CN114672498B

CN114672498B - Dragonfly pineapple AfCAL gene, cloning method, expression vector and application

Info

Publication number: CN114672498B
Application number: CN202210545765.8A
Authority: CN
Inventors: 徐立; 荆永琳; 王小冰; 李志英; 杨庆全
Original assignee: Tropical Crops Genetic Resources Institute CATAS
Current assignee: Tropical Crops Genetic Resources Institute CATAS
Priority date: 2022-05-19
Filing date: 2022-05-19
Publication date: 2023-12-29
Anticipated expiration: 2042-05-19
Also published as: CN114672498A

Abstract

The invention discloses a dragonfly pineapple AfCAL gene, a cloning method, an expression vector and application thereof, wherein the dragonfly pineapple total RNA is extracted, cDNA is synthesized by reverse transcription, a specific primer is designed by taking the total RNA as a template, the full-length cDNA of the AfCAL gene is obtained by utilizing a PCR method, and the total cDNA is obtained by using the PCR method

Description

Dragonfly pineapple AfCAL gene, cloning method, expression vector and application

Technical Field

The invention belongs to the technical field of biology, and relates to pineapple CAL genes, cloning, expression characteristic analysis, expression vector construction and a regulation and control effect on blooming.

Background

The pineapple family plants are perennial monocotyledonous She Caoben plants, including important tropical flowers (ornamental pineapple) and important tropical fruits (pineapple). Pineapple flowering time, flowering period length, flower morphology build-up can affect the time to market, period to market, fruit quality, etc. In recent years, more and more genes involved in the pineapple flowering pathway have been isolated and identified, but the CAL gene has been less studied in the pineapple inflorescence development and flowering mechanism.

CAL (CAULIFLOWER) is a gene for controlling the development of flower meristem and regulating the development of flowers, belongs to MADS-box transcription factor coding genes, and in Arabidopsis, AP1 (APETALA 1) and CAL double mutation can ensure that the flower meristem maintains infinite meristem characteristics and can form a flower ball phenotype similar to that of cauliflower. Whereas single mutation of the BobCAL gene in cauliflower can form a flower ball. Although the CAL gene and the AP1 gene are similar in sequence and structure, the difference between the MADS structural domain and the K structural domain has interaction influence on the formation of flower organ primordia, flower meristem, petals, sepal primordia and the like, and certain difference still exists in functions. MADS-box transcription factors often form homologous or heterologous complexes with multiple proteins to perform specific functions, and differences in CAL and AP1 functions are likely to be differences in their interacting factors. There have been studies to screen the respective interaction factors of CAL and AP1 in arabidopsis, and both do exist in each specific interaction protein, and also in the presence of a common interaction factor.

The fragment of CAL gene is obtained by dragonfly pineapple (aechmanea fasciata) comparative transcriptome information analysis, and BLAST comparison shows that the fragment has higher homology with the CAL genes in other plants, and is named as AfCAL. The real-time fluorescent quantitative PCR result shows that the expression quantity of the AfCAL gene in each organ of dragonfly pineapple has obvious difference. The full-length sequence of the gene is cloned by PCR and an expression vector is constructed, and after the gene is overexpressed in the arabidopsis, the flowering of the arabidopsis is promoted. The dragonfly pineapple AfCAL gene has the function of regulating and controlling plant flowering.

Disclosure of Invention

The invention aims to provide a dragonfly pineapple AfCAL gene, which is prepared by extracting total RNA of dragonfly pineapple, synthesizing cDNA by reverse transcription, taking the total RNA as a template, designing specific primers, obtaining full-length cDNA of the AfCAL gene by a PCR method, andand (3) connecting a blast vector, transforming escherichia coli Trans-T1 competent cells, and selecting positive clones to obtain a dragonfly pineapple AfCAL gene, wherein the total length of cDNA of the gene is 1315bp. The acquisition of the AfCAL gene lays a foundation for researching the flowering mechanism of dragonfly pineapple, provides theoretical reference for improving the flower forcing technology in pineapple plant cultivation, and has important theoretical and practical significance.

