CN114085845B - Tobacco nicotine metabolism related gene and application thereof - Google Patents

Abstract

The invention discloses a gene related to tobacco nicotine metabolism and application thereof, wherein the gene is an NtLNP2 gene, the sequence of the gene is SEQ ID No.1, and after the sequence of the gene is translated, the coded protein sequence of the gene is SEQ ID No.2. A method of knocking out a gene associated with tobacco nicotine metabolism using a CRISPR/Cas9 system, comprising the steps of: (1) Designing a sgRNA guide sequence and constructing a sgRNA expression vector; (2) introducing an expression vector into agrobacterium; (3) infecting the callus; (4) And (3) detecting the nicotine content of the leaves in the bud period of the homozygous knockout material of the NtLNP2 gene by using GC-MS. The gene and the method provide genetic materials and theoretical basis for the functional research of the tobacco nicotine metabolism gene and the cultivation research of new varieties of low-nicotine tobacco.

Description

Tobacco nicotine metabolism related gene and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a gene related to tobacco nicotine metabolism and application thereof.

Background

Alkaloids are important chemical components of plants of the genus Nicotiana (Nicotiana), with nicotine being the predominant alkaloid, accounting for more than about 90%. The nicotine is a main physiological active ingredient in tobacco leaves, and the content of the nicotine determines the physiological strength of the tobacco leaves and is also a main ingredient for causing addiction of tobacco products. In order to reduce the rate of smoking, the world health organization recommends reducing the nicotine content in the cut tobacco of cigarettes to below 0.4 mg/g. Therefore, the feasibility of low-nicotine-content tobacco leaf production technology and the influence on tobacco leaf quality and consumer experience have become research hotspots in the international tobacco community in recent years.

The nicotine content of tobacco leaves is fundamentally controlled by genetic factors, but is strongly influenced by measures such as ecology, agriculture and the like. The current low-nicotine tobacco variety cultivation comprises conventional breeding, genetic engineering and the like. Certain low-nicotine materials exist in tobacco gene resources, but the materials are generally poor in agronomic characters and have no cultivation and utilization values. Legg et al found that alkaloids were controlled by two independent genetic loci, nic1 and Nic2. Researchers have also grown cured tobacco and dark air cured tobacco lines with different Nic1.Nic2 obvious recessive combinations by crossing, backcrossing and diploid cultures. In addition, nicotine can be demethylated by nicotine demethylase to convert it to nornicotine, and the cultivation of a nicotine conversion line having nicotine demethylase activity is an alternative route to lower nicotine tobacco. The key gene for synthesizing nicotine can be inhibited or knocked out by molecular means, so that the synthesis of nicotine can be effectively reduced, and the nicotine content of tobacco leaves can be reduced to an extremely low level.

Through extensive researches for over 20 years, the metabolic process of alkaloid synthesis is clearer, and particularly key regulatory sites and control genes are gradually disclosed and recognized, which provides possibility for effectively regulating alkaloid synthesis, transportation and accumulation through genetic engineering and becomes a main way for controlling the nicotine content of tobacco leaves and creating ultra-low nicotine materials in recent years. At present, research on nicotine genetic engineering by using key genes and molecular regulatory mechanisms of alkaloid synthesis is mainly focused on PMT genes, MPO genes, QPT genes, A662 enzyme genes, BBL genes, nicotine root and leaf transport genes and the like.

Disclosure of Invention

The invention aims to solve the technical problem of providing a gene related to tobacco nicotine metabolism and application thereof, and provides genetic materials and theoretical basis for researching the functions of the tobacco nicotine metabolism gene and directionally improving new varieties of low-nicotine tobacco.

The technical problems to be solved by the invention are realized by the following technical scheme:

a gene related to tobacco nicotine metabolism, which is a NtLNP2 gene, the sequence of which is SEQ ID No.1.

Preferably, the sequence of the gene is translated, and the encoded protein sequence is SEQ ID NO.2.

