2 genes are simultaneously knocked out and edited and the plant is topped is close to that of a control, but the nicotine content is extremely lower than that of the control plant, the nicotine reduction content is extremely higher than that of the control plant, and the nicotine conversion rate is higher than 20%.

In conclusion, the tobacco NtNCP1 and NtNCP2 genes are knocked out simultaneously by using the CRISPR/Cas9 mediated gene editing technology to obtain an editing material with reduced nicotine content and increased nornicotine content, so that genetic materials and theoretical bases are provided for the research of the tobacco nicotine transformation gene function and the directional improvement of new tobacco varieties with regulated nicotine content.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description, serve to explain the principles of the invention.

FIG. 1 shows a comparison of the main agronomic traits of the edited plants of the present invention with those of a control (unedited).

FIG. 2 is a comparison of nicotine conversion rates of edited plants of the invention and a control (unedited).

Detailed Description

Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that: the relative arrangement of the components and steps, the numerical expressions and numerical values set forth in these embodiments do not limit the scope of the present invention unless it is specifically stated otherwise.

All experimental procedures used in the following examples are conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 obtaining of NtNCP1 Gene

Taking the whole plant of cultivated species of tobacco Honghuadajinyuan as an experimental material, extracting the total RNA of the root of tobacco by using an RNA extraction kit, and performing reverse transcription to obtain cDNA for later use:

and extracting the total RNA of the tobacco according to the instruction of the plant RNA extraction kit.

Mu.g of total RNA was extracted from leaves for reverse transcription in the following transcription system:

Total RNA 1μg；

Oligo(dT)(10μM) 1.5μL；

ddH ₂ O up to 15μL。

mixing the above system, placing in PCR, keeping temperature at 70 deg.C for 5min, removing, immediately placing on ice for 5min, and adding the following reagents into the system:

the system is put into a PCR instrument, is kept at 42 ℃ for 65min,65 ℃ for 10min and 4 ℃ and then is stored in a refrigerator at the temperature of minus 20 ℃ for use.

By means of homologous alignment, and referring to the known partial gene sequence of tobacco, the amplification primer sequence is designed as follows:

F：5’-ATGGCGTCAAAGCTCTTTTTGG-3’(SEQ ID No.5)；

R：5’-TCAAAAATAATCAACTACAGGAG-3’(SEQ ID No.6)。

and (3) performing PCR amplification by using the prepared cDNA as a template and the primers:

amplification System (50. Mu.L):

mixing, centrifuging and performing PCR amplification, wherein the PCR reaction conditions are as follows: 30 cycles of 95 ℃ for 10sec,52 ℃ for 30sec, and 72 ℃ for 2 min; 10min at 72 ℃; hold at 25 ℃.

And (3) purifying the amplification product and then sequencing to obtain a gene NtNCP1 sequence related to tobacco nicotine conversion, wherein the base sequence of the gene NtNCP1 is shown as SEQ ID No.1 and comprises 690 bases in total. After the gene sequence is translated, the coded protein sequence is shown as SEQ ID No.2 and comprises 229 amino acid residues in total.

Example 2 obtaining of NtNCP2 Gene

Taking the whole plant of cultivated species of tobacco Honghuadajinyuan as an experimental material, extracting the total RNA of the root of tobacco by using an RNA extraction kit, and performing reverse transcription to obtain cDNA for later use:

extracting total RNA of tobacco according to the instruction of the plant RNA extraction kit.

Mu.g of total RNA was extracted from leaves for reverse transcription in the following transcription system:

Total RNA 1μg；

Oligo(dT)(10μM) 1.5μL；

ddH ₂ O up to 15μL。

mixing the above system, placing in PCR, keeping temperature at 70 deg.C for 5min, removing, immediately placing on ice for 5min, and adding the following reagents into the system:

the system is put into a PCR instrument, is kept at 42 ℃ for 65min,65 ℃ for 10min and 4 ℃ and then is stored in a refrigerator at the temperature of minus 20 ℃ for use.

