CN114507688A - Application of tobacco NtCNGC4 gene in preparation of tobacco mutant material for regulating plant height and leaf amino acid content - Google Patents
Application of tobacco NtCNGC4 gene in preparation of tobacco mutant material for regulating plant height and leaf amino acid content Download PDFInfo
- Publication number
- CN114507688A CN114507688A CN202210358122.2A CN202210358122A CN114507688A CN 114507688 A CN114507688 A CN 114507688A CN 202210358122 A CN202210358122 A CN 202210358122A CN 114507688 A CN114507688 A CN 114507688A
- Authority
- CN
- China
- Prior art keywords
- tobacco
- ntcngc4
- gene
- amino acid
- acid content
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention discloses an application of a tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating plant height and leaf amino acid content, wherein the preparation method of the mutant material comprises the following steps: (1) selecting a guide sequence with a more specific 23nt nucleotide sequence in NtCNGC4 gene as CRISPR/Cas9, connecting the sequence fragment with a CRISPR/Cas9 vector, converting, detecting by PCR amplification, and carrying out PCR positive cloning to obtain a CRISPR/Cas9-NtCNGC4 editing vector; (2) and (3) carrying out genetic transformation and tissue culture by using the constructed CRISPR/Cas9-NtCNGC4 editing vector to obtain a plant subjected to knockout editing of the tobacco NtCNGC 4. The tobacco gene editing plant knocked out by the NtCNGC4 gene obtained by the invention is short and small, and the amino acid content of leaves is obviously reduced.
Description
Technical Field
The invention relates to the technical field of plant genetic engineering, in particular to application of a tobacco NtCNGC4 gene in preparation of a tobacco mutant material for regulating plant height and leaf amino acid content.
Background
Cyclic Nucleotide Gated Channels (CNGCs) belong to the non-selective cation channel gene family and are widely found in animals and plants. Some genes of the CNGCs family have been cloned and studied in plants such as barley, Arabidopsis thaliana, maize, tobacco, etc., and are a type of channel gated by cyclic nucleotide (cAMP). Researches show that the plant CNGCs can permeate cations such as potassium, sodium, calcium, magnesium and the like, are related to physiological processes such as heavy metal stress, salt stress, plant pathogenic reaction and the like, and also participate in the regulation and control of the growth and development of plants.
The function of the cyclic nucleotide gating channel gene in the regulation and control of the plant height and leaf amino acid content of tobacco is not reported at present.
Disclosure of Invention
The invention aims to solve the technical problem of providing the application of the tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating the plant height and the leaf amino acid content, and providing material reference for regulating the plant height and the leaf amino acid content of the tobacco.
The technical problem to be solved by the invention is realized by the following technical scheme:
an application of a tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating plant height and leaf amino acid content.
Preferably, in the above technical solution, the method for creating the mutant material comprises the following steps:
(1) selecting a guide sequence with a more specific 23nt nucleotide sequence in NtCNGC4 gene as CRISPR/Cas9, connecting the sequence fragment with a CRISPR/Cas9 vector, converting, detecting by PCR amplification, and carrying out PCR positive cloning to obtain a CRISPR/Cas9-NtCNGC4 editing vector;
(2) and (3) carrying out genetic transformation and tissue culture by using the constructed CRISPR/Cas9-NtCNGC4 editing vector to obtain a plant with NtCNGC4 gene subjected to knockout editing.
Preferably, in the above technical solution, the method further includes:
(3) and detecting the amino acid content of leaves of NtCNGC4 gene homozygous knockout materials by adopting GC-MS.
Preferably, in the above technical solution, the method further includes:
(4) and observing the growth condition of the plants by adopting a breeding experiment planting method.
Preferably, in the above technical scheme, the primer sequence for amplifying NtCNGC4 gene is:
an upstream primer F: TATTCCCAAACCCATAAAC (SEQ ID No. 3);
a downstream primer R: GGAGTGTTACCTTAGTGGTTCTTTG (SEQ ID No. 4).
Preferably, in the above technical scheme, in step (1), the more specific 23nt nucleotide sequence in the NtCNGC4 gene is shown as SEQ ID No. 5.
Preferably, in the above technical scheme, the tobacco variety is Honghuadajinyuan.
