CN113046371A

CN113046371A - Tobacco peroxidase related gene and application thereof

Info

Publication number: CN113046371A
Application number: CN202110302806.6A
Authority: CN
Inventors: 许力; 高茜; 许�永; 曾婉俐; 蒋佳芮; 李雪梅; 李正风; 向海英; 刘欣; 杨文武; 邓乐乐; 张建铎
Original assignee: China Tobacco Yunnan Industrial Co Ltd
Current assignee: China Tobacco Yunnan Industrial Co Ltd
Priority date: 2021-03-22
Filing date: 2021-03-22
Publication date: 2021-06-29

Abstract

The invention relates to a gene related to tobacco peroxidase and application thereof, wherein a nucleotide sequence is shown as SEQ ID No. 1. According to the tobacco peroxidase-related gene NtPOD7 provided by the invention, a gene NtPOD7 is knocked out by using a CRISPR/Cas 9-mediated gene editing technology to obtain a gene editing plant with reduced expression amount under stress resistance, and fluorescent quantitative PCR is used for finding that the expression amount of the NtPOD7 gene of the obtained gene editing plant has no obvious difference compared with that of a control plant under normal conditions; however, under the conditions of drought stress and salt stress, the expression quantity of the NtPOD7 gene of the gene editing plant is obviously lower than that of a control plant, so that genetic materials and theoretical bases are provided for research on tobacco peroxidase and research on tobacco stress resistance.

Description

Tobacco peroxidase related gene and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a tobacco peroxidase-related gene and application thereof.

Background

Plant peroxidases are encoded by a number of superfamily genes, either secreted from plant cells or transported into the vacuole via the Endoplasmic Reticulum (ER). Peroxidases play a variety of biological roles in plants, a widely-occurring oxidoreductase in plants, an important plant protective enzyme in normal plant growth and stress response, and most commonly, class III secreted peroxidases, whose biological function is to catalyze the removal of H₂O₂And participate in oxidation of toxic reducing agents, biosynthesis and degradation of lignin, plant morphogenesis and the like, and in environmental stress responses such as injury, pathogen attack, oxidative stress and the like. Owing to their physiologically important role in plants, peroxidases have been the subject of extensive biochemical and molecular biological research.

Peroxidases exhibit a variety of expression patterns in response to abiotic and biotic environmental stresses, such as mechanical damage, ethylene, pathogen infection, drought, low temperature, light and plant growth regulators. The peroxidase gene CanPOD in the pepper shows different expression levels in different tissues of the pepper, and the result shows that the phytophthora capsici can remarkably induce the CanPOD; CanPOD was also up-regulated in leaves after salt and drought stress treatment; the signal hormone Salicylic Acid (SA) strongly induces can pod expression. CanPOD is involved in defense responses of pepper plants against phytophthora capsici infection and in abiotic stress.

The tobacco is used as important economic crops and model crops in China, and has important significance in researching the molecular mechanism of response of the tobacco peroxidase gene to abiotic adversity stress. In the aspects of tobacco peroxidase gene cloning and function research, researchers clone tobacco peroxidase genes NtPOD1 and Ntpx belonging to class III secretory peroxidase from flue-cured tobacco variety K326 and common tobacco respectively. Both genes are expressed in roots, stems, leaves, flowers. Meanwhile, the plant is obviously induced by phytohormones such as high salt, drought and ABA.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, provides a tobacco peroxidase-related gene and application thereof, and provides genetic materials and theoretical basis for researching the stress resistance and gene function of tobacco.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

a tobacco peroxidase related gene has a nucleotide sequence shown in SEQ ID NO.1 and comprises 960bp bases, and is derived from tobacco (Nicotiana tabacum, named as NtPOD 7).

Preferably, the amino acid sequence of the protein coded by the gene related to the tobacco peroxidase is shown in SEQ ID NO.2 and comprises 319 amino acids.