In order to achieve the above purpose, the technical scheme of the invention is as follows: provides a dragonfly pineapple AfCAL gene, and the gene sequence has a nucleotide sequence shown in SEQ ID NO.1 in a sequence table.

Another object of the present invention is to provide a method for cloning dragonfly pineapple AfCAL gene, comprising the steps of:

(1) Taking dragonfly pineapple (Aechemia fasciata) as a material, and extracting total RNA by using a CTAB method;

(2) Cloning of an AfCAL gene;

(2-1) use of TransThe Uni One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgene) kit reverse transcribes RNA into cDNA as a PCR template for use;

(2-2) designing full-length cDNA amplification primers;

full-length cloning primer of AfCAL gene cDNA

(2-3) after optimizing PCR conditions based on the Tm value of the primer, PCR amplification is performed, and the obtained product is ligated toThe vector of the blast is transformed into competent Trans-T1 of the escherichia coli, and the sequencing is carried out after PCR and enzyme digestion identification.

The PCR system and the conditions are as follows:

the full-length cDNA was obtained as 1315bp, including a portion of the 5'UTR before the start codon and the 3' UTR after the stop codon. The open reading frame part is 759bp, thus the protein containing 253 amino acid residues is deduced to be encoded, and the amino acid sequence is subjected to conserved domain analysis in an international gene library and has a conserved functional domain of MADS family.

Further, the total RNA extraction in the step (1) is specifically as follows:

(1-1) preparation: putting the mortar into a baking oven in advance, baking for 4 hours at 180 ℃, cooling to room temperature for standby, wiping a pipetting gun and a laboratory table which are required to be used in the experimental process by alcohol, and removing RNase from a centrifuge tube and a gun head.

(1-2) into a 2ml centrifuge tube, 850. Mu.l CTAB buffer was placed in a 65℃water bath for preheating.

(1-3) weighing 0.2g of the material, fully grinding the material in a mortar added with liquid nitrogen, transferring the material into a preheated centrifuge tube in (1-2) after the material is in a powder state, and adding 25 mu l of beta-mercaptoethanol before adding the material.

(1-4) immediately vortex for 30s and mix well, water bath at 65 ℃ for 6min.

(1-5) adding equal volume of chloroform and isoamyl alcohol (24:1), shaking vigorously, uncovering and deflating, swirling for 30s, and centrifuging at 11000rpm for 15min at room temperature.

(1-6) the supernatant was pipetted into a fresh 2ml centrifuge tube, and an equal volume of chloroform/isoamyl alcohol (24:1) was added for another extraction, vortexed for 30s, and centrifuged at 11000rpm for 15min at room temperature.

(1-7) the supernatant was pipetted into a fresh 1.5ml centrifuge tube, 1/3 of 8mol/l LiCl was added, mixed upside down and precipitated at 4℃for 10-12h, not more than 16h.

(1-8) centrifugation at 11000rpm for 30min at 4℃and discarding the supernatant, washing the pellet twice with 500. Mu.l of 75% ethanol, discarding the liquid and air drying.

(1-9) 30-40. Mu.l RNase-free water was added to dissolve the precipitate.

(1-10) taking 2. Mu.l of RNA sample, detecting by 1.2% agarose gel electrophoresis, taking 2. Mu.l of RNA sample, measuring the concentration and purity of the sample by using a SimpliNano micro-spectrophotometer, and preserving the residual RNA sample at-80 ℃ for later use, wherein the preservation time is not longer than one week.

Further, the amplification primers in the step (2-2) comprise the sequences of AfCAL-F and AfCAL-R, and the sequences are respectively shown as SEQ ID NO.2 and SEQ ID NO.3 in the sequence table.

Another object of the present invention is to provide a dragonfly pineapple AfCAL gene expression vector, which uses the dragonfly pineapple AfCAL gene as a target gene.

Further, a dragonfly pineapple AfCAL gene is inserted into a plant expression vector CaMV35S-gfp to construct a high-efficiency expression vector containing the dragonfly pineapple AfCAL gene at the downstream of the CaMV35S promoter.