The technical scheme of the invention has the following beneficial effects:
(1) according to the invention, a CRISPR/Cas9 editing vector for knocking out the NtCNGC4 gene is constructed through a CRISPR/Cas9 mediated gene editing technology, and a tobacco plant with the NtCNGC4 gene knocked out is obtained after editing material creation and molecular detection and identification. Compared with a control tobacco plant, the tobacco gene editing plant with the NtCNGC4 gene knocked out obtained by the invention is shorter and smaller, and provides a material reference for cultivating a tobacco variety with a regulated plant height.
(2) According to the invention, the NtCNGC4 gene is knocked out by using a CRISPR/Cas9 mediated gene editing technology, so that a tobacco gene editing material with the remarkably reduced amino acid content in leaves is obtained, a theoretical basis is provided for further clarifying a tobacco amino acid regulation and control mechanism, and a material reference is provided for cultivating tobacco varieties with the remarkably changed amino acid content.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description, serve to explain the principles of the invention.
Fig. 1 is a plant height comparison graph of NtCNGC4 gene editing material plants and control plants of the present application.
FIG. 2 is a schematic diagram showing the decrease in leaf amino acid content of plants edited by the NtCNGC4 gene of the present application.
Detailed Description
Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that: the relative arrangement of the components and steps, the numerical expressions and numerical values set forth in these embodiments do not limit the scope of the present invention unless specifically stated otherwise.
All experimental procedures used in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 obtainment of NtCNGC4 Gene
This example mainly refers to the process of obtaining the gene NtCNGC4 related to the tobacco cyclic nucleotide gating channel, and is briefly described as follows.
Taking cultivated species tobacco safflower large gold element leaves as samples, extracting total RNA of the tobacco leaves by utilizing an RNA extraction kit, and carrying out reverse transcription to obtain cDNA for later use:
extracting total RNA of tobacco according to the instruction of the plant RNA extraction kit.
Mu.g of total RNA was extracted from leaves for reverse transcription in the following transcription system:
Total RNA 1μg，
Oligo(dT)(10μM) 1.5μL，
ddH2O up to 15μL。
mixing the above system, placing in PCR, keeping temperature at 70 deg.C for 5min, removing, immediately placing on ice for 5min, and adding the following reagents into the system:
the system is put into a PCR instrument, is kept at 42 ℃ for 65min, 65 ℃ for 10min and 4 ℃ and then is stored in a refrigerator at-20 ℃ for use.
By a homologous alignment method, referring to the sequence of an arabidopsis gene and the known partial gene sequence of tobacco, the sequence of an amplification primer is designed as follows:
an upstream primer F: TATTCCCAAACCCATAAAC (SEQ ID No. 3);
a downstream primer R: GGAGTGTTACCTTAGTGGTTCTTTG (SEQ ID No. 4).
And (3) performing PCR amplification by using the prepared cDNA as a template and the primers:
amplification system (50 μ L):
mixing, centrifuging and performing PCR amplification, wherein the PCR reaction conditions are as follows: 30 cycles of 95 ℃ for 10sec, 52 ℃ for 30sec, and 72 ℃ for 2.5 min; 10min at 72 ℃; hold at 12 ℃.
And (3) purifying and sequencing the amplified product to obtain a gene NtCNGC4 sequence related to the tobacco cyclic nucleotide gating channel, wherein the base sequence is shown as SEQ ID No.1 and comprises 2019bp bases. After the gene sequence is translated, the coded protein sequence is shown as SEQ ID No.2 and comprises 672 amino acids in total, and further comparative analysis shows that the protein contains a sequence with high homology and is highly conserved.
EXAMPLE 2 construction of the vector
By using the tobacco cyclic nucleotide gated channel related gene NtCNGC4 obtained in example 1, the invention further constructs a CRISPR/Cas9 vector, and obtains a gene editing plant by using leaf disc method transformation.
(1) Design and synthesis of sgRNA sequence of NtCNGC4 gene:
selecting a specific 23nt nucleotide sequence (SEQ ID No.5) in the NtCNGC4 gene as a guide sequence of CRISPR/Cas9, connecting the sequence fragment with a CRISPR/Cas9 vector (provided by southwest university), converting and detecting by PCR amplification, sending PCR positive clone to a sequencing company for sequencing confirmation, and finally obtaining the CRISPR/Cas9-NtCNGC4 editing vector.