The invention also provides application of the gene of the tobacco peroxidase in tobacco stress resistance. After the gene is edited, the tobacco has certain resistance to salt stress and drought stress in the seed germination seedling stage. The real-time fluorescent quantitative PCR shows that under normal conditions, the expression quantity of the NtPOD7 gene of the obtained gene editing plant has no obvious difference compared with that of a control (untransformed) plant; however, under the conditions of drought stress and salt stress, the expression level of the NtPOD7 gene of the gene editing plant is obviously lower than that of the control plant. The gene function research provides genetic material and theoretical basis for tobacco genetic improvement.

The invention has the beneficial effects that:

according to the invention, a CRISPR/Cas9 editing vector for knocking out NtPOD7 gene is constructed through a CRISPR/Cas9 mediated gene editing technology, and a safflower large gold plant with the NtPOD7 gene edited is obtained after genetic transformation. According to the invention, drought stress and salt stress treatment with different degrees are carried out in the seed germination seedling stage, and the growth (overground part and root length) of the NtPOD7 gene editing plant is obviously superior to that of a control (untransformed) plant under the conditions of drought stress and salt stress treatment.

The gene NtPOD7 related to the tobacco peroxidase is discovered through fluorescent quantitative PCR, and under normal conditions, the expression quantity of the NtPOD7 gene of an obtained gene editing plant has no obvious difference compared with a control (untransformed) plant; however, under the conditions of drought stress and salt stress, the expression level of the NtPOD7 gene of the gene editing plant is obviously lower than that of the control plant.

In conclusion, NtPOD7 gene is knocked out by using CRISPR/Cas9 mediated gene editing technology to obtain a gene editing plant with reduced expression amount under stress resistance, which provides genetic material and theoretical basis for research on tobacco peroxidase and research on tobacco stress resistance.

Drawings

FIG. 1 is a comparison of control (untransformed) plants and gene-edited plants at the germinating stage under different concentrations and treatment conditions (drought stress, salt stress), wherein (A) is a schematic dish distribution, (B) is a drought stress comparison, and (C) is a salt stress comparison;

FIG. 2 is a graph of the relative expression levels of NtPOD7 in control (untransformed) plant leaves and gene-edited plant leaves under different treatment conditions (control, drought stress, salt stress).

Detailed Description

The technical solutions of the present invention are described in detail below by examples, and the following examples are only exemplary and can be used only for explaining and explaining the technical solutions of the present invention, but not construed as limiting the technical solutions of the present invention.

In the embodiments of the present application, those who do not specify a specific technique or condition, and those who do follow the existing techniques or conditions in the field, and those who do not specify a manufacturer or a material used, are general products that can be obtained by purchasing.

The percentage numbers are volume percentages and the ratios are volume ratios unless otherwise specified.

The tobacco variety used in the application is Honghuadajinyuan, a commercialized tobacco variety.

Example 1

This example is described briefly below with respect to the procedure for obtaining the tobacco peroxidase-related gene NtPOD 7.

Taking cultivated species tobacco safflower large gold element leaves as samples, extracting total RNA of the tobacco leaves by utilizing an RNA extraction kit, and carrying out reverse transcription to obtain cDNA for later use:

extracting total RNA of tobacco according to the instruction of the plant RNA extraction kit.

Mu.g of total RNA was extracted from leaves for reverse transcription in the following transcription system:

Total RNA 1μg

Oligo(dT)(10μM)1.5μL

ddH₂O up to 15μL

mixing the above system, placing in PCR, keeping temperature at 70 deg.C for 5min, removing, immediately placing on ice for 5min, and adding the following reagents into the system:

the system is put into a PCR instrument, is kept at 42 ℃ for 65min, 65 ℃ for 10min and 4 ℃ and then is stored in a refrigerator at the temperature of minus 20 ℃ for use.