A method of knocking out a gene associated with tobacco nicotine metabolism, the gene associated with tobacco nicotine metabolism being the NtLNP2 gene described above, using a CRISPR/Cas9 system, the method comprising the steps of:

(1) Designing a sgRNA guide sequence and constructing a sgRNA expression vector;

(2) Introducing an expression vector into agrobacterium;

(3) Infection of callus;

(4) And (3) detecting the nicotine content of the leaves in the bud period of the homozygous knockout material of the NtLNP2 gene by using GC-MS.

Preferably, in step (1), the CRISPR/Cas9 system employs a sgRNA sequence of GAGACCTGCAGATCTACCCGCGG, and the sgRNA sequence employs a primer sequence of:

the upstream primer sgRNA-F: GATTGGAGACCTGCAGATCTACCCG;

the downstream primer sgRNA-R: AAACCGGGTAGATCTGCAGGTCTCC.

Preferably, the step (1) specifically comprises:

designing an sgRNA guide sequence, annealing an upstream primer sgRNA-F and a downstream primer sgRNA-R to form a double chain, and performing restriction enzyme digestion on a CRISPR/Cas9 vector pORE-Cas9 by using restriction enzyme BsaI-HF; connecting the double-stranded product formed by annealing with the carrier skeleton cut by enzyme by using T4 ligase; and (3) converting the connection product into competent cells of escherichia coli, detecting to obtain positive clones, and extracting the recombinant plasmid to obtain the CRISPR-Cas9 expression vector.

Preferably, the step (3) specifically comprises:

and soaking the infected tobacco leaf disc with agrobacterium tumefaciens LBA4404 bacterial liquid carrying the CRISPR/Cas9-sgRNA expression vector, and obtaining the T0 generation editing plant seeds and the T1 generation seeds.

Preferably, the chromatographic conditions in step (4) are:

the gas chromatography conditions were: chromatographic column: DB-35MS or equivalent column effect capillary chromatographic column; the specification is as follows: 30mm by 0.25m; sample introduction temperature: 250 ℃; column flow rate: 1.0mL/min; nicotine sample injection volume: 1.0L, split sample introduction, and split ratio of 40:1; other alkaloid sample injection volumes: 2.0L, split sample introduction, wherein the split ratio is 10:1; heating program: the initial temperature is 100 ℃, and the temperature is kept for 3min; raising the temperature to 260 ℃ at a speed of 8 ℃/min, and keeping for 10min;

mass spectrometry conditions: transmission line temperature: 280 ℃; ionization mode: an electron bombardment source; ionization energy: 70eV; ion source temperature: 230 ℃; solvent delay: 8min; the measurement method comprises the following steps: the ion monitoring mode is selected for scanning.

Preferably, the variety of the tobacco is safflower Dajinyuan.

A tobacco mutant created by a method for knocking out genes related to tobacco nicotine metabolism by using a CRISPR/Cas9 system.

Application of a method for knocking out genes related to tobacco nicotine metabolism by using CRISPR/Cas9 system in breeding new varieties of low-nicotine tobacco.

The technical scheme of the invention has the following beneficial effects:

the invention constructs a CRISPR/Cas9 editing vector for knocking out the NtLNP2 gene by a CRISPR/Cas9 mediated gene editing technology, and obtains a safflower Dajinyuan editing plant with the NtLNP2 gene knocked out after editing material creation and molecular detection and identification.

According to the tobacco nicotine metabolism related gene NtLNP2 provided by the invention, through gas chromatography-mass spectrometry combined detection, the leaf nicotine content of the NtLNP2 gene knockout editing plant in the bud period is obviously lower than that of a control plant.

In conclusion, the CRISPR/Cas9 mediated gene editing technology is utilized to knock out the NtLNP2 gene to obtain editing materials with obviously reduced nicotine content, and genetic materials and theoretical basis are provided for the function research of the nicotine metabolic genes of tobacco and the directional improvement of new varieties of low-nicotine tobacco with regulated and controlled nicotine content.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description, serve to explain the principles of the invention.

FIG. 1 is a comparison of the present invention's nicotine content at the bud phase of the edited plants versus the control (unedited) plants.

Detailed Description

Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that: the relative arrangement of the components and steps, numerical expressions and numerical values set forth in these embodiments do not limit the scope of the present invention unless it is specifically stated otherwise.

All experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the following examples were commercially available unless otherwise specified.

EXAMPLE 1 acquisition of the NtLNP2 Gene

The method comprises the steps of (1) taking a cultivar tobacco safflower large Jin Yuangen as an experimental material, extracting total RNA of tobacco roots by using an RNA extraction kit, and carrying out reverse transcription to obtain cDNA for later use:

extracting total RNA of tobacco according to the instruction of the plant RNA extraction kit.

1 μg total RNA extracted from leaf for reverse transcription was as follows:

Total RNA 1μg；

Oligo(dT)(10μM) 1.5μL；

ddH ₂ O up to 15μL；

mixing the above systems, placing in PCR, maintaining at 70deg.C for 5min, removing, immediately placing on ice for 5min, and adding the following reagents:

placing the above system into a PCR instrument, keeping temperature at 42deg.C for 65min, 65deg.C for 10min, and 4deg.C, and storing in a refrigerator at-20deg.C.

By a homology comparison method, referring to the sequence of the Arabidopsis gene and the sequence of the known tobacco part gene, the amplification primer sequence is designed as follows:

F：5’-ATGTTTCCGCTCATAATTCTG-3’(SEQ ID No.3)；

R：5’-TCATTCACTGCTATACTTGTGC-3’(SEQ ID No.4)。

PCR amplification was performed using the cDNA prepared as described above as a template and the above primers:

amplification system (50 μl):

and (3) carrying out PCR amplification after uniformly mixing and centrifuging, wherein the PCR reaction conditions are as follows: 30 cycles of 95℃10sec,52℃30sec,72℃2 min; 72 ℃ for 10min; hold at 25 ℃.

And (3) purifying and sequencing the amplified product to obtain a gene NtLNP2 sequence related to nicotine metabolism of the tobacco, wherein the base sequence of the gene is shown as SEQ ID No.1 and comprises 1506 bases. After the gene sequence is translated, the coded protein sequence is shown as SEQ ID No.2, and the coded protein sequence totally comprises 501 amino acid residues, and further comparative analysis shows that the protein contains a sequence with high homology and is highly conserved.

EXAMPLE 2 construction of expression vectors

The present invention further constructs a CRISPR/Cas9 vector using the nicotine metabolism related gene NtLNP2 obtained in example 1.

(1) Design and synthesis of sgRNA sequence of NtLNP2 gene:

the on-line software CRISPR-P2.0 (http:// cbi. Hzau. Edu. Cn/CRISPR /) is used for designing the sgRNA guide sequence, and the guide sequence with higher score and positioned at the proper position of the NtLNP2 gene sequence is selected. The sgRNA sequences selected in this application are: GAGACCTGCAGATCTACCCGCGG (SEQ ID No. 5).

(2) Forward and reverse primers of sgRNA sequences were designed and submitted to synthesis by design company: the upstream primer sgRNA-F: GATTGGAGACCTGCAGATCTACCCG (SEQ ID No. 6) and the downstream primer sgRNA-R: AAACCGGGTAGATCTGCAGGTCTCC (SEQ ID No. 7);

(3) Primer annealing: the synthesized target sequence primers (upstream primer and downstream primer) were sterilized with ddH ₂ O is diluted to 100 ng/. Mu.L, then 5. Mu.L of each of the upstream and downstream primers is taken and mixed into a PCR tube uniformly, and the mixture is placed on a PCR instrument for annealing, so that the upstream and downstream Oligo single chains are annealed to form double chains.

The annealing procedure of the PCR instrument is as follows: 95℃for 2min, -0.1 ℃/8s, annealed to 25℃and the annealed product diluted to 10 ng/. Mu.L with 90. Mu.L sterile water.

(4) Enzyme digestion and ligation

a. The CRISPR/Cas9 vector, port-Cas 9 (supplied by university of southwest) was digested with restriction enzyme BsaI-HF.