EXAMPLE 3 transformation of Agrobacterium
The CRISPR/Cas9-NtCNGC4 constructed in the previous step of example 2 is used for editing vector plasmids, and genetic transformation and tissue culture are carried out by taking a safflower large gold element as an example to obtain plants subjected to knockout editing of a gene NtCNGC4 related to a tobacco cyclic nucleotide gated channel, wherein related experimental processes are briefly introduced as follows.
Inoculating sterilized tobacco seed onto MS culture medium, culturing to 4 cotyledons (15-20d), transferring into culture bottle containing MS solid culture medium, and culturing at 25 + -1 deg.C under illumination intensity of 30-50 μmol/(m)2S) and culturing for 35-40d under the condition of 16h/d illumination time for later use.
LBA4404 preserved at-80 ℃ is taken out to be electrically transformed into competent Agrobacterium cells, and the cells are frozen and thawed on ice. When competence is just thawed, 2 μ L of CRISPR/Cas9-NtCNGC4 editing vector plasmid is added, mixed evenly and placed on ice. And then transferring the uniformly mixed competence into a precooled electric rotor, placing the electric rotor into an electric rotor for conversion, adding 1mL of YEB liquid culture medium after the conversion is finished, mixing with the conversion solution, and then placing the mixture in a shaking table at 28 ℃ and culturing for 1.5-2h at 200 rpm. The cells were centrifuged at 8000rpm to discard the supernatant medium, and then suspended in 200. mu.L of YEB liquid medium, spread on YEB solid medium containing 50mg/L rifampicin, 50mg/L streptomycin and 50mg/L kanamycin, and cultured in 28 ℃ inversion dark for 2-3 d.
Example 4 infection of callus
Preparing tobacco leaf disk into square leaf disk with side length of 1cm in superclean workbench, and preparing agrobacterium colony containing CRISPR/Cas9-NtCNGC4 editing vector by using MS liquid to form suspension bacterial liquid (OD)6000.6-0.8). And soaking and infecting the tobacco leaf discs for 10min by using the suspension agrobacterium liquid. Then, the leaf discs were placed on MS solid medium containing 2.0mg/L NAA +0.5 mg/L6-BA, incubated at 28 ℃ in the dark for 3 d. Then, subculture is carried out, and the subcultured cells are placed on an MS solid culture medium containing 2.0mg/L NAA, 0.5 mg/L6-BA, 250mg/L Cb and 50mg/L Kan under the culture conditions that: culturing at 28 deg.C for 16h/d with illumination intensity of 30-50 μmol/(m)2S), culturing in the dark at 25 ℃ for 8h/d, culturing for 45-60d until a differentiated bud is formed, and replacing the differentiation culture medium for 3-4 times every 7-10 d; culturing until a differentiated bud is formed; cutting off callus formed by existing differentiated bud, culturing on MS culture medium containing carbenicillin 500mg/L and kanamycin 50mg/L, culturing for 8-14d when the differentiated bud on callus grows to 2-4cm high and the culture condition is the same as that of differentiated culture; and (2) performing rooting culture on the regenerated plant, cutting a differentiated bud, inserting the cut differentiated bud into an MS culture medium containing 500mg/L carbenicillin and 50mg/L kanamycin to perform rooting culture, wherein the culture condition is consistent with the differentiation culture condition, culturing for 20-30d, performing regeneration and transplantation to a flowerpot, then performing transformation plant leaf sampling, delivering a Huada gene to perform molecular detection, determining to obtain an NtCNGC4 gene editing plant, and then performing seed harvesting to obtain T0 generation editing plant seeds. Carrying out self-copulating and auto-propagating on seeds of T0 generation by 23 times, when the plants grow to 5-6 leaves, sampling the leaves of the single plant, carrying out molecular detection on the Huada gene, determining to obtain the plants subjected to homozygous editing of the NtCNGC4 gene, and then harvesting to obtain the seeds subjected to homozygous editing of the NtCNGC4 gene.
The application of the tobacco cyclic nucleotide gated channel gene NtCNGC4 is to reduce the expression of the NtCNGC4 gene in a tobacco plant body and regulate the height of the tobacco plant and the content of amino acids in leaves. Methods of reducing gene expression or gene silencing commonly used in the art are suitable for use in the present invention.