By a homologous alignment method, referring to the sequence of an arabidopsis gene and the known partial gene sequence of tobacco, the sequence of an amplification primer is designed as follows:

F：5’-CCCTTCAAAGTAATATATTTCT-3’，(SEQ ID No.3)

R：5’-TTAGTTGATCCTCCTGCAATTCTTCC-3’；(SEQ ID No.4)

and (3) performing PCR amplification by using the prepared cDNA as a template and the primers:

amplification system (50 μ L):

mixing, centrifuging and performing PCR amplification, wherein the PCR reaction conditions are as follows: 30 cycles of 95 ℃ for 10sec, 52 ℃ for 30sec, and 72 ℃ for 2.5 min; 10min at 72 ℃; hold at 12 ℃.

And purifying and sequencing the amplified product to obtain a tobacco peroxidase-related gene NtPOD7 sequence, wherein the base sequence is shown as SEQ ID No.1 and comprises 960bp bases in total. After the gene sequence is translated, the coded protein sequence is shown as SEQ ID No.2 and comprises 319 amino acids in total, and further comparative analysis shows that the protein contains a sequence with high homology and is highly conserved.

Example 2

By using the tobacco peroxidase-related gene NtPOD7 obtained in example 1, the invention further constructs a CRISPR/Cas9 vector, and obtains a gene editing plant by using leaf disc method transformation.

Selecting a specific 23nt nucleotide sequence (SEQ ID No.5) in NtPOD7 gene as a guide sequence of CRISPR/Cas9, connecting the sequence fragment with a CRISPR/Cas9 vector (provided by southwest university) to obtain a transformed clone, carrying out PCR amplification detection, sending a PCR positive clone to a sequencing company for sequencing confirmation, and finally obtaining the CRISPR/Cas9-NtPOD7 editing vector.

A vector plasmid is edited by using the CRISPR/Cas9-NtPOD7 constructed in the previous step, a genetic transformation test is carried out by taking a safflower macrogol as an example, so as to knock out a tobacco peroxidase-related gene NtPOD7 in a plant body, and related experimental processes are briefly introduced as follows.

Dibbling tobacco seeds in a culture dishWhen 4 cotyledons (15-20 days) are grown, they are transferred into culture bottles (containing 80mL MS liquid culture medium), 2 strains per bottle, and the illumination intensity is 30-50 μmol/(m) at 25 + -1 deg.C²S), and culturing for 40d under the condition of 16h/d illumination time for later use.

LBA4404 preserved at-80 ℃ is taken out to be electrically transformed into competent Agrobacterium cells, and the cells are frozen and thawed on ice. When competence had just thawed, 2 μ L of plasmid containing the edited NtPOD7 gene was added, gently mixed, and placed on ice. And transferring the uniformly mixed liquid into a precooled electric rotor, placing the electric rotor into an electric rotor for conversion, adding 1mL of YEB liquid culture medium after the conversion is finished, mixing the YEB liquid culture medium with the conversion solution, and then placing the mixture in a shaking table at 28 ℃ and culturing the mixture for 1.5 to 2 hours at 200 rpm. The cells were centrifuged at 8,000rpm to discard the supernatant medium, and then suspended in 200. mu.L of YEB liquid medium, and plated on YEB solid medium containing 50mg/L rifampicin, 50mg/L streptomycin and 50mg/L kanamycin for 2-3d by inversion in the dark at 28 ℃.