Enzyme cleavage System (50. Mu.L):

and (3) performing enzyme digestion at 37 ℃ overnight, performing agarose gel electrophoresis at 1.5%, cutting a target fragment strip, and recovering a framework fragment by using a gel recovery kit.

b. Connection

And (3) connecting the double-chain product formed by annealing with the carrier framework which is cut by the enzyme.

Ligation system (10 μl):

the connection conditions are as follows: the connection was carried out at 16℃for 2 hours.

(5) Transformation of E.coli:

a. Trans-T1 competent cells were removed from-80℃and frozen and thawed on ice, and divided into 50. Mu.L/serving;

b. after the competent cells are melted, 10 mu L of the connection product is added into the competent cells, and the mixture is gently mixed and ice-bathed for 10min;

c. after ice bath, placing the mixture into a water bath kettle at 42 ℃ for heat shock for 90s, and rapidly placing the competence back on ice for standing for 2min.

d. mu.L of the transformation product was uniformly spread on LB solid medium containing 16mg/L kanamycin, and cultured in a bacterial incubator at 37℃for 12 hours.

(6) Positive clone screening:

a. when the flat plate grows out of the monoclonal, E.coli monoclonal is selected and put into a kanamycin LB liquid culture medium containing 50mg/L, and shaking is carried out on a shaking table at 37 ℃ overnight;

b. taking part of bacterial liquid to carry out bacterial liquid PCR, and detecting whether positive cloning exists through nucleic acid electrophoresis;

c. and extracting the escherichia coli plasmid from the remaining part of the bacterial liquid which is detected to be positive clone. The plasmid was sent to Nostoc origin for sequencing to confirm the correctness of the positive clones.

EXAMPLE 3 transformation of Agrobacterium

The CRISPR/Cas9-NtLNP2 editing vector plasmid constructed in the previous step is used for genetic transformation and tissue culture by taking safflower Dajinyuan as an example to obtain a plant with the gene NtLNP2 related to tobacco nicotine metabolism knocked out and edited, and the related experimental process is briefly described as follows.

And (3) after the surfaces of the tobacco seeds are disinfected, dibbling the tobacco seeds on an MS culture medium, growing until 4 cotyledons (15-20 d) are grown, transferring the cotyledons into a culture bottle containing an MS solid culture medium, and continuously culturing for 35-40d at the temperature of 25+/-1 ℃ under the condition that the illumination intensity is 30-50 mu mol/(m 2 s) and the illumination time is 16h/d for standby.

The plasmid with correct sequence is transformed into agrobacterium, and the specific steps are as follows:

(1) LBA4404 stored at-80℃was removed and competent Agrobacterium cells were electrotransformed and frozen and thawed on ice.

(2) When the competence was just thawed, 2 μl of CRISPR/Cas9-NtLNP2 editing vector plasmid was added, mixed well and placed on ice.

(3) Transferring the uniformly mixed competence into a precooled electric rotating cup, placing the electric rotating cup into an electric rotating instrument for conversion, adding 1mL of YEB liquid culture medium and conversion liquid for mixing after conversion is finished, and placing the mixture into a shaking table at 28 ℃ for culturing at 200rpm for 1.5-2h.

(4) The medium was centrifuged at 8,000rpm, the supernatant was discarded, and 200. Mu.L of YEB liquid medium was used to suspend the cells, which were spread on YEB solid medium containing 50mg/L rifampicin, 50mg/L streptomycin and 50mg/L kanamycin, and inverted dark culture was performed at 28℃for 2-3d.

EXAMPLE 4 infection of callus

(1) Square leaf discs with side length of 1cm were made in an ultra clean bench, and agrobacterium colony-forming suspension (OD) containing CRISPR/Cas9-NtLNP2 editing vector was prepared with MS liquid ₆₀₀ ＝0.6-0.8)。

(2) And soaking and infecting tobacco leaf discs for 10min by using suspension agrobacterium liquid.

(3) The leaf discs were placed on MS solid medium containing 2.0mg/L NAA+0.5 mg/L6-BA, at 28℃in the dark, and co-cultured for 3d.

(4) Subculturing was performed and placed on MS solid medium containing 2.0mg/L NAA+0.5 mg/L6-BA+250 mg/L Cb+50mg/L Kan.