Example 5GC-MS detection
The plants determined to be NtCNGC4 gene homozygous knockout by molecular detection in example 2 are used for seed collection to obtain gene homozygous editing materials. Then, the amino acid content of leaves of NtCNGC4 gene homozygous knockout material was tested by GC-MS.
Selecting tobacco plants in a mature period, and respectively collecting tobacco leaf samples of the same leaf position of 5 control (unedited) tobacco plants and tobacco plants subjected to NtCNGC4 gene homozygous editing; removing main ribs from leaves, wrapping with tinfoil paper, storing in liquid nitrogen, transporting, storing at ultralow temperature (-70 deg.C) in laboratory, lyophilizing, grinding, and sieving.
Derivation process of the standard: accurately sucking 1mL of mixed standard sample, adding 1mL of 1mol/L triethylamine acetonitrile solution, adding 1mL of 0.1mol/L phenyl isothiocyanate acetonitrile solution, uniformly mixing for 1min in a vortex mode, reacting at room temperature for half an hour, adding 2mL of n-hexane solution after complete reaction, vortex for 1min, standing for 10min, taking 200 mu L of lower layer clear liquid, placing in a sample bottle, adding 800 mu L of ultrapure water, uniformly mixing for 15s, filtering, and supplying liquid for liquid phase analysis. (standard curve range: 2.5. mu.g/mL-50. mu.g/mL).
Sample pretreatment and derivation: weighing 0.3000g of tobacco powder, placing the tobacco powder in a 15mL centrifuge tube, adding 5mL of 0.1mol/L hydrochloric acid aqueous solution, carrying out ultrasonic extraction for 40min, centrifuging for 10min at 8000r/min, accurately transferring 1mL of supernatant, adding 1mL of 1mol/L triethylamine acetonitrile solution, adding 1mL of 0.1mol/L phenyl isothiocyanate acetonitrile solution, carrying out vortex mixing for 1min, reacting for half an hour, adding 2mL of n-hexane solution after complete reaction, carrying out vortex mixing for 1min, standing for 10min, taking 200 mu L of subnatant, adding 800 mu L of ultrapure water, mixing for 15s, filtering, placing in a sample bottle, and carrying out liquid phase analysis.
The instrument method comprises the following steps:
a:50mmol/L sodium acetate (ph 6.5) (93:7 acetonitrile);
b, methanol: ACN: 2:6: 2;
a chromatographic column: dikma endavesil C18, 100 x 2.1mm, 1.8 μm;
wavelength: 254 nm;
column temperature: 40 ℃;
comparison of amino acid content in leaves of homozygous edited tobacco and control (unedited) plants with the NtCNGC4 gene (results are shown in FIG. 2). Compared with a control, the contents of arginine, proline, histidine, total amino acid and the like in leaves of tobacco plants homozygously edited by the NtCNGC4 gene are all obviously reduced.
Example 6
The plants determined to be NtCNGC4 gene homozygous knockout by molecular detection in example 2 are used for seed collection to obtain gene homozygous editing materials. Then, the growth condition of the plants is observed by adopting a breeding experiment planting method.
5-10 editing materials and comparison materials in the mature period are selected to investigate the characteristics of plant height, top leaf length, top leaf width, leaf number and the like.
The result shows that the plant height of the NtCNGC4 gene editing material is obviously lower than that of a control (unedited) safflower macrogol, and the length, width, number and the like of the top leaf have no obvious difference with the control.
Although the present invention has been described with reference to the above embodiments, it should be understood that the present invention is not limited thereto, and various changes and modifications may be made by those skilled in the art without departing from the spirit and scope of the present invention.