Preparing tobacco leaf disk into square leaf disk with side length of 1cm in ultra-clean workbench, and preparing Agrobacterium containing CRISPR/Cas9-NtPOD7 editing vector from MS liquid to form suspension bacterial liquid (OD)₆₀₀0.6-0.8). And soaking and infecting the tobacco leaf discs for 10min by using the suspension agrobacterium liquid. Then, the leaf discs were placed on MS solid medium containing 2.0mg/L NAA +0.5 mg/L6-BA, and were co-cultured at 28 ℃ in the dark for 3 days. Then, subculture is carried out, and the subcultured cells are placed on an MS solid culture medium containing 2.0mg/L NAA, 0.5 mg/L6-BA, 250mg/L Cb and 50mg/L Kan under the culture conditions that: culturing at 28 deg.C for 16h/d with illumination intensity of 30-50 μmol/(m)²S), culturing in the dark at 25 ℃ for 8h/d, culturing for 45-60d until a differentiated bud is formed, and replacing the differentiation culture medium for 5-6 times every 7-10 d; culturing until a differentiated bud is formed; cutting off callus formed by existing differentiated bud, culturing on MS culture medium containing carbenicillin 500mg/L and kanamycin 50mg/L, culturing for 8-14d when the differentiated bud on callus grows to 2-4cm high and the culture condition is the same as that of differentiated culture; rooting culture of regenerated plant, cutting off differentiated bud, inserting into MS culture medium containing carbenicillin 500mg/L and kanamycin 50mg/L for rooting culture under the condition of the same differentiation culture condition for 7-10 days,obtaining a regeneration plant of the gene NtPOD7 mediated and transformed by the LBA4404 agrobacterium, then sampling the leaves of the transformed plant, carrying out molecular detection on the gene NtPOD7, and determining to obtain the plant edited by the gene NtPOD 7.

Example 3

The molecular detection in example 2 is used to determine that the plant is an NtPOD7 gene knockout plant, and the plant is harvested to obtain a gene editing material. Then, carrying out stress resistance treatment on the seeds, selecting NtPOD7 gene editing tobacco seeds and control (untransformed) seeds, selecting full seeds without obvious defects for surface disinfection, and then respectively dibbling the seeds in an MS culture medium for culture; the culture conditions were: the culture temperature is 25 +/-1 ℃, and the illumination intensity is 30-50 mu mol/(m)²S), the culture was carried out in a horizontal state under the condition of an illumination time of 16h/d, and observation was carried out.

Preparation of salt stress (100mmol/L, 150mmol/L, 200mmol/L NaCl) and drought stress (5%, 7%, 10% PEG6000) treatment medium and MS medium.

When the tobacco seeds grow for about 3-4 days, selecting seeds (10-20 seeds) at the same period when the seeds are exposed to white, and carefully transferring the seeds to a salt stress (100mmol/L, 150mmol/L and 200mmol/L NaCl) and drought stress (5%, 7% and 10% PEG6000) treatment culture medium and an MS culture medium in the step (2); the culture conditions were: the culture temperature is 25 +/-1 ℃, and the illumination intensity is 30-50 mu mol/(m)²S) and culturing for 12-25d under the condition of 16h/d of illumination time, vertically placing for culturing, and observing. The MS culture medium is placed to expose white so as to prevent the inconsistent germination time due to different seed vitality. The seedlings are vertically placed and cultured, and the seedlings are vertically downward, so that the root length can be measured conveniently.

Observing and recording the root length, the state of the root, the leaf size, the leaf color and the like, and preliminarily determining the stress resistance of the tobacco seeds in the germination period.

Seeds of materials including (control) and gene editing were treated in the same dish (results are shown in FIG. 1); .

Example 4

In order to detect the expression condition of the tobacco peroxidase NtPOD7 gene under different stress treatments, the expression quantity of the gene in leaves is detected by a real-time fluorescent quantitative PCR method. SYBR Premix Ex Taq TM II from TaKaRa was used as a real-time fluorescent quantitative PCR reagent. The specific detection method comprises the following steps:

selecting 8-week-old tobacco plants, and adopting leaves of NtPOD7 gene editing plants and control (untransformed) plants under control (untreated) conditions; selecting 8-week-old tobacco plants, and sampling leaves of drought-treated 10-15d NtPOD7 gene editing plants and control (untransformed) plants; selecting 8-week-old tobacco plants, and sampling leaves of NtPOD7 gene editing plants treated by 300mM NaCl for 10-15d and control (untransformed) plants; and then the label is placed in liquid nitrogen for storage, so that subsequent RNA extraction and real-time fluorescence quantitative PCR detection test can be conveniently carried out.