The culture conditions are as follows: culturing at 28deg.C for 16h/d with light intensity of 30-50 μmol/(m2.s), culturing at 25deg.C in dark for 8h/d, culturing for 45-60d until differentiation bud forms, and changing differentiation culture medium for 3-4 times every 7-10 d; culturing until differentiation buds are formed; cutting off the callus formed by the existing differentiation buds, placing the callus on an MS culture medium containing 500mg/L carbenicillin and 50mg/L kanamycin for culture, and culturing for 8-14 days when the differentiation buds on the callus grow to 2-4cm high under the condition consistent with the differentiation culture condition; rooting and culturing regenerated plants, cutting off differentiated buds, inserting the cut off differentiated buds into an MS culture medium containing 500mg/L of carbenicillin and 50mg/L of kanamycin for rooting and culturing, wherein the culture conditions are consistent with the differentiation culture conditions, culturing for 20-30d, regenerating and transplanting the cut off differentiated buds to a flowerpot for culturing, sampling leaves of the transformed plants, carrying out molecular detection on the leaves of the transformed plants, determining to obtain NtLNP2 gene edited plants, and then harvesting to obtain T0 generation edited plant seeds.

And (3) carrying out selfing homozygous propagation on the T0 generation seeds according to 23 times, sampling the leaves of a single plant when the plants grow to 5-6 leaves, carrying out molecular detection on the large gene, determining that the plants subjected to homozygous editing of the NtLNP2 genes are obtained, and then carrying out seed collection to obtain the T1 generation seeds subjected to homozygous editing of the NtLNP2 genes.

Example 5GC-MS detection

And (3) carrying out seed collection by using the plant which is determined to be homozygous and knocked out by the molecular detection in the embodiment 4 to obtain the homozygous editing material of the gene. Then, GC-MS is used for detecting the nicotine content of leaves in the bud period of the homozygous knockout material of the NtLNP2 gene.

Selecting tobacco plants in a bud period, collecting 5 control (unedited) tobacco plant samples, and collecting leaves at the same leaf position; selecting a tobacco plant in a bud period, and collecting tobacco plant samples of 5 plants homozygous edited by the NtLNP2 gene; removing main ribs of the leaves, wrapping tinfoil paper with liquid nitrogen, preserving and transporting, preserving at ultralow temperature (-70 ℃) in a laboratory, freeze-drying, grinding and sieving.

Weighing 0.2g of sample in a 15mL centrifuge tube to be accurate to 0.1mg, adding 2.0mL of 5% sodium hydroxide solution, respectively adding 0.05mL of internal standard solution A (dimethyl quinoline solution, methanol preparation, methylene dichloride dilution to 1.0 mg/mL) and internal standard solution B (2, 2' -bipyridine-d 2 solution, methanol preparation, methylene dichloride dilution to 0.5 mg/mL), shaking and mixing uniformly, standing for 20min, adding 10.0mL of extraction solution (mixing methylene dichloride and methanol according to the volume ratio of 4:1), sealing, shaking and extracting at the speed of 2000r/min for 40min, centrifuging for 8min, transferring the lower organic phase into a chromatographic bottle, and performing GC-MS analysis.

The gas chromatography reference conditions were: chromatographic column: DB-35MS or equivalent column effect capillary chromatographic column, the specification is: 30mm (length) ×0.25mm (inner diameter) ×0.25m (film thickness); sample inlet temperature: 250 ℃; column flow rate: 1.0mL/min; nicotine sample injection volume: 1.0L, split sample introduction, and split ratio of 40:1; other alkaloid sample injection volumes: 2.0L, split sample introduction, wherein the split ratio is 10:1; heating program: the initial temperature is 100 ℃, and the temperature is kept for 3min; raising the temperature to 260 ℃ at a rate of 8 ℃/min and keeping the temperature for 10min.

Mass spectrometry reference conditions: transmission line temperature: 280 ℃; ionization mode: an electron bombardment source (EI); ionization energy: 70eV; ion source temperature: 230 ℃; solvent delay: 8min; the measurement method comprises the following steps: ion monitoring mode (SIM) scanning is selected.