By means of homologous alignment, and referring to the known partial gene sequence of tobacco, the amplification primer sequence is designed as follows:

F：5’-ATGGCCCAATGTATGGATGCTG-3’(SEQ ID No.7)；

R：5’-TCAAAAATAATCAATTACAGGAG-3’(SEQ ID No.8)。

and (3) performing PCR amplification by using the prepared cDNA as a template and the primers:

amplification System (50. Mu.L):

mixing, centrifuging and performing PCR amplification, wherein the PCR reaction conditions are as follows: 30 cycles of 95 ℃ 10sec,52 ℃ 30sec,72 ℃ 2 min; 10min at 72 ℃; hold at 25 ℃.

And purifying and sequencing the amplified product to obtain a gene NtNCP2 sequence related to tobacco nicotine conversion, wherein the base sequence of the gene NtNCP2 sequence is shown as SEQ ID No.3 and comprises 1083 bases in total. After the gene sequence is translated, the coded protein sequence is shown as SEQ ID No.4 and comprises 360 amino acid residues in total.

EXAMPLE 3 construction of expression vectors

The CRISPR/Cas9 vector is further constructed by using the nicotine transformation related genes NtNCP1 and NtNCP2 obtained in the example 1.

(1) Design and synthesis of sgRNA sequences of NtNCP1 and NtNCP2 genes:

the sgRNA guide sequence was designed using the online software CRISPR-P2.0 (http:// cbi. Hzau. Edu. Cn/CRISPR /), and the guide sequences with higher score and located at the appropriate positions in the NtNCP1 and NtNCP2 gene sequences were selected. The sgRNA sequences selected in this application are: TCATAATGCATATAGGTTGGAGG (SEQ ID No. 9).

(2) Forward and reverse primers of sgRNA sequences were designed and delivered by the design company:

an upstream primer sgRNA-F: GATTGTCATAATGCATTAGGTGG (SEQ ID No. 10);

a downstream primer sgRNA-R: AAACCCAAACCTATATGCATTATGA (SEQ ID No. 11).

(3) Annealing of the primer: the synthesized target sequence primers (upstream primer and downstream primer) were treated with sterile ddH ₂ Diluting O to be 100 ng/mu L, then taking 5 mu L of each of the upstream and downstream primers to a PCR tube, uniformly mixing, and placing on a PCR instrument for annealing to enable the single strands of the upstream and downstream Oligo to form double strands through annealing.

The annealing program of the PCR instrument comprises the following steps: annealing at 95 deg.C for 2min and-0.1 deg.C/8 s to 25 deg.C, and diluting the annealed product with 90 μ L sterile water to 10ng/μ L.

(4) Enzyme digestion and ligation

a. The CRISPR/Cas9 vector pORE-Cas9 (provided by southwest university) was digested with the restriction enzyme BsaI-HF.

Enzyme digestion system (50 μ L):

the enzyme digestion is carried out at 37 ℃ overnight, the target fragment band is cut through 1.5% agarose gel electrophoresis, and the framework fragment is recovered by a gel recovery kit.

b. Connection of

Connecting the double-chain product formed by annealing with the vector skeleton which is subjected to enzyme digestion.

Ligation system (10 μ L):

the connection conditions are as follows: ligation was carried out at 16 ℃ for 2 hours.

(5) And (3) transforming escherichia coli:

a. taking out Trans-T1 competent cells from-80 ℃, placing the cells on ice for freeze thawing, and dividing into 50 mu L per serving;

b. after the competent cells are thawed, adding 10 mu L of the ligation product into the competence, gently mixing uniformly, and carrying out ice bath for 10min;

c. after ice-bath, the mixture was placed in a 42 ℃ water bath and heat-shocked for 90s, and the competence was quickly placed back on ice and left for 2min.

d. 60. Mu.L of the transformant was spread evenly on LB solid medium containing 16mg/L kanamycin, and cultured in a bacterial incubator at 37 ℃ for 12 hours.