Construction of dragonfly pineapple AfCAL gene expression vector, specifically as follows:

according to the sequenced AfCAL gene sequence, an upstream primer P1 (the sequence is shown as SEQ ID NO.4 in a sequence table: 5'-CGGGGGACGAGCTCGGTACCCCACCTCGTCGCATTTCCAA-3') with a 15bp homologous recombination joint containing KpnI enzyme cutting site and a downstream primer P2 (the sequence is shown as SEQ ID NO.5 in the sequence table: 5'-ACCATGGTGTCGACTCTAGAGGTTCTCAATCTATCCTTTCGCA-3') with a homologous recombination joint containing XbaI enzyme cutting site are designed at the 5' end. The correct bacterial solution is used as a template for the AfCAL gene sequencing verification, the full length is amplified by PCR, and the CaMV35S-gfp vector is linearized by KpnI and XbaI restriction enzymes. Recombinant vectors were constructed using ClonExpressTMII One Step Cloning Kit (Vazyme). And obtaining the AfCAL gene expression vector after bacterial liquid PCR and double enzyme digestion detection verification.

Still another object of the present invention is to provide the application of dragonfly pineapple AfCAL gene in the technology of controlling plant flowering in response to ethylene.

Dragonfly pineapple AfCAL gene expression characteristics:

the expression level of the AfCAL gene in different organs is measured by using real-time fluorescence quantitative PCR, and the result shows that the expression level of the AfCAL in dragonfly pineapple flowers is higher and the expression level in roots is lower. This suggests that the AfCAL gene is involved in the plant flower organ growth and development process.

Functional identification of dragonfly pineapple AfCAL gene:

arabidopsis thaliana was transformed using Agrobacterium-mediated methods. Taking Arabidopsis thaliana Columbia (ecotype columbia) Wild Type (WT), infecting with agrobacterium carrying a plant expression vector of an AfCAL gene after flowering, obtaining potential transgenic seeds, then carrying out resistance screening on an MS solid plate medium of 30mg/L hygromycin to obtain T1 generation positive transgenic plants, carrying out resistance screening on an MS solid plate medium of 40mg/L hygromycin after maturation, and obtaining stably inherited T2 generation positive transgenic plants. The AfCAL gene-transferred Arabidopsis plants are found to be earlier than wild type plants.

The invention utilizes real-time fluorescence quantitative PCR to determine the expression level of the AfCAL genes of different organs of dragonfly pineapple, and proves that the expression level in pineapple flowers is obviously higher than that of other organs. Is connected to a plant expression vector CaMV35S-gfp to construct a new plant expression vector which is named CaMV35S-AfCAL. The gene affects flowering in Arabidopsis thaliana. Therefore, the acquisition of the AfCAL gene lays a foundation for researching the flowering mechanism of dragonfly pineapple, and has important theoretical and practical significance.

Detailed Description

A further understanding of the nature and advantages of the present invention may be realized by the following detailed description. The examples provided are merely illustrative of the methods of the present invention and are not intended to limit the remainder of the disclosure in any way whatsoever. The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1: cloning method of dragonfly pineapple gene

1. Extraction of total RNA: improved CTAB process.

(1) Preparation: putting the mortar into a baking oven in advance, baking for 4 hours at 180 ℃, cooling to room temperature for standby, wiping a pipetting gun and a laboratory table which are required to be used in the experimental process by alcohol, and removing RNase from a centrifuge tube and a gun head.

(2) 850 μl of CTAB buffer was placed into a 2ml centrifuge tube and placed into a 65℃water bath for preheating.

(3) 0.2g of the material is weighed and fully ground in a mortar added with liquid nitrogen, and the material can be transferred into the centrifuge tube preheated in the step (2) after being in powder form, and 25 mu l of beta-mercaptoethanol is added before the material is added.

(4) Immediately vortex for 30s and mix evenly, water bath at 65 ℃ for 6min.

(5) Adding equal volume chloroform and isoamyl alcohol (24:1), shaking vigorously, opening cover, deflating, swirling for 30s, and room temperature

(6) Centrifuge at 11000rpm for 15min.