Comparison of leaf nicotine content at the bud phase of control (unedited) and NtLNP2 gene homozygous edited tobacco plants (results are shown in fig. 1).

The results show that: the leaf nicotine content of the NtLNP2 gene knockout editing plant in the bud phase is obviously lower than that of a control plant through the detection of gas chromatography-mass spectrometry (GC-MS). The method provides genetic materials and theoretical basis for the function research of the nicotine metabolic gene of the tobacco and the cultivation research of new varieties of low-nicotine tobacco.

Although the present invention has been described with reference to the above embodiments, it should be understood that the present invention is not limited thereto, and that various changes and modifications may be made by those skilled in the art without departing from the spirit and scope of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Sequence listing

<110> Yunnan Zhongyan industry Limited liability company

<120> a gene related to nicotine metabolism in tobacco and use thereof

<130> WPC213278

<141> 2021-11-22

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1680

<212> DNA

<213> Artificial sequence (NtLNP 2)

<400> 1

atgtttccgc tcataattct gatcagcttt tcacttgctt ccttgtctga aactgctact 60

ggagctgtta caaatctttc agcctgctta atcaaccaca atgtccataa cttctctatt 120

taccccacaa gtagaaatta ctttaacttg ctccacttct cccttcaaaa tcttcgcttt 180

gctgcacctt tcatgccgaa accaaccttc attatcctac caagcagtaa ggaggagctc 240

gtgagcacca ttttttgttg cagaaaagca tcttatgaaa tcagagtaag gtgcggcgga 300

cacagttacg aaggaacttc ttacgtttcc tttgacgctt ctccattcgt gatcgttgac 360

ttgatgaaat tagacgacgt ttcagtagat ttggattctg aaacagcttg ggctcagggc 420

ggcgcaacaa ttggccaaat ttattatgcc attgccaagg taagtgacgt tcatgcattt 480

tcagcaggtt cgggaccaac agtaggatct ggaggtcata tttcaggtgg tggatttgga 540

cttttatcta gaaaattcgg acttgctgct gataatgtcg ttgatgctct tcttattgat 600

gctgatggac ggttattaga ccgaaaagcc atgggcgaag acgtgttttg ggcaatcaga 660

ggtggcggcg gtggaaattg gggcattgtt tatgcctgga aaattcgatt actcaaagtg 720

cctaaaatcg taacaacttg tatgatctat aggcctggat ccaaacaata cgtggctcaa 780

atacttgaga aatggcaaat agttactcca aatttggtcg atgattttac tctaggagta 840

ctgctgagac ctgcagatct acccgcggat atgaaatatg gtaatactac tcctattgaa 900

atatttcccc aattcaatgc actttatttg ggtccaaaaa ctgaagttct ttccatatcg 960

aatgagacat ttccggagct aggcgttaag aatgatgagt gcaaggaaat gacttgggta 1020

gagtcagcac ttttcttctc cgaattagct gacgttaacg ggaactcgac tggtgatatc 1080

tcccgtctga aagaacgtta catggacgga aaaggttttt tcaaaggcaa aacggactac 1140

gtgaagaagc cagtttcaat ggatgggatg ctaacatttc ttgtggaact cgagaaaaac 1200

ccgaagggat atcttgtctt tgatccttat ggcggagcca tggacaagat tagtgatcaa 1260

gctattgctt tccctcatag aaaaggtaac cttttcgcga ttcagtatct agcacagtgg 1320

aatgaagagg acgattacat gagcgacgtt tacatggagt ggataagagg attttacaat 1380

acaatgacgc cctttgtttc aagctcgcca aggggagctt atatcaacta cttggatatg 1440

gatcttggag tgaatatggt cgacgactac ttattgcgaa atgctagtag cagtagtcct 1500

tcttcctctg ttgatgctgt ggagagagct agagcgtggg gtgagatgta tttcttgcat 1560

aactatgata ggttggttaa agctaagaca caaattgatc cactaaatgt ttttcgacat 1620

gaacagagta ttcctcctat gcttggttca acgcaagagc acaagtatag cagtgaatga 1680

<210> 2

<211> 558

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Phe Pro Leu Ile Ile Leu Ile Ser Phe Ser Leu Ala Ser Leu Ser