(6) Screening positive clones:

a. when the plate grows out a single clone, selecting an escherichia coli single clone to a kanamycin LB liquid culture medium containing 50mg/L, and shaking overnight at 37 ℃ to mix;

b. taking partial bacterial liquid to carry out PCR of the bacterial liquid, and detecting whether the bacterial liquid is a positive clone or not through nucleic acid electrophoresis;

c. extracting the Escherichia coli plasmid from the rest part of the bacterial liquid which is preliminarily detected as positive clone. The plasmid was sent to Novista GmbH for sequencing to confirm the correctness of the positive clone.

Example 4 acquisition and testing of T0 Generation plants

(1) Transformation of Agrobacterium

Genetic transformation and tissue culture are carried out by using the CRISPR/Cas9-NtNCP1-NtNCP2 editing vector plasmid constructed in the last step and taking a safflower large gold as an example to obtain a plant with the genes NtNCP1 and NtNCP2 related to tobacco nicotine transformation subjected to knockout and editing, and related experimental processes are briefly introduced as follows.

Inoculating sterilized tobacco seed onto MS culture medium, culturing to 4 cotyledons (15-20 d), transferring into culture bottle containing MS solid culture medium, and culturing at 25 + -1 deg.C under illumination intensity of 30-50 μmol/(m) ² S) and culturing for 35-40d under the condition of 16h/d illumination time for later use.

The plasmid with the correct sequence is transformed into agrobacterium, and the specific steps are as follows:

(1) LBA4404 preserved at-80 ℃ is taken out to be electrically transformed into competent Agrobacterium cells, and the cells are frozen and thawed on ice.

(2) When competence is just thawed, 2 mu L of CRISPR/Cas9-NtNCP1-NtNCP2 editing vector plasmid is added, mixed evenly and placed on ice.

(3) And transferring the uniformly mixed competence into a precooled electric rotor, placing the electric rotor into an electric rotor for transformation, adding 1mL of YEB liquid culture medium after the transformation is finished, mixing with the transformation liquid, and then placing the mixture in a shaking table at 28 ℃ and culturing for 1.5-2h at 200 rpm.

(4) The medium was centrifuged at 8,000rpm, the supernatant was discarded, and the cells were suspended in 200. Mu.L of YEB liquid medium and plated on YEB solid medium containing 50mg/L rifampicin, 50mg/L streptomycin and 50mg/L kanamycin for 2-3 days in an inverted dark state at 28 ℃.

(2) Infection of callus

(1) Preparing tobacco leaf disc into square leaf disc with side length of 1cm in a clean bench, and preparing Agrobacterium colony containing CRISPR/Cas9-NtNCP1-NtNCP2 editing vector by using MS liquid to form suspension bacterial liquid (OD) ₆₀₀ ＝0.6-0.8)。

(2) And soaking and infecting the tobacco leaf discs for 10min by using the suspension agrobacterium liquid.

(3) The leaf discs were placed on MS solid medium containing 2.0mg/L NAA +0.5 mg/L6-BA, incubated at 28 ℃ in the dark for 3 days.

(4) Subculture was carried out and the cells were placed on MS solid medium containing 2.0mg/L NAA, 0.5 mg/L6-BA, 250mg/LCb and 50mg/L Kan.