(7) The supernatant was pipetted into a fresh 2ml centrifuge tube, extracted once more with an equal volume of chloroform/isoamyl alcohol (24:1), vortexed for 30s and centrifuged at 11000rpm for 15min at room temperature.

(8) The supernatant was pipetted into a fresh 1.5ml centrifuge tube, 1/3 of 8mol/l LiCl was added, mixed upside down and precipitated at 4℃for 10-12h, not more than 16h.

(9) Centrifugation was performed at 11000rpm for 30min at 4℃and the supernatant was discarded, the pellet was washed twice with 500. Mu.l of 75% ethanol, the liquid was discarded and air-dried.

(10) 30-40. Mu.l RNase-free water was added to dissolve the precipitate.

(11) Taking 2 mu l of RNA sample, detecting by 1.2% agarose gel electrophoresis, taking 2 mu l of RNA sample, measuring the concentration and purity of the sample by a SimpliNano micro-spectrophotometer, and preserving the residual RNA sample at-80 ℃ for later use, wherein the preservation time is not longer than one week.

2. Cloning and sequence analysis of AfCAL Gene

(1) Trans by Transgene IncUni One-Step gDNA Removal and cDNA Synthesis SuperMix Kit reverse transcribes RNA into cDNA as a template for PCR.

(2) Designing a full-length cDNA amplification primer:

(3) After optimizing the PCR conditions based on the Tm values of the primers, PCR amplification is performed according to the method described in the summary of the invention, and the obtained product is ligated to ^- Blunt vector was identified by PCR and cleavage and then sequenced.

(4) Homology search: the isolated sequences were compared to sequences in Genebank using BLAST software.

Example 2: real-time fluorescent quantitative RT-PCR expression detection of dragonfly pineapple AfCAL genes in different pineapple organs:

extracting RNA of roots, stems, leaves and flowers of dragonfly pineapple, reversely transcribing the RNA to synthesize cDNA, designing specific primers according to the qPCR primer design principle, and obtaining the internal reference gene of dragonfly pineapple Afactin. The primer sequences were as follows:

SYBR Green I is used as fluorescent dye, qPCR is used for measuring the relative expression level of AfCAL gene in the exogenous factor treatment process, and 2 is used ^-ΔΔCt Method for calculating AfFT2 geneRelative expression levels in each sample. Reaction in Quantum studio ^TM 3 fluorescent quantitative PCR apparatus (Thermo Fisher Scientific). The reaction was 20. Mu.l (template 2. Mu.l, forward and reverse primer each 0.4. Mu.l, 50X ROX Reference Dye dye 0.4. Mu.l, qPCR Master Mix 10. Mu.l, sterile deionized water was filled to 20. Mu.l). The reaction procedure is: pre-denaturation at 95 ℃ for 30s;95℃10s,60℃30s,40 cycles. Melting curve acquisition uses an instrument default procedure.

Example 3: construction of dragonfly pineapple AfCAL gene plant expression vector CaMV35S-gfp 1, designing a primer according to the nucleotide sequence of the separated dragonfly pineapple AfCAL gene:

forward primer:

5’-CGGGGGACGAGCTCGGTACCCCACCTCGTCGCATTTCCAA-3’

reverse primer:

5’-ACCATGGTGTCGACTCTAGAGGTTCTCAATCTATCCTTTCGCA-3’

the polymerase chain reaction was performed using total RNA reverse transcribed cDNA as a template.

2. Linearizing the CaMV35S-gfp vector by KpnI and XbaI restriction enzymes, purifying and recovering the PCR product, and connecting the PCR product with the linear vector, wherein the operation steps are carried out according to the instructions of a ClonExpressTMII One Step Cloning Kit kit by Vazyme company, and the reaction system is as follows:

after the system is prepared, the components are gently blown up and down for several times by a pipetting gun to be uniformly mixed, so that bubbles are avoided.

Placing on a PCR instrument, and reacting for 30min at 37 ℃. Immediately after the reaction was completed, the reaction tube was cooled on ice for 5min.