1 5 10 15

Glu Thr Ala Thr Gly Ala Val Thr Asn Leu Ser Ala Cys Leu Ile Asn

20 25 30

His Asn Val His Asn Phe Ser Ile Tyr Pro Thr Ser Arg Asn Tyr Phe

35 40 45

Asn Leu Leu His Phe Ser Leu Gln Asn Leu Arg Phe Ala Ala Pro Phe

50 55 60

Met Pro Lys Pro Thr Phe Ile Ile Leu Pro Ser Ser Lys Glu Glu Leu

65 70 75 80

Val Ser Thr Ile Phe Cys Cys Arg Lys Ala Ser Tyr Glu Ile Arg Val

85 90 95

Arg Cys Gly Gly His Ser Tyr Glu Gly Thr Ser Tyr Val Ser Phe Asp

100 105 110

Ala Ser Pro Phe Val Ile Val Asp Leu Met Lys Leu Asp Asp Val Ser

115 120 125

Val Asp Leu Asp Ser Glu Thr Ala Trp Ala Gln Gly Gly Ala Thr Ile

130 135 140

Gly Gln Ile Tyr Tyr Ala Ile Ala Lys Val Ser Asp Val His Ala Phe

145 150 155 160

Ser Ala Gly Ser Gly Pro Thr Val Gly Ser Gly Gly His Ile Ser Gly

165 170 175

Gly Gly Phe Gly Leu Leu Ser Arg Lys Phe Gly Leu Ala Ala Asp Asn

180 185 190

Val Val Asp Ala Leu Leu Ile Asp Ala Asp Gly Arg Leu Leu Asp Arg

195 200 205

Lys Ala Met Gly Glu Asp Val Phe Trp Ala Ile Arg Gly Gly Gly Gly

210 215 220

Gly Asn Trp Gly Ile Val Tyr Ala Trp Lys Ile Arg Leu Leu Lys Val

225 230 235 240

Lys Ile Val Thr Thr Cys Met Ile Tyr Arg Pro Gly Ser Lys Gln Tyr

245 250 255

Val Ala Gln Ile Leu Glu Lys Trp Gln Ile Val Thr Pro Asn Leu Val

260 265 270

Asp Asp Phe Thr Leu Gly Val Leu Leu Arg Pro Ala Asp Leu Pro Ala

275 280 285

Asp Met Lys Tyr Gly Asn Thr Thr Pro Ile Glu Ile Phe Pro Gln Phe

290 295 300

Asn Ala Leu Tyr Leu Gly Pro Lys Thr Glu Val Leu Ser Ile Ser Asn

305 310 315 320

Glu Thr Phe Pro Glu Leu Gly Val Lys Asn Asp Glu Cys Lys Glu Met

325 330 335

Thr Trp Val Glu Ser Ala Leu Phe Phe Ser Glu Leu Ala Asp Val Asn

340 345 350

Gly Asn Ser Thr Gly Asp Ile Ser Arg Leu Lys Glu Arg Tyr Met Asp

355 360 365

Gly Lys Gly Phe Phe Lys Gly Lys Thr Asp Tyr Val Lys Lys Pro Val

370 375 380

Ser Met Asp Gly Met Leu Thr Phe Leu Val Glu Leu Glu Lys Asn Pro

385 390 395 400

Lys Gly Tyr Leu Val Phe Asp Pro Tyr Gly Gly Ala Met Asp Lys Ile

405 410 415

Ser Asp Gln Ala Ile Ala Phe Pro His Arg Lys Gly Asn Leu Phe Ala

420 425 430

Ile Gln Tyr Leu Ala Gln Trp Asn Glu Glu Asp Asp Tyr Met Ser Asp

435 440 445

Val Tyr Met Glu Trp Ile Arg Gly Phe Tyr Asn Thr Met Thr Pro Phe

450 455 460

Val Ser Ser Ser Pro Arg Gly Ala Tyr Ile Asn Tyr Leu Asp Met Asp

465 470 475 480

Leu Gly Val Asn Met Val Asp Asp Tyr Leu Leu Arg Asn Ala Ser Ser

485 490 495

Ser Ser Pro Ser Ser Ser Val Asp Ala Val Glu Arg Ala Arg Ala Trp

500 505 510

Gly Glu Met Tyr Phe Leu His Asn Tyr Asp Arg Leu Val Lys Ala Lys

515 520 525

Thr Gln Ile Asp Pro Leu Asn Val Phe Arg His Glu Gln Ser Ile Pro

530 535 540

Pro Met Leu Gly Ser Thr Gln Glu His Lys Tyr Ser Ser Glu

545 550 555

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgtttccgc tcataattct g 21

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

tcattcactg ctatacttgt gc 22

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gagacctgca gatctacccg cgg 23

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gattggagac ctgcagatct acccg 25

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

aaaccgggta gatctgcagg tctcc 25

Claims (4)