Sequence listing
<110> Limited liability company for tobacco industry in Yunnan province
<120> application of tobacco NtCNGC4 gene in preparation of tobacco mutant material for regulating plant height and leaf amino acid content
<130> WPC220771
<141> 2022-04-06
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2019
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggctactc ataatcttga acttgaacta tcacataatt acagtgacag taatgatgat 60
gacgaggatg aggagcaaga catcgatgaa gaaatagaag tggagggaaa agaagaaaat 120
aattctaatg agtacaacaa caattgcgga gtttgtagtg gtcgtggtcg tggtcgagga 180
ggactggcag gctttttctc cgggaaagtt atagacccga gagcgccttg ggttcaagaa 240
tggaacagaa tattcttact agtatgtgcc actggacttt ttgtggatcc actatttttc 300
tatgctcttt ctattagtga gaattgtatt tgcctcttca tcgacgggtg gttcgccgtc 360
acggtcacgg ctctccggtg catgactgat gccttgcatt tatggaacat gtggctacaa 420
ttcagaatga acaaattacg tcctcatgat aagaatcctc cacgttctgt ggctttacga 480
tatttgaagg ctaaaaaagg gttctttttt gatctatttg tcatccttcc tttgccgcag 540
atagtgatgt gggtagcgat tccagatcta ctggagaaag gatctataac aacagtgatg 600
acagtgttgt taataatgtt tctgtttcag tacctgccca aaatctatca ctccgtttgc 660
ctattgcggc ggatgcaagg tctctccggc tacatatttg gcactgtttg gtggggaatt 720
gctctcaact tgatcgccta ttttgtcgct tcccacgctg tgggagcatg ttggtacttg 780
ctaggaatcc aaagggctgc gaaatgtttg aaacaacagt gtgaaattac aaaaggttgt 840
ggcctcagaa tgttggcctg cgaagagtca atatattatg gaacaactac tctggtgaag 900
cacaaaagtc gactcatatg gggtgagacc aaacttgcta gatcgacgtg cctatcctct 960
gaagaaagtt ttgactatgg agcttataaa tggactgttc aacttgtcac taatgaaaat 1020
cttcttgaga aaatcctctt tcccattttc tggggtctca tgactctcag tacttttggc 1080
aacctggaga gcacaacaga ttggctagaa ttagtattca taatcatcgt tcttactagt 1140
gggctacttc tggtcaccat gttgattggt aacatcaagg ttttcttgca tgcaacgaca 1200
tcaaagaaac aggcaatgca acttaagatg agaaatgtag agtggtggat gaggaggaga 1260
agattgccac aggattacaa gcaaagagtg agaaactatg aacggcaaag atatgcagca 1320
acgcgtggag ttgatgaatg cgaaatgata cataaccttc ctgagggtct tagaagggac 1380
atcaaatacc atctttgttt ggacttggtc agacaggttc ctctatttca gcatatggat 1440
aatttggtcc tggagaacat atgtgatcgc gtgaaatccc tgatttttac aaaaggagaa 1500
acaataacta gagagggcga tccagttcag agaatgttat tcatagtgag aggccatctc 1560
caaagtagtc aagtacttcg agacggtgta aaaagttgct gcatgttagg tcccggaaac 1620
ttcagcggcg acgaacttct ttcatggtgc ctccgacgac ccttcgtgga gcgactgccg 1680
ccatcctcat catcattagt gactcttgaa accactgaag cctttggtct tgaagctgac 1740
gatgtaaagt atgtaacaca acattttcgg tacacatttg tggacgaaaa agtcaagaga 1800
agtgctagat attattctcc aggatggaga acttgggcag cagttgctat tcaattggct 1860
tggaggagat ataaacacag gttgacactc acctcgttgt cgtttattag accaagaaga 1920
ccattatctc gatgttcttc actaacggag gacagactca agctttatac ggctttgctt 1980
acttcgccaa agcctaatca ggatgatttt gatttttaa 2019
<210> 2
<211> 672
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Ala Thr His Asn Leu Glu Leu Glu Leu Ser His Asn Tyr Ser Asp
1 5 10 15
Ser Asn Asp Asp Asp Glu Asp Glu Glu Gln Asp Ile Asp Glu Glu Ile
20 25 30
Glu Val Glu Gly Lys Glu Glu Asn Asn Ser Asn Glu Tyr Asn Asn Asn
35 40 45
Cys Gly Val Cys Ser Gly Arg Gly Arg Gly Arg Gly Gly Leu Ala Gly
50 55 60
Phe Phe Ser Gly Lys Val Ile Asp Pro Arg Ala Pro Trp Val Gln Glu
65 70 75 80