The culture conditions are as follows: culturing at 28 deg.C under illumination for 16h/d with illumination intensity of 30-50 μmol/(m 2 s), culturing at 25 deg.C in dark for 8h/d, culturing for 45-60d until differentiated bud is formed, and changing differentiation culture medium every 7-10d for 3-4 times; culturing until a differentiated bud is formed; cutting off callus formed by existing differentiated bud, culturing on MS culture medium containing carbenicillin 500mg/L and kanamycin 50mg/L, culturing for 8-14d when the differentiated bud on callus grows to 2-4cm high and the culture condition is the same as that of differentiated culture; cutting a differentiated bud, inserting the cut differentiated bud into an MS culture medium containing 500mg/L carbenicillin and 50mg/L kanamycin to perform rooting culture, wherein the culture condition is consistent with the differentiation culture condition, culturing for 20-30d, performing regeneration and transplantation to a flowerpot, then performing transformation plant leaf sampling, delivering a Huada gene to perform molecular detection, and performing NtNCP1 target detection primers as follows: the upstream primer NtNCP1-F: CCATCAGAAGCACCACAAA (SEQ ID No. 12) and a downstream primer NtNCP1-R: TGCTCTGGTTCTTCGGCTAAG (SEQ ID No. 13); the NtNCP2 target detection primers are as follows: an upstream primer NtNCP2-F: CCATCAGAAGCACCACAAA (SEQ ID No. 14) and a downstream primer NtNCP2-R: GCGTTTATTTGCTCCGGTTCTT (SEQ ID No. 15), determining to obtain a T0 generation plant with NtNCP1 and NtNCP2 genes knocked out simultaneously, and harvesting and reserving for use.

Example 5 acquisition of homozygous editing Material

Carrying out inbred homozygous propagation on the T0 generation seeds by 96 times, sampling leaves of a single plant when the plant grows to 5-6 leaves, and sending a Huahua big gene to carry out molecular detection on NtNCP1 target detection primers: the upstream primer NtNCP1-F: CCATCAGAAGCACCACAAA (SEQ ID No. 12) and downstream primer NtNCP1-R: TGCTCTGGTTCTTCGGCTAAG (SEQ ID No. 13); the NtNCP2 target detection primers are as follows: an upstream primer NtNCP2-F: CCATCAGAAGCACCACAAA (SEQ ID No. 14) and downstream primer NtNCP2-R: GCGTTTATTTGCTCCGGTTCTT (SEQ ID No. 15), plants which are homozygously edited with NtNCP1 and NtNCP2 genes are determined to be obtained, and then harvest is carried out to obtain T1 generation seeds which are homozygously edited with the NtNCP1 and NtNCP2 genes.

Example 6 Material planting and Property survey

Plant seeds determined to be homozygous knockout of NtNCP1 and NtNCP2 genes by molecular detection in example 4 are used for pot culture for propagation, 60 plants are planted, topping is carried out in the full-bloom stage, and 10 days after topping, the indexes of plant height, waist leaf length, waist leaf width, stem circumference, pitch and other properties are determined and analyzed by referring to YCT 142-2010 tobacco agronomic trait survey and measurement method.

At present, the tobacco plants 10 days after topping are collected, and the index data of the 10 tobacco plants, such as plant height, waist leaf length, waist leaf width, stem girth, and the like, are subjected to statistical analysis.

The result shows that the plant height, stem circumference, waist leaf length, waist leaf width and other indexes of the plant with the NtNCP1 and NtNCP2 genes knocked out simultaneously are close to those of the control, and no obvious difference exists. The major trait pairs of control and NtNCP1 and NtNCP2 genes homozygously edited tobacco plants are shown in figure 1.

Example 7GC-MS detection

The edited plants grown in example 5 were used, followed by GC-MS for the determination of alkaloid content in leaves 14 days after topping of the NtNCP1 and NtNCP2 gene homozygous knockout material.

Selecting tobacco plants 14 days after topping, collecting 5 control (unedited) tobacco plant samples, and collecting leaves at the same leaf position; selecting tobacco plants 10 days after topping, and collecting tobacco plant samples homozygously edited by 5 NtNCP1 and NtNCP2 genes; removing main ribs from leaves, wrapping with tin foil paper, storing in liquid nitrogen, storing at ultralow temperature (-70 deg.C) in laboratory, lyophilizing, grinding, and sieving.