Ntpoc 7 qPCR amplification primers were as follows:

qPCR-Nt NtPOD7-F1：CTGGAGCTCACACCATTGGA(SEQ ID NO.6)

qPCR-Nt NtPOD7-R1：TGCCAAGTTGTTGTCCCCTG(SEQ ID NO.7)

the primers for amplifying the internal reference gene (18S) are as follows:

18S-F：CCTACGCTCTGTATACATTAGC(SEQ ID NO.8)

18S-R：GTGTTGAGTCAAATTAAGCCGC(SEQ ID NO.9)

three technical replicates were performed for each sample, and the reaction system was as follows:

amplification conditions: 30s at 95 ℃; at 95 ℃ for 10s and at 60 ℃ for 10s, for 40 cycles.

Dissolution curve: 95 ℃ for 10s, 60 ℃ for 60s, 95-0.29 ℃/s.

The results show that the tobacco peroxidase-related gene NtPOD7 is expressed in tobacco leaves under the conditions of control, drought stress and salt stress (the results are shown in figure 2).

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> tobacco industry Limited liability company in Yunnan

<120> tobacco peroxidase-related gene NtPOD7

<130> WPM210174

<141> 2021-03-22

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 960

<212> DNA

<213> Artificial sequence (NtPOD7)

<400> 1

atggcttctt ttaagactgc catagttttg tttttcctag tgagcttaac tggaagctcc 60

tcagctcaac taaccactgg cttttattca aaatcatgtc ctaagctcta tgaaactgtg 120

aaatcagtag tgcattctgc cgttcagaag gaaacccgta tgggtgcttc cctccttcgc 180

ctattcttcc acgattgctt cgtcaatgga tgcgatggat cattattcct agatgataca 240

tcaaccttca caggggaaaa aagggcacaa ccaaatttca attccgccag aggatttgaa 300

gttattgacg atatcaaatc tgccgttgaa aaagtgtgcc ctggggtcgt ctcttgcgct 360

gatattttgg ccgttactgc tcgagactct gttgtcattc ttggagggcc taattgggat 420

gtaaaactag gaagaagaga tgccagaaca gcaagccaag ctgctgcaaa tagtagcatt 480

cctcccccga cttcaaacct taaccgtctc atctctagct tcactgctgt tggcctttcc 540

accaaggata tggttgcctt atctggagct cacaccattg gacaagcaag gtgcacaagt 600

ttcagggcac gcatatacaa cgagaccaat aacttggatt catcactagc aaaaaccagg 660

caaaacaact gcccaagaaa ctcaggttca ggggacaaca acttggcacc tcttgatctt 720

cagactccta catatttcga caaccattat ttcattaacc ttgtaagcaa aaagggtcta 780

ctccactctg atcagcagct cttcaacggc ggatccgccg attcaattgt gaaatcatac 840

agcgacaacc ccagcagttt cgccactgat tttgtgactg ccatgattaa gatgggtgac 900

aaccgtcccc ttactggatc taaaggagag atcaggaaga attgcaggag gatcaactaa 960

<210> 2

<211> 319

<212> PRT

<213> Artificial sequence (NtPOD7)