3. The ligation product was transformed into E.coli Trans-T1 competent and cultured overnight on LB solid plates containing kanapecillin (100. Mu.g/ml). The monoclonal is picked up and cultured in LB liquid medium for 5-6h. The colonies were identified by PCR and restriction enzyme. The constructed recombinant was named CaMV35S-AfCAL.

Example 4: flowering function identification of AfCAL gene

1. Planting wild type Arabidopsis thaliana

(1) Proper amount of dried wild type seeds of Arabidopsis thaliana are put into a 1.5ml centrifuge tube, 1ml of sterile water is added, and the mixture is put into a refrigerator at 4 ℃ for vernalization for 3 days.

(2) The nutrient soil for planting the arabidopsis is sterilized for 30min at the temperature of 121 ℃ at 98kPa in advance, insect eggs in the nutrient soil are killed, and the nutrient soil is cooled for standby.

(3) And (3) dibbling the vernalized seeds into seedling culture hole trays by using a pipetting gun, wherein each hole is dibbled with 1-2 grains. After sowing, the seeds are covered by a transparent cover matched with the plug in size, so that the environment is kept moist, and seed germination is facilitated. And uncovering after four true leaves grow on the seeds.

(4) Water is typically poured every 2-3 days, waiting for the arabidopsis to be ready for infestation while flowering.

2. Inflorescence infection method for transforming arabidopsis thaliana

(1) 100. Mu.l of the agrobacteria liquid, which has been tested for correctness, are taken and cultured for 2 days in 1ml of LB liquid medium (containing 100. Mu.g/ml Rif and 50. Mu.g/ml Kana), at 28℃in a shaking table at 200 rpm.

(2) Taking 800 mu l of activated bacterial liquid in 200ml of LB liquid medium (containing 100 mu g/ml Rif and 50 mu g/ml Kana), and shaking and culturing in a shaking table at 28 ℃ and 200rpm until the OD600 value is 0.8-1.2.

(3) Pre-cooling by a centrifugal machine, centrifuging 3500g for 10min at 4 ℃, and discarding the supernatant.

(4) Preparing a conversion solution: 5% sucrose and 0.02% Silwet were added to 200ml pure water, and the mixture was stirred and mixed.

(5) The prepared transformation solution is used for resuspending the thalli until the OD600 value is 0.8-1.0.

(6) The arabidopsis thaliana is watered with enough water one day before infection, and the arabidopsis thaliana inflorescences are soaked in a conversion solution for 40s when infection is carried out, and the arabidopsis thaliana inflorescences are transferred to a dark place for 24h in a dark place after the infection is finished.

(7) Arabidopsis thaliana was transferred to light for growth. And 3-5 times of infection. The interval between each infection is 5-6 days. After all infestations are completed, arabidopsis seeds are awaited to be harvested and marked as T0 generation. .

3. Screening of transgenic plants

Taking a proper amount of dried T0 generation arabidopsis seeds, and sterilizing the seeds on an ultra-clean workbench: soaking in 75% ethanol for 4min, centrifuging, and removing ethanol; adding 84 disinfectant, soaking for 6min, centrifuging, and removing disinfectant. The seeds are repeatedly washed with sterile water for 4-5 times until 84 disinfectant is cleaned. After washing, adding sterile water to suspend the seeds. The seeds are sucked by a gun head and sown on MS solid culture medium with hygromycin concentration of 30 mg/L. Vernalizing at 4deg.C in dark for 48 hr, transferring to climate incubator, culturing at 23deg.C under 16 hr light/8 hr dark conditions. After about two weeks, selecting a resistant plant with green leaves and normal root development, transplanting the resistant plant into a culture medium, and continuously culturing. The culture medium fully absorbs water before transplanting, a transparent cover is covered after transplanting, the culture medium is removed for about 3 days, the T2 generation seeds are harvested and marked after the culture medium is managed as above, and the culture medium is continuously screened until homozygous transformed plants are obtained.