Weighing 0.2g of sample in a 15mL centrifuge tube, accurately obtaining the sample with the concentration of 0.1mg, adding 2.0mL L5% sodium hydroxide solution, then respectively adding 0.05mL of internal standard solution A (dimethyl quinoline solution, methanol preparation, dichloromethane diluted to 1.0 mg/mL) and internal standard solution B (2, 2' -bipyridine-d 2 solution, methanol preparation, dichloromethane diluted to 0.5 mg/mL), shaking and mixing uniformly, standing for 20min, then adding 10.0mL of extraction solution (dichloromethane and methanol are mixed according to a volume ratio of 4, 1), covering and sealing, placing in a vortex oscillator, shaking and extracting at a speed of 2000r/min for 40min, standing for 1h, centrifuging for 8min, taking the lower organic phase, transferring to a chromatographic bottle, and analyzing by GC-MS (gas chromatography-mass spectrometer).

The gas chromatography reference conditions were: a chromatographic column: DB-35MS or equivalent column effect capillary chromatographic column with the specification as follows: 30mm (length) × 0.25mm (inner diameter) × 0.25m (film thickness); sample inlet temperature: 250 ℃; column flow rate: 1.0mL/min; nicotine sample injection volume: 1.0L, split-flow sample injection, wherein the split-flow ratio is 40; volume of other alkaloid samples: 2.0L, split-flow sample injection, wherein the split-flow ratio is 10; temperature rising procedure: maintaining the initial temperature at 100 deg.C for 3min; the temperature was raised to 260 ℃ at a rate of 8 ℃/min and held for 10min.

Mass spectrum reference conditions: transmission line temperature: 280 ℃; an ionization mode: an electron impact source (EI); ionization energy: 70eV; ion source temperature: 230 ℃; solvent retardation: 8min; measurement method: an ion monitoring mode (SIM) scan is selected.

Comparison of leaf nicotine levels 14 days after topping of control (unedited) and NtNCP1 and NtNCP2 gene homozygous edited tobacco plants (results are shown in table 1) indicates: the gas chromatography-mass spectrometry (GC-MS) combined detection shows that the total alkaloid amount 14 after the NtNCP1 and NtNCP2 gene knockout editing plant is topped is close to that of a control, but the nicotine content is extremely lower than that of the control plant, the nicotine content is extremely higher than that of the control plant, and the nicotine conversion rate is 24.3% (the control is 0.5%) and exceeds the judgment standard of 2.5%, which indicates that the nicotine transformation plant can be quickly obtained by simultaneously knocking out the NtNCP1 and NtNCP2 genes of the cultivated tobacco through gene editing. The method provides genetic materials and theoretical basis for research on the functions of genes related to nicotine conversion of tobacco and cultivation of new tobacco varieties with regulated nicotine content.

Table 1 shows the alkaloid content (μ g/g) of fresh tobacco leaves 14 days after topping of the edited plants and the control (not edited) according to the invention

Although the present invention has been described with reference to the above embodiments, it should be understood that the present invention is not limited thereto, and various changes and modifications may be made by those skilled in the art without departing from the spirit and scope of the present invention.

Claims (10)

1. A method for rapidly obtaining a tobacco nicotine transformant for cultivation is characterized in that genes related to tobacco nicotine transformation are knocked out by a CRISPR/Cas9 system, the genes are NtNCP1 genes and NtNCP2 genes, the NtNCP1 gene sequence is shown in SEQ ID No.1, and the NtNCP2 gene sequence is shown in SEQ ID No. 3.

2. The method for rapidly obtaining the nicotiana tabacum nicotine transformant as claimed in claim 1, wherein the sequence of the encoded protein of the NtNCP1 gene is represented by SEQ ID No.2 after the NtNCP1 gene is translated.