<400> 2

Met Ala Ser Phe Lys Thr Ala Ile Val Leu Phe Phe Leu Val Ser Leu

1 5 10 15

Thr Gly Ser Ser Ser Ala Gln Leu Thr Thr Gly Phe Tyr Ser Lys Ser

20 25 30

Cys Pro Lys Leu Tyr Glu Thr Val Lys Ser Val Val His Ser Ala Val

35 40 45

Gln Lys Glu Thr Arg Met Gly Ala Ser Leu Leu Arg Leu Phe Phe His

50 55 60

Asp Cys Phe Val Asn Gly Cys Asp Gly Ser Leu Phe Leu Asp Asp Thr

65 70 75 80

Ser Thr Phe Thr Gly Glu Lys Arg Ala Gln Pro Asn Phe Asn Ser Ala

85 90 95

Arg Gly Phe Glu Val Ile Asp Asp Ile Lys Ser Ala Val Glu Lys Val

100 105 110

Cys Pro Gly Val Val Ser Cys Ala Asp Ile Leu Ala Val Thr Ala Arg

115 120 125

Asp Ser Val Val Ile Leu Gly Gly Pro Asn Trp Asp Val Lys Leu Gly

130 135 140

Arg Arg Asp Ala Arg Thr Ala Ser Gln Ala Ala Ala Asn Ser Ser Ile

145 150 155 160

Pro Pro Pro Thr Ser Asn Leu Asn Arg Leu Ile Ser Ser Phe Thr Ala

165 170 175

Val Gly Leu Ser Thr Lys Asp Met Val Ala Leu Ser Gly Ala His Thr

180 185 190

Ile Gly Gln Ala Arg Cys Thr Ser Phe Arg Ala Arg Ile Tyr Asn Glu

195 200 205

Thr Asn Asn Leu Asp Ser Ser Leu Ala Lys Thr Arg Gln Asn Asn Cys

210 215 220

Pro Arg Asn Ser Gly Ser Gly Asp Asn Asn Leu Ala Pro Leu Asp Leu

225 230 235 240

Gln Thr Pro Thr Tyr Phe Asp Asn His Tyr Phe Ile Asn Leu Val Ser

245 250 255

Lys Lys Gly Leu Leu His Ser Asp Gln Gln Leu Phe Asn Gly Gly Ser

260 265 270

Ala Asp Ser Ile Val Lys Ser Tyr Ser Asp Asn Pro Ser Ser Phe Ala

275 280 285

Thr Asp Phe Val Thr Ala Met Ile Lys Met Gly Asp Asn Arg Pro Leu

290 295 300

Thr Gly Ser Lys Gly Glu Ile Arg Lys Asn Cys Arg Arg Ile Asn

305 310 315

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (NtPOD7)

<400> 3

cccttcaaag taatatattt ct 22

<210> 4

<211> 26

<212> DNA

<213> Artificial sequence (NtPOD7)

<400> 4

ttagttgatc ctcctgcaat tcttcc 26

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (NtPOD7)

<400> 5

tcctcagctc aactaaccac tgg 23

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (NtPOD7)

<400> 6

ctggagctca caccattgga 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (NtPOD7)

<400> 7

tgccaagttg ttgtcccctg 20

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (NtPOD7)

<400> 8

cctacgctct gtatacatta gc 22

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence (NtPOD7)

<400> 9

gtgttgagtc aaattaagcc gc 22

Claims

1. A gene related to tobacco peroxidase is characterized in that a nucleotide sequence is shown as SEQ ID NO. 1.

2. The tobacco peroxidase-associated gene of claim 1, wherein the tobacco peroxidase-associated gene encodes a protein.

3. The tobacco peroxidase-associated gene of claim 2, wherein the amino acid sequence of the encoded protein is set forth in SEQ ID No. 2.

4. The application of any one of the genes related to the tobacco peroxidase is characterized in that the genes are used for editing the tobacco peroxidase genes to obtain plants with resistance to drought stress and salt stress.

5. The application of the tobacco peroxidase-related gene as claimed in claim 4, wherein the gene editing is achieved by CRI SPR/Cas 9-mediated gene editing technology, a CRI SPR/Cas9 editing vector for knocking NtPOD7 gene out is constructed, and a tobacco plant with the edited NtPOD7 gene is obtained after genetic transformation.

6. The use of a tobacco peroxidase-related gene according to claim 4, wherein it is found by real-time fluorescent quantitative PCR that, under normal conditions, the expression level of the NtPOD7 gene of the obtained gene-edited plant is not significantly different from that of a control plant; however, under the conditions of drought stress and salt stress, the expression level of the NtPOD7 gene of the gene editing plant is obviously lower than that of the control plant.