Trp Asn Arg Ile Phe Leu Leu Val Cys Ala Thr Gly Leu Phe Val Asp
85 90 95
Pro Leu Phe Phe Tyr Ala Leu Ser Ile Ser Glu Asn Cys Ile Cys Leu
100 105 110
Phe Ile Asp Gly Trp Phe Ala Val Thr Val Thr Ala Leu Arg Cys Met
115 120 125
Thr Asp Ala Leu His Leu Trp Asn Met Trp Leu Gln Phe Arg Met Asn
130 135 140
Lys Leu Arg Pro His Asp Lys Asn Pro Pro Arg Ser Val Ala Leu Arg
145 150 155 160
Tyr Leu Lys Ala Lys Lys Gly Phe Phe Phe Asp Leu Phe Val Ile Leu
165 170 175
Pro Leu Pro Gln Ile Val Met Trp Val Ala Ile Pro Asp Leu Leu Glu
180 185 190
Lys Gly Ser Ile Thr Thr Val Met Thr Val Leu Leu Ile Met Phe Leu
195 200 205
Phe Gln Tyr Leu Pro Lys Ile Tyr His Ser Val Cys Leu Leu Arg Arg
210 215 220
Met Gln Gly Leu Ser Gly Tyr Ile Phe Gly Thr Val Trp Trp Gly Ile
225 230 235 240
Ala Leu Asn Leu Ile Ala Tyr Phe Val Ala Ser His Ala Val Gly Ala
245 250 255
Cys Trp Tyr Leu Leu Gly Ile Gln Arg Ala Ala Lys Cys Leu Lys Gln
260 265 270
Gln Cys Glu Ile Thr Lys Gly Cys Gly Leu Arg Met Leu Ala Cys Glu
275 280 285
Glu Ser Ile Tyr Tyr Gly Thr Thr Thr Leu Val Lys His Lys Ser Arg
290 295 300
Leu Ile Trp Gly Glu Thr Lys Leu Ala Arg Ser Thr Cys Leu Ser Ser
305 310 315 320
Glu Glu Ser Phe Asp Tyr Gly Ala Tyr Lys Trp Thr Val Gln Leu Val
325 330 335
Thr Asn Glu Asn Leu Leu Glu Lys Ile Leu Phe Pro Ile Phe Trp Gly
340 345 350
Leu Met Thr Leu Ser Thr Phe Gly Asn Leu Glu Ser Thr Thr Asp Trp
355 360 365
Leu Glu Leu Val Phe Ile Ile Ile Val Leu Thr Ser Gly Leu Leu Leu
370 375 380
Val Thr Met Leu Ile Gly Asn Ile Lys Val Phe Leu His Ala Thr Thr
385 390 395 400
Ser Lys Lys Gln Ala Met Gln Leu Lys Met Arg Asn Val Glu Trp Trp
405 410 415
Met Arg Arg Arg Arg Leu Pro Gln Asp Tyr Lys Gln Arg Val Arg Asn
420 425 430
Tyr Glu Arg Gln Arg Tyr Ala Ala Thr Arg Gly Val Asp Glu Cys Glu
435 440 445
Met Ile His Asn Leu Pro Glu Gly Leu Arg Arg Asp Ile Lys Tyr His
450 455 460
Leu Cys Leu Asp Leu Val Arg Gln Val Pro Leu Phe Gln His Met Asp
465 470 475 480
Asn Leu Val Leu Glu Asn Ile Cys Asp Arg Val Lys Ser Leu Ile Phe
485 490 495
Thr Lys Gly Glu Thr Ile Thr Arg Glu Gly Asp Pro Val Gln Arg Met
500 505 510
Leu Phe Ile Val Arg Gly His Leu Gln Ser Ser Gln Val Leu Arg Asp
515 520 525
Gly Val Lys Ser Cys Cys Met Leu Gly Pro Gly Asn Phe Ser Gly Asp
530 535 540
Glu Leu Leu Ser Trp Cys Leu Arg Arg Pro Phe Val Glu Arg Leu Pro
545 550 555 560
Pro Ser Ser Ser Ser Leu Val Thr Leu Glu Thr Thr Glu Ala Phe Gly
565 570 575
Leu Glu Ala Asp Asp Val Lys Tyr Val Thr Gln His Phe Arg Tyr Thr
580 585 590
Phe Val Asp Glu Lys Val Lys Arg Ser Ala Arg Tyr Tyr Ser Pro Gly
595 600 605
Trp Arg Thr Trp Ala Ala Val Ala Ile Gln Leu Ala Trp Arg Arg Tyr
610 615 620
Lys His Arg Leu Thr Leu Thr Ser Leu Ser Phe Ile Arg Pro Arg Arg
625 630 635 640
Pro Leu Ser Arg Cys Ser Ser Leu Thr Glu Asp Arg Leu Lys Leu Tyr
645 650 655
Thr Ala Leu Leu Thr Ser Pro Lys Pro Asn Gln Asp Asp Phe Asp Phe
660 665 670
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tattcccaaa cccataaac 19
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggagtgttac cttagtggtt ctttg 25
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aactcacctg cggcaaagga agg 23
Claims (7)
1. An application of a tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating plant height and leaf amino acid content.