1. The application of the gene related to the tobacco nicotine metabolism in reducing the leaf nicotine content of the tobacco in the bud stage is characterized in that the gene related to the tobacco nicotine metabolism is a NtLNP2 gene, the sequence of the gene is SEQ ID No.1, and the leaf nicotine content of a plant in the bud stage is obviously lower than that of a control plant by knocked-out and edited by the NtLNP2 gene;

the method for knocking out the gene related to tobacco nicotine metabolism by using the CRISPR/Cas9 system comprises the following steps:

(1) Designing a sgRNA guide sequence and constructing a sgRNA expression vector;

(2) Introducing an expression vector into agrobacterium;

(3) Infection of callus;

(4) Detecting the nicotine content of leaves in the bud period of the NtLNP2 gene homozygous knockout material by using GC-MS;

the CRISPR/Cas9 system adopts a sgRNA sequence of GAGACCTGCAGATCTACCCGCGG, and the sgRNA sequence adopts a primer sequence of:

the upstream primer sgRNA-F: GATTGGAGACCTGCAGATCTACCCG;

the downstream primer sgRNA-R: AAACCGGGTAGATCTGCAGGTCTCC;

the variety of the tobacco is safflower Dajinyuan.

2. The use according to claim 1, wherein step (1) is specifically:

designing an sgRNA guide sequence, annealing an upstream primer sgRNA-F and a downstream primer sgRNA-R to form a double chain, and performing restriction enzyme digestion on a CRISPR/Cas9 vector pORE-Cas9 by using restriction enzyme BsaI-HF; connecting the double-stranded product formed by annealing with the carrier skeleton cut by enzyme by using T4 ligase; and (3) converting the connection product into competent cells of escherichia coli, detecting to obtain positive clones, and extracting the recombinant plasmid to obtain the CRISPR-Cas9 expression vector.

3. The use according to claim 1, wherein step (3) is specifically:

and soaking the infected tobacco leaf disc with agrobacterium tumefaciens LBA4404 bacterial liquid carrying the CRISPR/Cas9-sgRNA expression vector, and obtaining the T0 generation editing plant seeds and the T1 generation seeds.

4. The use according to claim 1, wherein the chromatographic conditions in step (4) are:

the gas chromatography conditions were: chromatographic column: DB-35MS; the specification is as follows: 30mm×0.25mm ×0.25m; sample introduction temperature: 250. the temperature is lower than the temperature; column flow rate: 1.0mL/min; nicotine sample injection volume: 1.0L, split-flow sample introduction, wherein the split-flow ratio is 40:1; other alkaloid sample injection volumes: 2.0L, split-flow sample introduction, wherein the split-flow ratio is 10:1; heating program: the initial temperature is 100 ℃, and the temperature is kept for 3min; raising the temperature to 260 ℃ at a speed of 8 ℃/min, and keeping for 10min;

mass spectrometry conditions: transmission line temperature: 280. the temperature is lower than the temperature; ionization mode: an electron bombardment source; ionization energy: 70eV; ion source temperature: 230. the temperature is lower than the temperature; solvent delay: 8min; the measurement method comprises the following steps: the ion monitoring mode is selected for scanning.