4. Molecular characterization of transgenic plants

The total RNA of transgenic, wild-type and empty vector Arabidopsis leaves is extracted and reversely transcribed into cDNA. PCR detection is carried out by using a specific primer AfCAL-F/R by taking cDNA as a template, agarose gel electrophoresis shows that a target gene band is amplified in transgenic Arabidopsis plants, and no band exists in wild Arabidopsis and transgenic carrier Arabidopsis, so that the gene AfCAL is successfully transferred into Arabidopsis.

5. Transgenic phenotype observations

The transgenic arabidopsis is observed at different growth stages, and the arabidopsis transformed with the AfCAL is found to be earlier than the wild type arabidopsis, which shows that the high expression of the AfCAL promotes the flowering of the arabidopsis and accords with theoretical speculation.

The foregoing disclosure is merely illustrative of the preferred embodiments of the present invention and is not intended to limit the scope of the claims herein, as equivalent variations of the claims herein will fall within the scope of the invention.

Sequence list

<110> national academy of Tropical agricultural sciences, tropical crop variety institute

<120> dragonfly pineapple AfCAL gene, cloning method, expression vector and application

<160>5

<170> SIPOSequenceListing 1.0

<210>1

<211>1315

<212>DNA

<213> dragonfly pineapple (Aechmanea fasciata)