2. The application of the tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating the plant height and the leaf amino acid content as claimed in claim 1, wherein the preparation method of the mutant material comprises the following steps:
(1) selecting a guide sequence with a more specific 23nt nucleotide sequence in NtCNGC4 gene as CRISPR/Cas9, connecting the sequence fragment with a CRISPR/Cas9 vector, converting, detecting by PCR amplification, and carrying out PCR positive cloning to obtain a CRISPR/Cas9-NtCNGC4 editing vector;
(2) and (3) carrying out genetic transformation and tissue culture by using the constructed CRISPR/Cas9-NtCNGC4 editing vector to obtain a plant with the tobacco NtCNGC4 gene subjected to knockout editing.
3. The application of the tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating the plant height and the leaf amino acid content according to claim 1, further comprising:
(3) and detecting the amino acid content of leaves of NtCNGC4 gene homozygous knockout materials by adopting GC-MS.
4. The application of the tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating the plant height and the leaf amino acid content according to claim 1, further comprising:
(4) and observing the growth condition of the plants by adopting a breeding experiment planting method.
5. The application of the tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating plant height and leaf amino acid content according to claim 1, wherein the primer sequence for amplifying the NtCNGC4 gene is as follows:
an upstream primer F: TATTCCCAAACCCATAAAC (SEQ ID No. 3);
a downstream primer R: GGAGTGTTACCTTAGTGGTTCTTTG (SEQ ID No. 4).
6. The application of the tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating plant height and leaf amino acid content according to claim 1, wherein in step (1), a more specific 23nt nucleotide sequence in the NtCNGC4 gene is shown as SEQ ID No. 5.
7. The application of the tobacco NtCNGC4 gene in preparing a tobacco mutant material for regulating plant height and leaf amino acid content according to claim 1, wherein the tobacco variety is Honghuadajinyuan.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210358122.2A CN114507688A (en) | 2022-04-06 | 2022-04-06 | Application of tobacco NtCNGC4 gene in preparation of tobacco mutant material for regulating plant height and leaf amino acid content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210358122.2A CN114507688A (en) | 2022-04-06 | 2022-04-06 | Application of tobacco NtCNGC4 gene in preparation of tobacco mutant material for regulating plant height and leaf amino acid content |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114507688A true CN114507688A (en) | 2022-05-17 |
Family
ID=81554748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210358122.2A Pending CN114507688A (en) | 2022-04-06 | 2022-04-06 | Application of tobacco NtCNGC4 gene in preparation of tobacco mutant material for regulating plant height and leaf amino acid content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114507688A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116590304A (en) * | 2023-04-06 | 2023-08-15 | 东北农业大学 | Onion AcCNGC2 gene and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636128A (en) * | 2016-11-15 | 2017-05-10 | 内蒙古和盛生态育林有限公司 | CNGC2 gene and application of amino acid sequence encoded by CNGC2 gene in cultivation of new varieties of plants |
| CN108660141A (en) * | 2018-05-28 | 2018-10-16 | 贵州省烟草科学研究院 | Application of the NtCNGC1 genes in tobacco resistance to bacterial wilt |
-
2022
- 2022-04-06 CN CN202210358122.2A patent/CN114507688A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636128A (en) * | 2016-11-15 | 2017-05-10 | 内蒙古和盛生态育林有限公司 | CNGC2 gene and application of amino acid sequence encoded by CNGC2 gene in cultivation of new varieties of plants |