3. The method for rapidly obtaining the nicotiana tabacum nicotine transformant as claimed in claim 1, wherein the sequence of the encoded protein of the NtNCP2 gene is represented by SEQ ID No.4 after the NtNCP2 gene is translated.

4. The method for rapidly obtaining a cultivated nicotine transformant according to claim 1, comprising the steps of:

(1) Creating a T0 generation editing material;

(2) The T0 generation plants are subjected to selfing homozygosis to obtain homozygous editing materials;

(3) Homozygous editing material planting and character observation;

(4) And detecting the alkaloid content of leaves 14 days after topping of NtNCP1 and NtNCP2 gene homozygous knockout materials by GC-MS, and calculating the nicotine conversion rate.

5. The method for rapidly obtaining the nicotine transformant of nicotiana tabacum as claimed in claim 4, wherein in step (1), the sgRNA sequence adopted by the CRISPR/Cas9 system is TCATAATGCATAGGTTGGAGG, and the primer sequence adopted by the sgRNA sequence is as follows:

an upstream primer sgRNA-F: gattgtcataatgcatatgg;

a downstream primer sgRNA-R: AAACCCAAACCTATATGCATTATGA.

6. The method for rapidly obtaining the nicotine transformant for cultivation of tobacco according to claim 5, wherein, in the step (1),

the primer sequences adopted by the editing detection of the NtNCP1 target point are as follows:

the upstream primer NtNCP1-F: CCATCAGAAGCAGCACACAAS;

the downstream primer NtNCP1-R: TGCTCTGGTTCTTCGGCTAAG;

the primer sequences adopted by the editing detection of the NtNCP2 target point are as follows:

the upstream primer NtNCP2-F: CCATCAGAAGCACCACAAA;

the downstream primer NtNCP2-R: GCGTTTATTTGCTCCGGTTCTT.

7. The method for rapidly obtaining a cultivated nicotine transformant of tobacco according to claim 6,

the step (1) is specifically as follows:

designing a sgRNA guide sequence, annealing an upstream primer sgRNA-F and a downstream primer sgRNA-R to form a double strand, and digesting a CRISPR/Cas9 vector pORE-Cas9 by using a restriction endonuclease BsaI-HF; connecting the double-chain product formed by annealing and the carrier skeleton which is well digested by enzyme by using T4 ligase; the ligation product is transformed into an escherichia coli competent cell, positive clone is obtained through detection, recombinant plasmid is extracted, and a CRISPR-Cas9 expression vector is obtained;

soaking and infecting a tobacco leaf disc with agrobacterium LBA4404 bacterial liquid carrying a CRISPR/Cas9-sgRNA expression vector to obtain a T0 generation plant, obtaining a plant with NtNCP1 and NtNCP2 genes simultaneously edited through target point editing and detection, and harvesting to obtain a T0 generation seed.

The step (2) is specifically as follows:

and (2) carrying out selfing homozygous expanded propagation planting on the T0 generation seeds, obtaining plants subjected to homozygous editing of NtNCP1 and NtNCP2 genes through target point editing detection, and harvesting seeds to obtain T1 generation seeds, wherein the primer sequences adopted by the NtNCP1 and NtNCP2 target point editing detection are the same as the step (1).

8. Use of a tobacco nicotine conversion-associated gene in the rapid production of nicotine converted plants, wherein the tobacco nicotine conversion-associated gene is the NtNCP1 gene and the NtNCP2 gene according to any one of claims 1 to 7.

9. Use of a method for rapidly obtaining a cultured nicotine tobacco transformant according to any one of claims 1 to 7 for the preparation of a nicotine tobacco transformant.

10. The use of claim 9, wherein the total amount of alkaloid in the leaves 14 days after the NtNCP1 and NtNCP2 genes are knocked out simultaneously is close to that of the control plant, but the nicotine content is significantly lower than that of the control plant, the nicotine content is significantly higher than that of the control plant, and the nicotine conversion rate is higher than 20%.

Images