<400>1

TCCCACTCCC ACCACCTCGT CGCATTTCCA AATCGAGTTA GGGTTTTCCC TTCCGAGGAA 60

GGAGGAGAGG AATTATATTA TAGGGTTAGG GTTGCGCCAT GGGGAGGGGG CCGGTGCAGT 120

TGAAGAGGAT CGAGAACAAG ATCAATCGCC AGGTCACGTT CTCGAAGCGC CGCAGCGGCT 180

TGCTGAAGAA GGCGCACGAG ATCTCCGTCC TCTGCGACGC CGAGGTCGCG CTCATCGTCT 240

TCTCCACCAA GGGCAAGCTC TACGAGTACT CCACCGACAC CTCTATGGAG AGGATTCTTG 300

ATCGCTACGA GCGCTATGCT TACGCAGAGA AAGCCCTCTC GGAAGGATAT CCCGAATCGC 360

AGGGATGCTG GGGTGAGGAC TATGGGAAGC TAAAGTCGAA AGTCGAATCG TTACAGAAAA 420

AGCAAAGGAA TCTCATGGGC GAACAACTCG ATTCGTTAAC GCTGAAAGAA CTTCAACTAC 480

TGGAGCAACA ACTTGATGCT GCTTTGAGAC ACATAAGATC AAGAAAGAAT CAGCTTCTGT 540

TCGATTCGAT TTCCGAGCTA CAAAAGAAGG AGAAGTCATT GCAGGAGCAA AACAATGCTC 600

TGGAGAAGCT CATGGAGAAA GACGCGGCCG ACACCAACGC TCTGACCCAA CATCTGCAGT 660

GGGAGCAGCA AAATCAGCCG CCGACGAGCT CCTCTTCGCC TCTCCCGTTC GTGTTTACCG 720

ACGCTTTCCC AAATTCGAAC GCCAGCGCAA ATCAACAAAG CGACGACGCA TCTTGCGAGC 780

CCGGATCTGC TGAGCCCCTC ATCCACACGA ACAGCAAAAC CCTCCCTCCA TGGATGCTTC 840

GACTTGCGAA AGGATAGATT GAGAACCTGC TGCTTTCCGA TAAACGCCCT CGGCGACGGT 900

TACGAGTGCG TCGCCGCATC CTCTTCCTCC ATTTCCTTCT CCATCGGCGC CGGCTACTCT 960

TGGCGATAGT AACGAGAACA GCGCCGCCTT CTCTGTCTTT GCCTCCGCCT CTGCCGGTGT 1020

CGGAGAAGGA CAAGAACTCG AAGCAGACCC AGGTGCGGTT GGAGCCAACT GAGGCGATGA 1080

GGTCGTTTCC ATATATGTTT TGGGGCTCCG AGGCAGCGCG CAGGGCAAAA AGGCTCACGG 1140

TGGTGATCGA GGATGAGGTC GGAGGAGAAG AGGAAGGGGT CAAGGGAAAA GAAAGAAGAA 1200

GATGATGATG AGGCGATGAG GATCGGAGAA TAGTATAATT TTCTCTAAAA TAATATAATT 1260

TTCGTCGAAA GAATGCAACT TTTATTTCAA AAAGTGTATT TTTTATCTCA AAGAG 1315

<210>2

<211>20

<212>DNA

<213> Synthesis

<400>2

CCACCTCGTCGCATTTCCAA 20

<210>3

<211>23

<212>DNA

<213> Synthesis

<400>3

GGTTCTCAATCTATCCTTTCGCA 23

<210>4

<211>40

<212>DNA

<213> Synthesis

<400>4

CGGGGGACGAGCTCGGTACCCCACCTCGTCGCATTTCCAA 40

<210>5

<211>43

<212>DNA

<213> Synthesis

<400>5

ACCATGGTGTCGACTCTAGAGGTTCTCAATCTATCCTTTCGCA 43

Claims

1. The application of the dragonfly pineapple AfCAL gene over-expression in the technology of promoting the flowering of arabidopsis is characterized in that the application is specifically the application of the dragonfly pineapple AfCAL gene over-expression alone in the technology of promoting the flowering of arabidopsis; the nucleotide sequence of the dragonfly pineapple AfCAL gene is shown in SEQ ID NO. 1; the cloning method of the dragonfly pineapple AfCAL gene comprises the following steps:

(1) Taking dragonfly pineapple as a material, and extracting total RNA by using a CTAB method;

(2) Cloning of an AfCAL gene;

(2-1) reverse transcription of RNA into cDNA using UniOne-Step gDNA Removal and cDNA Synthesis SuperMix Kit from Transgene, inc., as a PCR template;

(2-2) designing full-length cDNA amplification primers;

(2-3) optimizing PCR conditions based on the Tm value of the primer, performing PCR amplification, and connecting the obtained product to E.coli, and performing sequence determination after PCR and cleavage identification.

2. The use according to claim 1, wherein the step of extracting total RNA in step (1) is specifically as follows:

(1-1) preparation: putting the mortar into a baking oven in advance, baking for 4 hours at 180 ℃, cooling to room temperature for standby, wiping a pipetting gun and a laboratory table which are required to be used in the experimental process by alcohol, and ensuring that no RNase exists in a centrifuge tube and a gun head;

(1-2) taking 850 μl of CTAB buffer into a 2ml centrifuge tube, and placing into a 65 ℃ water bath for preheating;

(1-3) weighing 0.2g of the material, fully grinding the material in a mortar added with liquid nitrogen, transferring the material into a preheated centrifuge tube in (1-2) after the material is in a powder state, and adding 25 mu l of beta-mercaptoethanol before adding the material;

(1-4) immediately swirling for 30s and uniformly mixing, and carrying out water bath at 65 ℃ for 6min;

(1-5) adding equal volume of chloroform/isoamyl alcohol, shaking vigorously, uncovering and deflating, swirling for 30s, and centrifuging for 15min at the room temperature of 11000 rpm;

(1-6) sucking the supernatant into a new 2ml centrifuge tube, adding equal volume of chloroform/isoamyl alcohol for extraction once, swirling for 30s, and centrifuging for 15min at the room temperature of 11000 rpm;

(1-7) sucking the supernatant into a new 1.5ml centrifuge tube, adding 1/3 volume of 8mol/l LiCl, reversing and mixing uniformly, and precipitating for 10-12h at 4 ℃ without exceeding 16h;

(1-8) centrifuging at 11000rpm for 30min at 4deg.C, discarding supernatant, washing the precipitate twice with 500 μl of 75% ethanol, discarding the liquid, and air drying;

(1-9) adding 30-40. Mu.l RNase-free water to dissolve the precipitate;

3. The use according to claim 2, wherein the amplification primers in step (2-2) comprise AfCAL-F and AfCAL-R, the sequences of which are shown in SEQ ID No.2 and SEQ ID No.3, respectively.