| CN108660141A (en) * | 2018-05-28 | 2018-10-16 | 贵州省烟草科学研究院 | Application of the NtCNGC1 genes in tobacco resistance to bacterial wilt |
Non-Patent Citations (5)
| Title |
|---|
| GENGER RK, ET AL.: "Signaling pathways that regulate the enhanced disease resistance of Arabidopsis \"defense, no death\" mutants", 《MOL PLANT MICROBE INTERACT》, vol. 21, no. 10, pages 1285 - 1296 * |
| GRACE I. JURKOWSKI ET AL.: "Arabiodopsis DND2, a second cyclic nucleotide-gated ion channel gene for which mutation causes the "Defense, No Death" phenotype", 《MOLECULAR PLANT-MICROBE INTERACTIONS : MPMI》, vol. 17, no. 5, pages 515 * |
| NAWAZ Z, ET AL.: "Genome-wide identification, evolution and expression analysis of cyclic nucleotide-gated channels in tobacco (Nicotiana tabacum L.)", 《GENOMICS》, vol. 111, no. 2, pages 121 - 133 * |
| 王月;侯和胜;: "植物环核苷酸门控通道(CNGC)基因家族的结构与功能", 《植物生理学通讯》, no. 01, pages 1 - 8 * |
| 蒋佳芮等: "烟草单倍体基因编辑系统的建立", 《中国烟草学报》, vol. 26, no. 5, pages 66 - 71 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116590304A (en) * | 2023-04-06 | 2023-08-15 | 东北农业大学 | Onion AcCNGC2 gene and application thereof |
| CN116590304B (en) * | 2023-04-06 | 2024-01-26 | 东北农业大学 | Onion AcCNGC2 gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2505085A1 (en) | Production of increased oil and protein in plants by the disruption of the phenylpropanoid pathway | |
| CN113999857B (en) | Gene related to synthesis regulation of nicotine in tobacco and application thereof | |
| CN113046371A (en) | Tobacco peroxidase related gene and application thereof | |
| CN114507688A (en) | Application of tobacco NtCNGC4 gene in preparation of tobacco mutant material for regulating plant height and leaf amino acid content | |
| CN113151307A (en) | Gene related to tobacco ethylene response transcription factor and application thereof | |
| CN112048515B (en) | Rape S-adenosine-L-methionine dependent methyltransferase gene BnPMT6 and application thereof | |
| CN110862445B (en) | NtOEP1 gene influencing tobacco pigment content and application thereof | |
| CN114438105B (en) | Tobacco NtMLO6-1 gene and knockout method and application thereof | |
| CN113980978B (en) | Tobacco nicotine transporter related gene and application thereof | |
| CN113151296B (en) | Tobacco heat shock protein related gene and application thereof | |
| CN114807215A (en) | Application of tobacco methionine sulfoxide reductase gene NtE4 in tobacco stress resistance | |
| CN114426973B (en) | Tobacco guide protein related gene NtImpα4 and application thereof | |
| CN114836430B (en) | Application of tobacco ABA receptor protein gene NtPYL6 in regulation and control of tobacco plant height and leaf rutin content | |
| CN114591979B (en) | Tobacco ubiquitin conjugated enzyme NtE gene and application thereof | |
| CN114540368B (en) | Application and method of tobacco amino acid transporter related gene NtLHT1 | |
| CN114085845B (en) | Tobacco nicotine metabolism related gene and application thereof | |
| CN114807081B (en) | Tobacco glutathione transfer related gene and application thereof | |
| CN114875043B (en) | Betula alba BpPIF4 gene participating in adventitious root development and application thereof | |
| CN110904067B (en) | Tobacco chlorogenic acid synthetic gene NtHQT and application thereof | |
| CN114990133B (en) | Tobacco carotenoid metabolism related gene and application | |
| CN117210490B (en) | PCHR gene for regulating and controlling malus plant self-flower fructification and application thereof | |
| CN111118029B (en) | Key gene PmARF6 for regulating and controlling blossoming of masson pine and application thereof | |
| CN112724215B (en) | Gene and method for changing flowering period of corn | |
| CN113789327B (en) | Dendrobium officinale constitutive strong promoter ProDoWOX1 and application thereof | |
| CN114106120B (en) | Heavy metal transport protein PhHMA5II-1 and related products and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |