CN101284876A - Fusion protein Penharpin, preparation method and use - Google Patents

Abstract

The invention discloses fused protein Penharpin, a method for making the same, a use thereof, a DNA sequence coding the Penharpin, a carrier containing the DNA sequence, a hose cell containing the carrier, a method for making the Penharpin through genetic engineering and medicine combination containing the Penharpin. The Penharpin has the activity of both Pen-2 and exciton Harpin, i.e. the biological activity which can resist microorganism such as bacteria, fungus and virus; meanwhile, the Penharpin has the biological function of inducing tobacco anaphylaxis, and can induce the defensive substances in plant such as peroxidase (POD) and superoxide dismutase (SOD). The Penharpin can be used in the prevention of plant disease due to microbial infection caused by bacteria, fungus and virus and has ideal prevention effect in plant diseases; moreover, the Penharpin can induce and improve the disease-resistant ability of plant so as to promote plant growth and increase crop yield.

Description

Fusion rotein Penharpin and preparation method and purposes

Technical field

The present invention relates to genetic engineering technique, medicine and control of plant disease field, more specifically, the present invention relates to prawn peptide Pen-2 (Penaeidin-2, hereinafter to be referred as Pen-2) with the fusion rotein Penharpin of exciton Harpin, the encode dna sequence dna of this fusion rotein contains the carrier of this dna sequence dna, contains the host cell of this carrier, prepare the method for this fusion rotein Penharpin with genetically engineered, and the pharmaceutical composition that contains this fusion rotein Penharpin.The fusion rotein Penharpin that the present invention relates to has the activity of prawn peptide Pen-2 and exciton Harpin simultaneously.Fusion rotein Penharpin has the biological activity of the microorganisms such as antibacterium, fungi and virus of prawn peptide Pen-2, has the anaphylactoid biological function of exciton Harpin evoking tobacco simultaneously, defensive material in the energy inducing plant.The application of this fusion rotein Penharpin in bacterium, fungi and the virus disease of prevention and treatment plant, and the application in controlling plant diseases, the resistance against diseases that induces and improve plant, promotion plant-growth, raising crop yield.

Background technology

Prawn peptide Penaeidins is the peptide matters of an isolating class biologically active from the acid extract of Penaeus vannamei blood plasma and hemocyte, and molecular size is 5.48-6.62kDa.Penaeidin family is a cationic antibacterial peptide, and the COOH-end contains 6 halfcystines, forms 3 disulfide linkage, NH ₂-end proline rich.Penaeidin precursor N end has the very strong signal peptide of conservative property, obtains mature peptide through processing.The Penaeidin mature peptide has the characteristic of posttranslational modification, and perhaps C holds amidated, and perhaps the N end is by Pyrrolidonecarboxylic acid cyclisation (Destoumieux D, Bulet P, Loew D, et al.1997.C.-J.Kanget al.2007).

Penaeidins is the Ch-penaedin of one group of biologically active, and the present Penaeidins that has separated and identified is respectively Pen-1, Pen-2, Pen-3, Pen-4 and Pen-5 etc.Penaeidin exists in Environment of Litopenaeus vannamei Low and Bai Bin prawn, and they may carry out different biological functions respectively.The transcriptional level of Penaeidin is very high, and prawn can produce a large amount of different Penaeidin.Two structural domains are arranged in the Penaeidin molecule, and one is the N end structure territory of being rich in glycine and proline(Pro), and another is the C end that contains 6 conservative cysteine residues.Two different structural domains that Penaeidin contained are being exercised different functions, play a role jointly, thereby make antibacterial peptide have multi-functional characteristics.Prawn peptide Penaeidin-2 (Pen-2) is the cationic antibacterial peptide that is separated to from the Penaeus vannamei hemolymph.Natural Pen-2 has 50 amino-acid residues, and molecular weight is 5562Da.

Penaeidins has the biological activity of resisting gram-positive bacterium and gram negative bacterium simultaneously.Penaeidins plays a role by multiple antibiotic pattern, and bacterium is played the effect of killing fast, perhaps shows as restraining effect.The antibacterial activity of Penaeidin mainly is at gram-positive microorganism, and species specificity is arranged.Penaeidin can suppress the growth of many bacteriums, and mechanism of action is varied.The slow killing bacteria of the Penaeidin that has, the germicidal action that has is very rapid.

Penaeidins has anti-mycotic activity, embraces son by inhibition and sprouts the effect of killing different strain fungies of playing, and when the concentration of Penaeidins is hanged down, then can suppress fungi growth, and cause its paramophia.Prawn peptide Pen-2 has the activity of antibacterium and fungi simultaneously.Prawn peptide Pen-2 and Pen-3a have anti-microbial activity for many filamentous funguss, and minimal inhibitory concentration (MIC) is lower than 10 μ mol/L.

Antibacterial peptide has advantages such as broad-spectrum bactericidal action, relative molecular weight are less, good water solubility, and antibacterial peptide is to almost not effect of eukaryotic cell, only acts on prokaryotic cell prokaryocyte and the eukaryotic cell of pathology takes place.At present, along with antibiotic remains, the continuous appearance of Resistant strain.Many pathogenic bacterias produce very strong resistance to microbiotic, and antibacterial peptide produces resistance hardly.Antibacterial peptide has the incomparable advantage of many traditional microbiotic, and they have the biologic activity of wide spectrum, and antibacterial ability is strong, sterilization is rapid, and kind is many, and available scope is wide, the target bacterial strain be difficult for to produce resistant mutation, has synergy with typical microbiotic, in the energy and intracellular toxin etc.Simultaneously, antibacterial peptide also is one of the important component of the natural defending system of body opposing exogenous infection, has specificity and security.Therefore, research can progressively substitute antibiotic antibacterial peptide and just seem very important, and antibacterial peptide becomes the important novel antibacterial medicine of a class after traditional microbiotic such as penicillin.In field of medicaments, the existing multiple antibacterial peptide of the Germany and the U.S. is applied to the report of clinical treatment operation back severe fungi infestation and severe symptoms of pneumonia.Antibacterial peptide mainly as preserving agent and sanitas, has been obtained effect preferably in the foods and cosmetics field.Antibacterial peptide will have wide application prospect at aspects such as medicine, makeup, biological pesticide, biology feed additive, antiseptics for natural food, animal and plant disease resisting genetically engineereds.

From the source, exciton (elicitor) can be divided into biological exciton and abiotic exciton two big classes.Biological exciton refers to the material that can inducing plant produces defense response from pathogenic bacteria, nonpathogenic bacteria, host plant and non-host plant.Exciton Harpin is the class protein exciton that Gram-negative (G-) plant pathogenetic bacteria produces.(hypersensitive response HR), is a plant in a kind of endemism (Klement Z et al, 1963) that is subjected to being produced when compatible reaction is not infected, taken place to pathogenetic bacteria to allergic reaction of plant.Anaphylaxis is a kind of protective reaction that plant self has, and is similar to the immune response of the broad-spectrum disease resistance bacterium insect pest that higher animal has.Some polysaccharide that pathogenic bacteria produced, lipopolysaccharides, glycoprotein, lipid acid, protein and the sub-inducing allergic reaction of plant of polypeptide equal excitation.

The gene that participates in anaphylaxis in the germ is called anaphylaxis gene (hypersensitivereaction and pathogenicity; Hrp) (Daniels M J et al, 1993).The general cluster of hrp gene exists, and the hrp gene cluster is made up of a plurality of transcription units usually.Phytopathogen all has the hrp gene cluster, and molecular weight is 2000～4000, comprises 3～13 genes, they both with cause a disease relevant, relevant with the anaphylaxis of inducing the host again (Willis DK, et al, 1991).1992, Wei etc. at first are separated to a kind of about 44kDa, can excite protein exciton Harpin (the hrpN genes encoding of HR from the pathogenetic bacteria (Erwinia amylovora) of fire blight of pear, Harpin Ea commonly used represents), and achievement in research is published in " Science " and goes up (Wei et al., 1992).Each synergistic effect of gene in the hrp gene cluster is equivalent to a regulation and control unit on the function, they are both with pathogenic relevant, relevant with the anaphylaxis of inducing the host again (Ezra D et al, 2000; Leach J E, 1996).In genome, the hrp gene is bunchiness often, forms an operon structure, and the encoding gene that can produce anaphylactoid exciton Harpin is one of them or several (Beer SV, et al, 1991).

Exciton Harpin can induce non-host plant to produce anaphylaxis, itself is again a kind of virulence factor (He SY, 1993) of host.Exciton Harpin by with the receptors bind of plant surface, the defense function of activated plant self, activate in the born of the same parents activity and protein phosphorylation by change of configuration then about enzyme, form the second messenger, signal obtains amplifying, finally excite plant to produce defense response (Liang Yuancun etc., 2001) by adjusting to special gene.The approach of exciton Harpin activated plant defense response mainly contains three kinds: (1) a kind of unknown pathway activation plant antibacterium reaction; (2) antibacterium of salicylate pathway activated plant, fungi, virus reaction; (3) ethene and the antimycotic reaction of jasmonic pathway activation.

Exciton Harpin has the function of regulating ionic channel, causing defense response and necrocytosis.Exciton Harpin can excite oxygen production in cell suspension culture.Proved that active oxygen has the disease-resistant function of three aspects: what (1) transmitted the induced defense reaction makes signal mutually; (2) modify host's cell walls to resist infecting of pathogenic bacteria; (3) directly suppress the intrusion (He SY, 1993) of pathogenic bacteria.

Exciton Harpin can directly apply to control of plant disease (directly spray and use or make up multi-functional biological and ecological methods to prevent plant disease, pests, and erosion microorganism), also can be applied to transgenic plant, produces the disease-resistant characteristic of wide spectrum.Exciton Harpin can be used for preventing and treating the bacterium class disease that Rhodopseudomonas, erwinia, xanthomonas etc. cause; The Mycophyta disease that fusarium, phytophthora etc. cause; Plant virus such as tobacco mosaic virus (TMV) and Tomato mosaic virus class disease.In addition; exciton Harpin can suppress bacterium, virus, fungi, nematode, insect infecting and encroach on plant; it is a kind of novel antibiotic bacteriostat; be widely used in plant protection; particularly monocotyledons and dicotyledons are comprising main farm crop and cash crop, vegetables etc.

Exciton Harpin has the function that promotes g and D, studies show that exciton Harpin can promote seed germination and development of plants, improves output and the quality of crop, increases the plant individuality, is beneficial to precocity and solid (Bonas U et al, 1994 of plant; Laby et al, 1997; Fu Huaxin, 1999; Gao Zhengliang, 1999).

Exciton Harpin also can improve vegetables, the anti-ability of rotting, go mouldy of fruit, prolongs storage time.In addition, exciton Harpin also has certain walking quickly and keeping away and control action kou for farm crop, vegetables pest such as bollworm, beet armyworm, cabbage caterpillar etc.

Itself does not have any fungicidal activity exciton Harpin, and pathogenic is not had direct inhibition or toxic effect, does not have the selective pressure that promotes harmful organism population resistance development.But exciton Harpin can produce a series of resistance reactions by activated plant.Studies show that exciton Harpin is harmless to wildlife (as bird, fish, honeybee, water flea and phycophyta etc.).Therefore, exciton Harpin has free from environmental pollution as antibiotic bacteriostat, and to the person poultry safety, advantage such as do not develop immunity to drugs has application promise in clinical practice on producing.

Summary of the invention

The objective of the invention is to be to provide a kind of have new time prawn peptide Pen-2 and the bioactive fusion rotein Penharpin of exciton Harpin.Fusion rotein Penharpin has the biological activity of the microorganisms such as antibacterium, fungi and virus of prawn peptide Pen-2, has the anaphylactoid biological function of exciton Harpin evoking tobacco simultaneously, defensive material in the energy inducing plant.

Another object of the present invention is the DNA that is to provide encoding said fusion protein Penharpin, contains the carrier of this dna sequence dna, contains the host cell of this carrier.

A further object of the present invention is to be to provide a kind of method for preparing described fusion rotein Penharpin.

Of the present invention aspect first, a kind of fusion rotein Penharpin is provided, and this albumen comprises: the aminoacid sequence of prawn peptide Pen-2, the aminoacid sequence of exciton Harpin and 1-20 amino acid whose connection peptides sequence between the aminoacid sequence of the aminoacid sequence of prawn peptide Pen-2 and exciton Harpin.Preferable, described connection peptides sequence contains 4-15 amino acid.Better, described fusion rotein comprises the aminoacid sequence shown in the SEQ ID No.2.

Aspect second of the present invention, provide a kind of isolated DNA molecule, the fusion rotein Penharpin that this dna molecule encode is above-mentioned.Preferable, described dna molecule encode comprises the fusion rotein of the aminoacid sequence shown in the SEQ IDNo.2.Better, described dna molecular comprises the nucleotide sequence shown in the SEQ IDNo.1.

Aspect the 3rd of the present invention, a kind of carrier is provided, this carrier contains above-mentioned dna molecular.Preferable, described carrier comprises recombinant expression plasmid pET-pen-hrp.

Aspect the 4th of the present invention, a kind of host cell is provided, this host cell contains above-mentioned carrier.Preferable, described host cell comprises recombination engineering strain Escherichia coliOrigamiB (DE3) pLysS (pET-pen-hrp), i.e. E.coli OrigamiB (DE3) pLysS (pET-pen-hrp), CCTCC No:M208071.This bacterial strain contains above-mentioned recombinant expression plasmid pET-pen-hrp.

Aspect the 5th of the present invention, a kind of method that produces above-mentioned fusion rotein Penharpin is provided, this method may further comprise the steps: cultivate above-mentioned host cell, can express under the described fusion rotein Penharpin condition (comprising inducing or non-inductive condition), express above-mentioned fusion rotein Penharpin, then separation, purified fusion protein Penharpin.

Aspect the 6th of the present invention, a kind of pharmaceutical composition is provided, said composition comprises the above-mentioned fusion rotein Penharpin of effective dose, and pharmaceutically acceptable synergistic agent, emulsifying agent, stablizer, adhesive agent, thinner or vehicle or capsule or carrier.

Aspect the 7th of the present invention, provide the application of aforementioned pharmaceutical compositions in prevention or treatment Plant diseases.Described fusion rotein Penharpin or the application of pharmaceutical composition in controlling plant diseases.

The invention still further relates to the application of fusion rotein Penharpin in the medicine of preparation treatment or prevention bacterial-infection resisting.

The invention still further relates to the application of fusion rotein Penharpin in the medicine of preparation treatment or prevention anti-fungal infection.

The invention still further relates to the application of fusion rotein Penharpin in the medicine of preparation treatment or prevention anti-virus infection.

The present invention is with prawn peptide Pen-2 gene and exciton Harpin gene fusion, reconstruct, expression, produce the fusion rotein Penharpin of prawn peptide Pen-2 and exciton Harpin, this fusion rotein Penharpin has the activity of prawn peptide Pen-2 and exciton Harpin simultaneously.Fusion rotein Penharpin has the biological activity of the microorganisms such as antibacterium, fungi and virus of prawn peptide Pen-2, has the anaphylactoid biological function of exciton Harpin evoking tobacco simultaneously, defensive material in the energy inducing plant.Fusion rotein Penharpin becomes a kind of novel medicament, is applied to prevent and treat bacterium, fungi and the virus disease of plant, plays a role in controlling plant diseases, the resistance against diseases that induces and improve plant, promotion plant-growth, raising crop yield.

Definition

As used herein, term " fusion rotein of prawn peptide Pen-2 and exciton Harpin ", " prawn peptide Pen-2-exciton Harpin fusion rotein ", " the fusion rotein Penharpin of prawn peptide Pen-2 and exciton Harpin ", " Pen-2-Harpin fusion rotein ", " fusion rotein Penharpin ", " Penharpin fusion rotein " etc. are used interchangeably, and all refer to the albumen with prawn peptide Pen-2 aminoacid sequence and exciton Harpin aminoacid sequence merge, reconstruct forms.Wherein, can there be or do not have the connection peptides sequence between two aminoacid sequences.

As used herein, " prawn peptide Pen-2 aminoacid sequence " refers to a part of aminoacid sequence in described fusion rotein among the term fusion rotein Penharpin.This sequence has substantially the same aminoacid sequence with prawn peptide Pen-2 natural or variation, and has the substantially the same biological activity with natural prawn peptide Pen-2.Preferred prawn peptide Pen-2 aminoacid sequence is natural prawn peptide Pen-2 aminoacid sequence.

As used herein, " exciton Harpin aminoacid sequence " refers to a part of aminoacid sequence in described fusion rotein Penharpin in the term fusion rotein.This sequence has substantially the same aminoacid sequence with exciton Harpin natural or variation, and has the biological activity substantially the same with exciton Harpin.Preferred exciton Harpin aminoacid sequence is natural exciton Harpin aminoacid sequence.

As used herein, term " connection peptides " refers between prawn peptide Pen-2 aminoacid sequence and exciton Harpin aminoacid sequence, the small peptide of performance ligation.The length of connection peptides is 1-20 amino acid, and preferable is 4-15 amino acid.The technician can be according to the ordinary method design connection peptides of this area.

As used herein, term " fusion gene of prawn peptide Pen-2 and exciton Harpin ",, " pen-hrp fusion gene ", " pen-hrp " etc. are used interchangeably, all refer to prawn peptide Pen-2 gene pen and exciton Harpin gene hrp merges, reconstruct forms fusion gene.Wherein, can there be or do not have the connection peptides dna sequence dna between two gene orders.

As used herein, the dna sequence dna of encoding fusion protein Penharpin, whole synthetic, also available pcr amplification or synthetic method obtain respectively the to encode dna sequence dna of prawn peptide Pen-2 and exciton Harpin, it splices then, constitutes the dna sequence dna of fusion rotein Penharpin of the present invention.This sequence is connected with suitable expression vector, changes proper host cell then over to.Cultivate above-mentioned host cell,, express above-mentioned fusion rotein Penharpin, then separation, this fusion rotein of purifying Penharpin expressing under the described fusion rotein Penharpin condition (comprising inducing or non-inductive condition).

As used herein, term " carrier " comprises cloning vector, expression vector, virus vector, plasmid and clay etc.In the present invention, can select various carrier known in the art for use, as prokaryotic system expression vector and eukaryotic system expression vector etc.The nucleotide sequence of code book being invented new fusion rotein Penharpin inserts in the above-mentioned carrier expressed fusion protein Penharpin.

Among the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic cell prokaryocyte comprises intestinal bacteria and Bacillus subtilus etc.Eukaryotic cell comprises yeast cell, mammalian cell and insect cell etc.Preferable, this host cell is intestinal bacteria.

Among the present invention, the host cell that contains above-mentioned carrier can be expressed above-mentioned fusion rotein Penharpin through cultivating under appropriate condition, then separation, purified fusion protein Penharpin.

Escherichia expression system has the following advantages: (1) protein expression amount height.The highest 30-50% that can reach the tropina total amount of the expression amount of engineered protein.(2) can express the fusion rotein that the N end contains 6 continuous Histidines, these 6 successive Histidines help proteinic separation and purifying.Histidine is a rare amino acid in general albumen, introduces 6 Histidines of successive and has very high specificity.6 Histidine tails and metal ion have very strong binding ability, and very little to the influence of the 26S Proteasome Structure and Function of target protein, and biologic activity can be kept usually, without removing the directly proteic biologic activity of research purpose of 6 Histidine tails.(3) escherichia expression system is a kind of safe expression system, has successfully adopted escherichia expression system to express multiple medical protein at present, and safety non-toxic is nontoxic to people and animals and environment.(4) be beneficial to industrialization production.In all gene engineering expression systems, colibacillary production cost is minimum, and the fermentation equipment and the production method of moulding have been arranged, and helps realizing industrialization production.

In one embodiment of the invention, the pen-hrp fusion gene cloning is gone into prokaryotic expression carrier pET-32a (+), transformed into escherichia coli Escherichia coli OrigamiB (DE3) pLysS, prepare a kind of recombination engineering strain Escherichia coli OrigamiB (DE3) pLysS (pET-pen-hrp), be E.coli OrigamiB (DE3) pLysS (pET-pen-hrp), CCTCC No:M208071.PET-32a (+) carrier is the very high carrier of a kind of expression amount, cultivate E.coli OrigamiB (DE3) pLysS (pET-pen-hrp), expressing under the described fusion rotein Penharpin condition (comprising inducing or non-inductive condition), expressed fusion protein Penharpin, separation, purified fusion protein Penharpin then.Fusion rotein Penharpin accounts for more than 28% of tropina total amount, and the fusion rotein Penharpin of expression mainly forms soluble proteins.

Penharpin fusion rotein of the present invention has the biological activity of prawn peptide Pen-2 and exciton Harpin.In an embodiment, the Penharpin fusion rotein all has in various degree antibacterial activity to gram positive bacterium and gram negative bacterium, and various bacteria is all had certain inhibitory or killing effect.The Penharpin fusion rotein has tangible anti-microbial activity to aspergillus niger.The Penharpin fusion rotein can prevent tobacco mosaic virus (TMV) (TMV) to the infecting of tobacco, and the Penharpin fusion rotein that prevention tobacco mosaic virus (TMV) (TMV) is infected the effect of tobacco is good than exciton Harpin.In addition, the Penharpin fusion rotein has certain result of treatment to the infection of TMV, and disease index contrast reduces.The Penharpin fusion rotein can cause the anaphylaxis of tobacco, and Penharpin fusion rotein and exciton harpin sample are compared, and the anaphylaxis that Penharpin fusion rotein treatment group is caused is strong than the level of response of exciton Harpin treatment group.The Penharpin fusion rotein can also the evoking tobacco blade in defensive material peroxidase (POD) and superoxide-dismutase (SOD).

In another aspect of this invention, provide a kind of pharmaceutical composition.Pharmaceutical composition of the present invention comprises the Penharpin fusion rotein of effective dose, and pharmaceutically acceptable synergistic agent, emulsifying agent, stablizer, adhesive agent, thinner or vehicle or capsule or carrier.

Vehicle can be divided into 8 classes: (1) weighting agent, and as the mineral oil (whiteruss) of plant amylum, lactose, calcium salt, sodium bicarbonate, Citric Acid, dextran, sucrose, alcohol, glycerine, Sorbitol Powder, Xylitol, water and topical preparation, Vaseline, paraffin, lanolin, beeswax, bentonite, neusilin etc.(2) coating-forming agent is as gelatin, polymkeric substance, lac, gluten, rubber cement etc.; (3) sweeting agent,, cyclohexylenedinitrilotetraacetic acid sulfamate sweet etc. as sucrose, lactose, dextran, fructose, maize treacle, A Siba; (4) seasonings, as the natural perfume that extracts from apple, cherry, cocoa, oranges and tangerines, the Sudan cocoa, ginger, Radix Glycyrrhizae, peppermint etc., and the source is by materials such as generally regarded as safe artificial flavors.(5) tinting material/dyestuff is as azo and monoazo-dyes, quinoline dye, triphenylmethane dye, xanthine dyestuff etc.(6) buffer reagent is as phosphoric acid salt, borate, acetate etc. and some suspendibles, emulsification and hardening compound; (7) sanitas is as Sorbic Acid, Thiomersalate, phenylcarbinol etc.; (8) propelling agent is as pressurized gas, fluorocarbon etc.

Therefore, composition can be tablet, capsule, granule, solution, suspensoid, emulsion, gelifying agent, nanometer formulation etc.

Composition can be made into unit or polynary formulation, and various formulations comprise in order to produce the predetermined amount activeconstituents of desired control of plant disease effect---Penharpin fusion rotein, and proper drug thinner or vehicle or capsule etc.

This pharmaceutical composition can adopt effective dose to carry out dispenser according to the Plant diseases particular case in control of plant disease, and this can be determined by the biological control personnel.In addition, Penharpin fusion rotein of the present invention and pharmaceutical composition can with other medicines (as ZhiBingLing(SIC), derosal) coupling, be applied to the control of Plant diseases.

In order to achieve the above object, the present invention adopts following technical measures:

In one embodiment of the invention, provide a kind of preparation method of dna segment, this fragment comprises the nucleotide sequence of described coding Penharpin fusion rotein.

In one embodiment of the invention, the aminoacid sequence that has of Penharpin fusion rotein of the present invention is the aminoacid sequence shown in the SEQ ID No.2.

In one embodiment of the invention, provide a kind of nucleotides sequence of the Penharpin of coding fusion rotein to classify the nucleotide sequence shown in the SEQ ID No.1 as.

In one embodiment of the invention, provide a kind of Penharpin fusion rotein, this albumen is genetic engineering fusion protein, and the amino acid of its N is that carrier is coded, and the N terminal amino acid is:

MSDKIIHLTD?DSFDTDVLKA?DGAILVDFWA?EWCGPCKMIA?PILDEIADEY?QGKLTVAKLN 60

IDQNPGTAPK?YGIRGIPTLL?LFKNGEVAAT?KVGALSKGQL?KEFLDANLAG?SGSGHMHHHH 120

HHSSGLVPRG?SGMKETAAAK?FERQHMDSPD?LGTDDDDKAM?ADIGSEF 167

In one embodiment of the invention, used pET-32a (+) plasmid is a Novagen company product, also have His.Tag, S.Tag and enteropeptidase and zymoplasm restriction enzyme site in pET-32a (+) plasmid multiple clone site upstream, express the Penharpin fusion rotein, the about 65kDa of its molecular mass.

In one embodiment of the invention, a kind of host cell---intestinal bacteria are provided, this host cell comprises the nucleotide sequence of the Penharpin fusion rotein of the present invention of encoding, and perhaps comprises the dna segment of the Penharpin fusion rotein of the present invention of encoding.

In one embodiment of the invention, a kind of intestinal bacteria recombination engineering strain is provided, this strain classification called after Escherichia coli OrigamiB (DE3) pLysS (pET-pen-hrp), be E.coli OrigamiB (DE3) pLysS (pET-pen-hrp), depositary institution: Chinese typical culture collection center, preservation address: China. Wuhan. Wuhan University, preservation date: on May 13rd, 2008, deposit number: CCTCC No:M208071, this host cell comprises the nucleotide sequence of Penharpin fusion rotein of the present invention.

The construction process of a kind of intestinal bacteria recombination engineering strain E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) is provided in one embodiment of the invention.The steps include: the amplification of (1) Penaeus vannamei Pen-2 gene pen

Upstream primer PEN1:(SEQ ID No.3)

5 ' GT GAATTCTACAGGGGCGGTTACACA3 ' (the underscore place is EcoR I site).

Downstream primer PEN2:(SEQ ID No.4)

5 ' GG TCTAGAAGAACCGCCAGATCCAGAGCCACCTCCTTTTACTAAGTGA3 ' (the underscore place is Xba I site).

The plasmid pGEM-T/Pen that contains Pen-2 gene pen is a template, utilizes the amplification of PCR instrument, obtains the 230bp goal gene.

(2) structure of recombinant plasmid pGEM-T-pen and evaluation

Reclaim the PCR product, the PCR product is connected on the pGEM-T carrier (purchasing the company in Promega), Transformed E .coli JM109 (purchasing company) competent cell in Promega, coat and contain 5-bromo-4 chloro-3 indoles-D-galactoside (X-gal, Promega company product), isopropylthiogalactoside (IPTG, Promega company product) and carry out the screening of blue hickie on the LB flat board of 100 μ g/mL penbritins (Amp), identify dna sequencing Analysis and Identification recombinant plasmid pGEM-T-pen with PCR and digestion with restriction enzyme.

(3) amplification of exciton Harpin gene hrp

Upstream primer HRP1:(SEQ ID No.5)

5 ' GG TCTAGAGGTGGCTCTGGATCTATGCGGGGTTCTCATCATCA 3 ' (the underscore place is Xba I site).

Downstream primer HRP2:(SEQ ID No.6)

5 ' GG CTGCAGAAGCTTTCAGGCCACAGCCTGGTTAGTCTG 3 ' (the underscore place is HindIII and PstI site).

The plasmid pGEM-T-hrp that contains Harpin gene hrp is a template, utilizes the amplification of PCR instrument, obtains the 1281bp goal gene.

(4) structure of recombinant plasmid pGEM-T-hrp and evaluation

Reclaim the PCR product, the PCR product is connected on the pGEM-T carrier, Transformed E .coli JM109 competent cell, coat and contain 5-bromo-4 chloro-3 indoles-D-galactoside (X-gal, Promega company product), isopropylthiogalactoside (IPTG, Promega company product) and carry out the screening of blue hickie on the LB flat board of 100 μ g/mL penbritins (Amp), identify dna sequencing Analysis and Identification recombinant plasmid pGEM-T-hrp with PCR and digestion with restriction enzyme.

(5) structure of recombinant plasmid pGEM-T-pen-hrp and evaluation

With Xba I, Pst I double digestion recombinant plasmid pGEM-T-pen DNA, reclaim test kit (Omega company product) recovery, purifying purpose 3.2kb dna segment with glue.With Xba I, Pst I double digestion recombinant plasmid pGEM-T-hrp DNA, reclaim test kit recovery, purifying purpose 1.2kb dna segment with glue.Again the 3.2kb dna segment is connected with the 1.2kb dna segment, behind 16 ℃ of connection 15h, product Transformed E .coli JM109 competent cell is coated on the LB flat board that contains 100 μ g/mL penbritins (Amp), screening is identified with PCR and digestion with restriction enzyme.

(6) structure of recombinant expression plasmid pET-pen-hrp and evaluation

Use EcoR I, Hind III is double digestion expression vector pET-32a (+) and recombinant plasmid pGEM-T-pen-hrp DNA respectively, reclaiming test kit with glue respectively reclaims, purifying target DNA segment, pen-hrp dna segment with 1.4kb is connected with pET-32a (+) dna segment again, behind 16 ℃ of connection 15h, product Transformed E .coli Origami B (DE3) pLysS competent cell, coat and contain 100 μ g/mL penbritins (Amp), on the LB flat board of 34 μ g/mL paraxin and 15 μ g/mL kantlex, screening, identify dna sequencing Analysis and Identification recombinant plasmid pET-pen-hrp with PCR and digestion with restriction enzyme.These bacterial strain called after intestinal bacteria recombination engineering strain E.coli OrigamiB (DE3) pLysS (pET-pen-hrp).

In one embodiment of the invention, provide a kind of intestinal bacteria recombination engineering strain E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) that utilizes, expressed the method for Penharpin fusion rotein.The steps include:

(1) picking list colony inoculation is in containing 100 μ g/mL penbritins (Amp), in the LB liquid nutrient medium of 34 μ g/mL paraxin and 15 μ g/mL kantlex, and 37 ℃, shaking culture 8-12h under the 250r/min.4 ℃ of placements are spent the night.

(2) insert the fresh 100 μ g/mL penbritins (Amp) that contain by 4% inoculum size next day, in 34 μ g/mL paraxin and the 15 μ g/mL kantlex 2YT liquid nutrient mediums, continue down shaking culture when bacterium liquid OD600 value is 0.6-0.8 at 37 ℃, add inductor IPTG to final concentration be 0.4mmoI/L, at 37 ℃ of following abduction delivering 3-5h, 4 ℃ of centrifugal collection thalline.

(3) expression of 10%SDS-PAGE electrophoresis detection target protein.

A kind of method of purifying Penharpin fusion rotein is provided in one embodiment of the invention.

(1) the centrifugal collection supernatant of ultrasonic disruption;

(2) adopt HisBind resin post (Novagen company product), according to the operational manual purifying Penharpin of Novagen company fusion rotein;

(3) the Penharpin fusion rotein of PBS damping fluid (pH7.3) dialysis treatment purifying;

(4) 10%SDS-PAGE electrophoresis, laser scanning detect Penharpin fusion rotein purity.

(5) adopt Bradford assay method, measure the Penharpin fusion rotein concentration of purifying.

The present invention compared with prior art has the following advantages and effect:

In one embodiment of the invention, detected the antibacterial biological activity of Penharpin fusion rotein.

Adopt tetrazolium bromide (MTT) method, detect the activity of fusion rotein Penharpin gram positive bacterium and gram negative bacterium.Fusion rotein Penharpin has broad-spectrum antibacterial action, and gram positive bacterium and gram negative bacterium are all had tangible bacteriostatic activity.The final concentration of fusion rotein Penharpin is 1.4pmol/mL in the experiment, to streptococcus aureus (Staphylococcusaureus), bacillus pumilus (Bacillus pumilus), bacillus thuringiensis (Bacillusthuringiensis), subtilis (Bacillus megaterium), vibrio alginolyticus (Vibrioalginolyticus), Vibrio parahaemolyticus (Bibrio Parahemolyticus), Salmonella typhimurium (salmonella typhimurium), e. coli jm109 (Escherichia coli JM109), Pseudomonas aeruginosa (Pseudomonas aeruginosa) etc. has the excellent antibiotic activity.

In one embodiment of the invention, detected the antimycotic biological activity of Penharpin fusion rotein.

Adopt tetrazolium bromide (MTT) method, detect the activity of fusion rotein Penharpin fungi.Fusion rotein Penharpin has tangible anti-microbial activity to aspergillus niger (Aspergillus niger).The final concentration of fusion rotein Penharpin is 1.4pmol/mL in the experiment, and aspergillus niger is had inhibitory or killing effect, and pressing down the rate of killing is 47.7%.

In one embodiment of the invention, detected the biological activity that Penharpin fusion rotein resisting tobacco mosaic virus infects.The final concentration of fusion rotein Penharpin is 2.0pmol/mL in the experiment, fusion rotein Penharpin, exciton Harpin all can prevent tobacco mosaic virus (TMV) (TMV) to the infecting of tobacco, and fusion rotein Penharpin that prevention tobacco mosaic virus (TMV) (TMV) is infected the effect of tobacco is good than exciton Harpin.In addition, fusion rotein Penharpin and exciton Harpin also have certain result of treatment to the infection of TMV, disease index contrast reduces, and its relative control effect is respectively 14.63% and 13.93%, and the relative control effect of fusion rotein Penharpin is higher than exciton Harpin.

In one embodiment of the invention, measured the anaphylaxis of Penharpin fusion rotein evoking tobacco.

Adopt the blade puncture method, measure the anaphylaxis of fusion rotein Penharpin evoking tobacco.Fusion rotein Penharpin and exciton Harpin all can cause the anaphylaxis of tobacco, and fusion rotein Penharpin and exciton Harpin sample preparation group are compared, the anaphylaxis that fusion rotein Penharpin treatment group is caused is strong than the level of response of exciton Harpin treatment group, and E.coli OrigamiB (DE3) pLysS (pET) extracting solution sample preparation group and PBS treatment group are all reactionless.

In one embodiment of the invention, measured the inducing action of fusion rotein Penharpin to defensive material.

Peroxidase (POD) and superoxide-dismutase (SOD) all are the enzymes that plays an important role in the plant defense, by measuring POD and SOD, determine the inducing action of fusion rotein Penharpin to defensive Substance P OD and SOD in the tobacco leaf.The final concentration of fusion rotein Penharpin is 2.0pmol/mL in the experiment.

Tobacco leaf POD activity 4h after handling through fusion rotein Penharpin promptly begins to raise, and reaches peak value when 10h, is about 1.8 times of initial value, and enzyme value alive falls back near initial level during to 14h.The activity of the blade POD that exciton Harpin handles also reaches peak value at 10h, is about 1.5 times of initial value.The no considerable change alive of the enzyme of PBS treatment group.Fusion rotein Penharpin treatment group is compared with exciton Harpin treatment group, and the POD enzyme work of the blade of fusion rotein Penharpin treatment group all is higher than exciton Harpin treatment group at each time point.

After tobacco leaf sprayed processing through fusion rotein Penharpin, the activity of superoxide-dismutase (SOD) increased.SOD promptly begins to raise handling back 4h through fusion rotein Penharpin, reaches peak value when 6h, and for initial value 1.5 times fall after rise then gradually, and the enzyme value of living falls back near initial level during to 14h.The activity of the blade SOD that exciton Harpin handles reaches peak value at 10h, is about 1.2 times of initial value.The enzyme of PBS treatment group no obvious variation alive.Compare with exciton Harpin treatment group, the SOD enzyme of the blade of fusion rotein Penharpin treatment group is lived and is reached maximum within a short period of time.

Prawn peptide Pen-2 and exciton Harpin have unique biological activity separately.Prawn peptide Pen-2 all has tangible anti-microbial infection activity to gram positive bacterium, gram negative bacterium, fungi, virus.Exciton Harpin energy stimulating plant produces the immunologic mechanism of nature, makes plant can resist a series of bacterium, fungi and virus disease.Exciton Harpin also has the function that promotes plant-growth and growth.At present, exciton Harpin can directly apply to control of plant disease (directly spray and use or make up multi-functional biological and ecological methods to prevent plant disease, pests, and erosion microorganism), also can be applied to transgenic plant and has the disease-resistant characteristic of wide spectrum.But, exciton Harpin in application process, the problem that exists many, the anti-Plant diseases effects of spraying times to have much room for improvement.

Up to now, do not see report and the document that prawn peptide Pen-2 uses both at home and abroad in control of plant disease.Penharpin fusion rotein involved in the present invention has the activity of prawn peptide Pen-2 and exciton Harpin simultaneously, in the control of Plant diseases the application of more single exciton Harpin more effective, the prevention effect of Plant diseases is better.Simultaneously, the independent production of the production of Penharpin fusion rotein and prawn peptide Pen-2, exciton Harpin has relatively reduced production cost, has also reduced the cost of control of plant disease.

Advantage of the present invention is as follows:

(1) adopts genetic engineering technique, prepared the Penharpin fusion rotein, the Penharpin fusion rotein has the activity of prawn peptide Pen-2 and exciton Harpin simultaneously, compare biological activity more effective, wide spectrum that this fusion rotein has with single prawn peptide Pen-2 and exciton Harpin biological activity.

(2) gene engineering preparation method of Penharpin fusion rotein is compared with other method such as chemical crosslink technique, have simple to operate, expression amount is high, safe, cost is low, help realizing industrialization production.The application of this method has avoided that the existing operation of chemical crosslink technique is loaded down with trivial details, cross-linking efficiency is low, product heterogeneity, the easy inactivation of protein, the more high defective of cost.

(3) adopt genetically engineered to produce the Penharpin fusion rotein, more single production prawn peptide Pen-2 and exciton Harpin have avoided the duplication of labour, have reduced production cost.

(4) in the control of Plant diseases was used, the Penharpin fusion rotein is compared with the application of single exciton Harpin, and was better to the prevention effect of Plant diseases.

(5) in the control of Plant diseases is used, the Penharpin fusion rotein is used with exciton Harpin and is compared, and has reduced spraying times, has reduced the cost of control of plant disease.

The Penharpin fusion rotein had both had the biological activity of prawn peptide Pen-2, had the biological activity of exciton Harpin again, was a kind of newtype drug of preventing and treating the disease of plant, the growth that promotes plant, raising crop yield.

Description of drawings

Above and other objects of the present invention, characteristics and advantage obtain the content shown in the detailed description and the accompanying drawings of the preferred embodiment of the present invention from following with may be obvious that, and reference symbol identical in the different views is represented identical part.Accompanying drawing might not be shown to scale, and it focuses on illustrating enforcement of the present invention and effect.

The pcr amplification product electrophoretogram of Fig. 1 Pen-2 gene pen

Lane?1，LD2000?marker；lane?2，DNA?fragments?of?pen?were?amplified?by?PCR.

PCR and the enzyme of Fig. 2 recombinant plasmid pGEM-T-pen are cut evaluation figure

Lane?1，LD2000?marker；lane?2，DNA?fragments?of?pen?were?amplified?by?PCR；lane?3，recombinant?pGEM-T-pen?vector?digested?by?EcoR?I；lane?4，recombinant?pGEM-T-pen?vector?digested?by?EcoR?I/Xba?I；lane?5，MarkerIII.

The pcr amplification product electrophoretogram of Fig. 3 Harpin gene hrp

Lane?1，Marker?III；lane?2，DNA?fragments?of?hrp?were?amplified?by?PCR.

PCR and the enzyme of Fig. 4 recombinant plasmid pGEM-T-hrp are cut evaluation figure

Lane?1，Marker?III；lane?2，DNA?fragments?of?hrp?were?amplified?by?PCR；lane?3，recombinant?plasmid?pGEM-T-hrp?digested?by?Pst?I；lane?4，recombinant?plasmid?pGEM-T-hrp?digested?by?Pst?I/Xba?I.

PCR and the enzyme of Fig. 5 recombinant plasmid pGEMT-pen-hrp are cut evaluation figure

Lane?1，LD2000marker；lane?2，DNA?fragments?of?pen?were?amplified?by?PCRwith?PEN1?and?PEN2；lane?3，DNA?fragments?of?hrp?were?amplified?by?PCRwith?HRP1?and?HRP2；lane?4，DNA?fragments?of?pen-hrp?were?amplified?byPCR?with?PEN1?and?HRP2；lane?5，recombinant?plasmid?pGEM-T-pen-hrpdigested?by?EcoR?I；lane?6，recombinant?plasmid?pGEMT-pen-hrp?digested?byEcoR?I/Hind?III；lane?7，Marker?III.

The building process figure of Fig. 6 recombinant plasmid pGEMT-pen-hrp

PCR and the enzyme of Fig. 7 recombinant expression plasmid pET-pen-hrp are cut evaluation figure

Lane?1，DL2000?marker；lane?2，DNA?fragments?of?pen-hrp?were?amplifed?byPCR?with?PEN?1and?HRP2；Lane?3，recombinant?pET-pen-hrp?vector?digestedby?EcoR?I/Hind?III；lane?4，pET-pen-hrp?vector?digested?by?EcoR?I；lane?5，Marker?IV

The building process figure of Fig. 8 recombinant expression plasmid pET-pen-hrp

Figure 91 0%SDS-PAGE detects the expression of fusion rotein Penharpin

Lane 1, and E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) does not induce; Lane 2, before E.coliOrigamiB (DE3) pLysS (pET-pen-hrp) induces; Lane 3, and E.coli OrigamiB (DE3) pLysS (pET-32a) induces 4h; Lane 4, and E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) induces 3h; Lane 5, and E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) induces 4h; Lane 6, and E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) induces 5h; Lane 7, and E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) induces 6h; Lane 8, molecular weight standard; Lane 9, the fusion rotein Penharpin. of purifying

Figure 10 fusion rotein Penharpin induces the anaphylaxis of generation on tobacco leaf

1/6，Penharpin?sample；2/5，harpin?sample；3/4，PBS?Buffer.

Figure 11 fusion rotein Penharpin induces POD, the POD determination of activity

Time-course?measurement?of?systemic?activation?of?phenol?peroxidase(POD)in?tobacco?leaves?treated?with?protein?Penharpin?and?Harpin.Control?leaveswere?treated?with?PBS.Plants?were?harvested?at?different?time?intervals?afterthe?beginning?of?treatment.

Figure 12 fusion rotein Penharpin induces SOD, the SOD determination of activity

Time-course?measurement?of?systemic?activation?of?Superoxide?dismutase(SOD)in?tobacco?leaves?treated?with?protein?Penharpin?and?Harpin.Controlleaves?were?treated?with?PBS.Plants?were?harvested?at?different?time?intervalsafter?the?beginning?of?treatment.

Embodiment

By in conjunction with following specific embodiment, illustrate the present invention.What however, it should be understood that is, these embodiment only are used to the present invention is described and are not used in and limit the scope of the invention.

Amplification and the clone of embodiment 1 Penaeus vannamei Pen-2 gene pen

1. the design of amplimer and synthetic

In order to make expressed Pen-Harpin fusion rotein biologically active, possess correct space conformation, connection peptides is " GGSGSGGSSRGGSGS " between design prawn peptide Pen-2 and the Harpin albumen.

Nucleotide sequence according to prawn peptide Pen-2 gene pen sequence and connection peptides " GGSGSGGSSRGGSGS " designs a pair of primer PEN1 and PEN2, and the nucleotide sequence of PEN1 and PEN2 is respectively:

Upstream primer PEN1:(SEQ ID No.3)

5 ' GT GAATTCTACAGGGGCGGTTACACA3 ' (the underscore place is EcoR I site).

Downstream primer PEN2:(SEQ ID No.4)

5 ' GG TCTAGAAGAACCGCCAGATCCAGAGCCACCTCCTTTTACTAAGTGA3 ' (the underscore place is Xba I site).

Primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized, through the PAGE purifying.

2. the pcr amplification of goal gene pen

With PEN 1 and PEN2 is primer, and the plasmid pGEM-T/Pen that contains Pen-2 gene pen is a template, and pcr amplification contains the pen dna segment of connection peptides nucleotide sequence, and its 5 ' end and 3 ' end contain EcoR I and Xba I restriction enzyme site respectively.PCR reaction system: 10 * reaction buffer, 5 μ L; 1.5mM MgCl2,3 μ L; 0.2mM dNTP, 1 μ L; 20pmol upstream primer P1,1 μ L; 20pmol downstream primer P2,1 μ L; 5U/ μ L Taq archaeal dna polymerase 1 μ L; Template 6 μ L; Adding sterilized water to final volume is 50 μ L.The PCR reaction conditions: 95 ℃, 5min; 94 ℃, 30s; 53 ℃, 45s; 72 ℃ of 30s (35 circulations); 72 ℃, 5min.

The agarose gel electrophoresis result as shown in Figure 1.Pcr amplification goal gene pen product is through 1.2% agarose gel electrophoresis, and EB dyeing back ultraviolet lamp is observed down, has one to be about 230bp DNA band, and pen result conforms to goal gene.

3. the clone of Penaeus vannamei pen gene

(1) the segmental recovery of goal gene pen

Adopt DNA glue to reclaim test kit (Omega company product), reclaim the test kit specification sheets according to the DNA of Omega company glue and reclaim target gene fragment.The concrete operations step is as follows:

1. the PCR product through 1.2% agarose gel electrophoresis (1 * TAE), observe the electrophoresis situation with ultraviolet lamp, when the DNA band that will reclaim and other bands separate fully, stop electrophoresis, under ultraviolet lamp, downcut desire and reclaim band, with PCR product purification test kit purifying with blade.

2. in the Eppendorf pipe, glue is smashed to pieces, added isopyknic sol solutions Binding Buffer, 65 ℃ of water-bath 7min, every therebetween 2min jog Eppendorf pipe once melts fully until glue.

The sample that 3. will melt adds in the chromatography column, and the centrifugal 1min of 12000rpm discards liquid.

4. add 300 μ L Binding Buffer, the centrifugal liquid that discards.

5. add 750 μ L Washing Buffer, the centrifugal liquid that discards.

6. repeating step (5), 1 time.

7. the centrifugal 1min of the sub-12000rpm of void column is to dry liquid.

8. pillar is put in 1.5mL Eppendorf pipe, adds 30 μ L Elution buffer, 37 ℃ of insulation 2min, the centrifugal 1min of 12000rpm collects centrifugate, is stored in-20 ℃.

(2) goal gene pen fragment cloning is gone into the pGEM-T carrier, construction recombination plasmid pGEM-T-pen

In the pGEM-T carrier, the pGEM-T carrier is available from Promega company with the PCR product cloning of above purifying.Reaction system is: 2 * Ligation buffer, 5.0 μ L; The pGEM-T carrier, 0.5 μ L; The PCR product, 4.0 μ L; T4DNA ligase, 0.5 μ L; Do not have and add bacterium ddH2O to 10 μ L.Mix aforesaid liquid on ice, 16 ℃ connect 15h.

(3) conversion of plasmid

1. the preparation of competent cell: adopt cold Calcium Chloride Method to prepare competent escherichia coli cell.The single E.coli JM109 of picking bacterium colony, be inoculated in the 5mL LB substratum, 37 ℃, 220rpm overnight incubation are got above-mentioned bacterium liquid next day and are inoculated in the 50mL LB nutrient solution 37 ℃ in proportion at 1: 100, the 220rpm vibration, treat that bacterium liquid OD value is at 0.6 o'clock, get 1.5mL bacterium liquid and add in the aseptic Eppendorf centrifuge tube 4, the centrifugal 10min of 000rpm abandons supernatant.The 0.1M calcium chloride that adds the precooling of 800 μ L ice, the resuspended bacterial sediment that vibrates gently, ice bath 30min.4, the centrifugal 10min of 000rpm abandons supernatant.The resuspended precipitation of 0.1M calcium chloride that adds the precooling of 100 μ L ice, 4 ℃ of preservations were used in 7～10 days.

2. plasmid Transformed E .coli JM109 competent cell: get above-mentioned connection product 10 μ L and add in the 100 μ L competent cells, mixing gently, ice bath 60 minutes, 42 ℃ of heat-shockeds 90 seconds were put ice bath 2 minutes again, added the fresh LB liquid nutrient medium of 390 μ L, 37 ℃, 150rpm jog, 50min.Getting 100 μ L bacterium liquid coats and contains 5-bromo-4 chloro-3 indoles-D-galactoside (X-gal, Promega company product), isopropylthiogalactoside (IPTG, Promega company product) and on the LB flat board of Amp resistance, 37 ℃ of overnight incubation, observations is carried out blue hickie screening.Picking white colony rapid extraction plasmid carries out PCR and enzyme is cut evaluation.

(4) evaluation of recombinant plasmid pGEM-T-pen

10 mono-clonal hickies of picking are used plasmid extraction kit (Qiagen company product) extracting plasmid after the enlarged culturing at random.With plasmid pGEM-T-pen is template, shows with primer PEN1, PEN2 to amplify and the segment that predicts the outcome and conform to, and goal gene pen has been cloned in the pGEM-T carrier.PCR and enzyme are cut qualification result and are seen accompanying drawing 2.Recombinant plasmid pGEM-T-pen obtains the expection dna segment of about 3000bp and 230bp through EcoRI and Xba I double digestion, and pGEM-T-pen obtains the expection dna segment of single about 3230bp through the EcoRI single endonuclease digestion.

(5) pen nucleotide sequencing

Plasmid pGEM-T-pen DNA is after PCR and enzyme are cut evaluation, and the picked at random positive colony send the big genome company of Beijing China to carry out the dna sequencing analysis.The pGEM-T-pen plasmid is through full-automatic sequencing analysis, and the pen gene nucleotide series is:

tacaggggcg?gttacacagg?cccgataccc?aggccaccac?ccattggaag?accaccgttc 60

agacctgttt?gcaatgcatg?ctacagactt?tccgtctcag?atgctcgcaa?ttgctgcatc 120

aagttcggaa?gctgttgtca?cttagtaaaa?gga 153

Amplification and the clone of embodiment 2 exciton Harpin gene hrp

1. the design of amplimer and synthetic

Nucleotide sequence according to exciton Harpin gene hrp sequence and connection peptides " GGSGSGGSSRGGSGS " designs a pair of primer HRP1 and HRPP2, and the nucleotide sequence of HRP1 and HRPP2 is respectively:

Upstream primer HRP1:(SEQ ID No.5)

5 ' GG TCTAGAGGTGGCTCTGGATCTATGCGGGGTTCTCATCATCA 3 ' (the underscore place is Xba I site).

Downstream primer HRP2:(SEQ ID No.6)

5 ' GG CTGCAGAAGCTTTCAGGCCACAGCCTGGTTAGTCTG 3 ' (the underscore place is HindIII and PstI site).

Primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized, through the PAGE purifying.

2. the pcr amplification of goal gene hrp

With HRP1 and HRPP2 is primer, and the plasmid pGEM-T-hrp that contains exciton Harpin gene hrp is a template, and pcr amplification contains the hrp dna segment of connection peptides nucleotide sequence, and its 5 ' end contains the XbaI enzyme cutting site.3 ' end contains HindIII and PstI restriction enzyme site.PCR reaction system: 10 * reactionbuffer, 5 μ L; 1.5mM MgCl2,3 μ L; 0.2mM dNTP, 1 μ L; 20pmol upstream primer P1,1 μ L; 20pmol downstream primer P2,1 μ L; 5U/ μ L Taq archaeal dna polymerase 1 μ L; Template 6 μ L; Adding sterilized water to final volume is 50 μ L.The PCR reaction conditions: 95 ℃, 5min; 94 ℃, 30s; 53 ℃, 45s; 72 ℃ of 30s (35 circulations); 72 ℃, 5min.

The agarose gel electrophoresis result as shown in Figure 3.Pcr amplification goal gene hrp product is through 0.7% agarose gel electrophoresis, and EB dyeing back ultraviolet lamp is observed down, has one to be about 1281bp DNA band, and the result conforms to goal gene hrp product.

3. the clone of goal gene hrp

(1) the segmental recovery of goal gene hrp

Method is with embodiment 1.

(2) goal gene hrp fragment cloning is gone into the pGEM-T carrier, construction recombination plasmid pGEM-T-hrp

In the pGEM-T carrier, the pGEM-T carrier is available from Promega company with the PCR product cloning of above purifying.Reaction system is: 2 * Ligation buffer, 5.0 μ L; The pGEM-T carrier, 0.5 μ L; The PCR product, 4.0 μ L; T4DNA ligase, 0.5 μ L; Do not have and add bacterium ddH2O to 10 μ L.Mix aforesaid liquid on ice, 16 ℃ connect 15h.

(3) conversion of plasmid

Method is with embodiment 1.

(4) evaluation of recombinant plasmid pGEM-T-hrp

10 mono-clonal hickies of picking are used plasmid extraction kit (Qiagen company product) extracting plasmid after the enlarged culturing at random.With plasmid pGEM-T-hrp is template, and the result shows with primer HRP1, HRP2 and amplify and the segment that predicts the outcome and conform to that goal gene has been cloned in the pGEM-T carrier.PCR and enzyme are cut qualification result and are seen accompanying drawing 4.Recombinant plasmid pGEM-T-hrp obtains the expection dna segment of about 3000bp and 1281bp through Xba I and Pst I double digestion, and pGEM-T-hrp obtains the expection dna segment of single about 4281bp through Pst I single endonuclease digestion.

(5) hrp nucleotide sequencing

Plasmid pGEM-T-hrp DNA is after PCR and enzyme are cut evaluation, and the picked at random positive colony send the big genome company of Beijing China to carry out the dna sequencing analysis.The pGEM-T-hrp plasmid is through full-automatic sequencing analysis, and the hrp nucleotides sequence is classified as:

atgcggggtt?ctcatcatca?tcatcatcat?ggtatggcta?gcatgactgg?tggacagcaa 60

atgggtcggg?atctgtacga?cgatgacgat?aaggatccaa?cccttatgca?gagtctcagt 120

cttaacagca?tgagttcgtt?gcaaacctct?gcatcattgt?tccccgtgtc?gctcaacagc 180

gatgtgagcg?ccaacaccag?cacttccagc?aaagagctca?aggctgtgat?cgatcagctg 240

gttcaggcgc?tgacccaaag?tgggcagctc?gatgaaacct?caccgctcgg?caaaatgctc 300

gccaaggcca?tggctgcgga?tggcaagtcg?gctaacagca?tcgatgacat?cactgcatcg 360

ctcgacaagc?tgatccacga?aaagctcggc?aacaatttcg?gtgcctctgc?cggcatcggc 420

gcgggtggcg?gtggcggtgg?cattggcggg?gcgggttctg?gttcgggtgt?cggtggcggt 480

ctgagcagcg?acgcgggtgc?cgggcaatcc?gatctgatga?gccaggtcct?gaacggcctc 540

ggcaaagccg?tgctggacga?tctgctgaca?ccgagtggtg?aaggcggaac?aaccttttcc 600

agtgatgaca?tgccgaccct?ggaaaaagtc?gcccggttca?tggacgacaa?caaggcccag 660

ttccctactc?gggacggcgg?ctcgtggatg?aacgagctga?aggaagacaa?tggcctgtat 720

gcacaggaaa?ccgctcagtt?tcgttcggct?ctcgacgtca?ttggtcaaca?gctcggccag 780

caacaaggtg?atgccagtgg?cgttaccagt?ggcggcggtc?tgggttcgcc?cgtgagtgac 840

agctccctgg?gtaatcctgc?aatcgatgcc?aacacaggtc?ccgcggccaa?tggcaatgcc 900

agcgtcgacg?taggtcaact?gatcggtcaa?ctcatcgacc?gtggtttgca?gtcggtttcg 960

tcgggtggcg?gtctgggtac?accggtcgac?aattccacgc?agccgacagg?tggcacgcca 1020

gcggctaacc?cgacgggcaa?cgtgtccaat?caggacctgg?gtcaactgct?gaacggcttg 1080

ctgcaacgcg?ggctggaagc?gacgcttcag?gatgctggca?acaccggcgc?cgacctgcaa 1140

tcgagcgctg?cgcaagtggc?agctcagctg?atcaatgcgc?tgttgcaagg?caccaataac 1200

cagactaacc?aggctgtggc?ctga 1224

Synthetic and the engineering strain of embodiment 3pen-hrp fusion gene

The structure of E.coli OrigamiB (DE3) pLysS (pET-pen-hrp)

1. the structure of recombinant plasmid pGEM-T-pen-hrp and evaluation

With XbaI, Pst I double digestion recombinant plasmid pGEM-T-pen DNA, reclaim test kit recovery, purifying purpose 3.2kb dna segment with glue.With XbaI, Pst I double digestion recombinant plasmid pGEM-T-hrpDNA, reclaim test kit recovery, purifying purpose 1.2kb dna segment with glue.The 3.2kb dna segment is connected with the 1.2kb dna segment, behind 16 ℃ of connection 15h, product Transformed E .coli JM109 competent cell is coated on the LB flat board that contains 100 μ g/mL penbritins (Amp) 37 ℃ of overnight incubation again.

10 positive colonies of picking after enlarged culturing, with plasmid extraction kit extracting plasmid, adopt PCR and Xba I, Pst I enzyme to cut and identify recombinant plasmid pGEM-T-pen-hrp at random.With plasmid pGEM-T-pen-hrp is template, amplifies and the segment that predicts the outcome and conform to primer PEN1, PEN2, HRP1 and HRP2, shows that goal gene pen-hrp requires to be cloned in the pGEM-T carrier according to molecular designing.PCR and enzyme are cut qualification result such as accompanying drawing 5.Recombinant plasmid pGEM-T-pen-hrpDNA obtains two dna segments of about 3.0kb and 1.4kb through the EcoRI+HindIII double digestion, and pGEM-T-pen-hrp DNA obtains the dna segment of single about 4422bp through the EcoRI single endonuclease digestion.

The building process of recombinant plasmid pGEM-T-pen-hrp such as accompanying drawing 6.

3. the structure of recombinant expression plasmid pET-pen-hrp and evaluation

With EcoR I, Hind III difference double digestion expression vector pET-32a (+) and recombinant plasmid pGEM-T-pen-hrp DNA, reclaim test kit recovery, purifying target DNA segment with glue respectively, pen-hrp dna segment with 1.4kb is connected with pET-32a (+) dna segment again, behind 16 ℃ of connection 15h, product Transformed E .coli Origami B (DE3) pLysS competent cell, coat and contain 100 μ g/mL penbritins (Amp), on the LB flat board of 34 μ g/mL paraxin and 15 μ g/mL kantlex, 37 ℃ of overnight incubation.

10 positive colonies of picking after enlarged culturing, are used plasmid extraction kit extracting plasmid at random, and PCR and EcoR I, Hind III enzyme are cut and identified the pET-pen-hrp recombinant expression plasmid.With plasmid pET-pen-hrp is template, amplifies and the segment that predicts the outcome and conform to primer PEN1, PEN2, HRP1 and HRP2, shows that goal gene has been cloned in pET-32a (+) carrier.PCR and enzyme are cut qualification result such as accompanying drawing 7.Recombinant plasmid pET-pen-hrp DNA obtains two dna segments of about 5875bp and 1422bp through the EcoRI+HindIII double digestion, and pET-pen DNA obtains the dna segment of single about 7297bp through the EcoRI single endonuclease digestion.

The building process of recombinant expression plasmid pET-pen-hrp such as accompanying drawing 8.

4.pen-hrp fusion gene nucleotide sequencing

Plasmid pET-pen-hrp DNA is after PCR and enzyme are cut evaluation, and the picked at random positive colony send the big genome company of Beijing China to carry out the dna sequencing analysis.The pET-pen-hrp plasmid is through full-automatic sequencing analysis, the result shows that 6 His sequences merge before the pen gene, the pET-pen-hrp plasmid contains pen gene, GGSGSGGSSRGGSGS connection peptides encoding sequence and hrp gene successively on from 5 ' to 3 ' direction, the fusion rotein sequence is read frame does not have frameshit.

The dna sequence dna of pen-hrp fusion gene is shown in SEQ ID No.1.Wherein, the fusion rotein coding region is the 1-1422 position, and the pen coding region is 1-153, and the hrp coding region is 199-1422, and GGSGSGGSSRGGSGS connection peptides coding region is 154-198.The aminoacid sequence of the fusion rotein Penharpin that this fusion gene is coded shown in SEQ ID No.2, totally 473 amino acid.

The above-mentioned constructed bacterial strain that contains plasmid pET-pen-hrp is E.coli OrigamiB (DE3) pLysS (pET-pen-hrp), culture presevation CCTCCM208071.

The expression of embodiment 4 genetic engineering fusion protein Penharpin

Bacterial classification E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) that picking is preserved with glycerine, be inoculated in and contain 100 μ g/mL Ampicillin, in the LB liquid nutrient medium of 34 μ g/mL chloramphenicol and 15 μ g/mLkanamycin (sulfate), 37 ℃, shaking culture 8-12h under the 250r/min.Insert fresh contain 100 μ g/mL Ampicillins by 4% inoculum size next day, in the 2YT liquid nutrient medium of 34 μ g/mLchloramphenicol and 15 μ g/mL kanamycin (sulfate), 37 ℃ are cultured to bacterium liquid OD600 value when the 0.6-0.8, add inductor IPTG (final concentration is 0.4mM), 37 ℃ of following abduction deliverings are induced back 3h, 4h, 5h, 6h takes a sample respectively, centrifugation, remove supernatant, add 300 μ LPBS (PH6.9) damping fluids, ultrasonic disruption, 12, the centrifugal 10min of 000g, supernatant adds 5 * SDS-PAGE sample buffer, carries out SDS-PAGE with reference to " molecular cloning ", with coomassie brilliant blue R250 dyeing check and analysis expression of results.The result as shown in Figure 9.The 10%SDS-PAGE electrophoresis result shows at IPTG induces the back engineering strain can expressed fusion protein Penharpin, and the expression product molecular weight conforms to expection, is about 65kDa.

The purifying of embodiment 5 fusion rotein Penharpin

(1) bacterial classification E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) that preserves with glycerine of picking, be inoculated in and contain 100 μ g/mL Ampicillin, in the LB liquid nutrient medium of 34 μ g/mL chloramphenicol and 15 μ g/mL kanamycin (sulfate), 37 ℃, shaking culture 8-12h under the 250r/min.Insert fresh contain 100 μ g/mL Ampicillins by 4% inoculum size next day, in the 2YT liquid nutrient medium of 34g/mL chloramphenicol and 15 μ g/mL kanamycin (sulfate), 37 ℃ are cultured to bacterium liquid OD600 value when the 0.6-0.8, add inductor IPTG (final concentration is 0.4mM), 37 ℃ of following abduction deliverings, behind the abduction delivering 4h, the centrifugal collection thalline of 5000g.

(2) be resuspended in Binding Buffer pH7.920mmol/L Tris-HCl, among the 5mmol/L NaCl, 4 ℃, carry out the ultrasonic disruption bacterium and handle (locating 30min, each 10s, 30s at interval).12, the centrifugal 20min twice of 000g collects supernatant, and supernatant is the extracting solution of Penharpin fusion rotein.

(3) Ni ⁺⁺The column chromatography sample preparation: the extracting solution of Penharpin fusion rotein is settled to 100ml Ni through the membrane filtration of 0.45 μ m with 1 * Binding Buffer ⁺⁺The column chromatography sample.With 10 1 * Binding Buffer, 20 sterile water wash post beds; With 10 1 * Charge Buffer (5mMNiSO4), in conjunction with Ni ⁺⁺After using 10 1 * Binding Buffer balance columns beds again, standby (1 promptly is the volume of medium in the post).Sample passes through Ni in a looping fashion through peristaltic pump ⁺⁺Post makes the abundant and Ni of the protein sample moving phase that has 6 * His ⁺⁺Ni in the post ⁺⁺Combine, the back of spending the night is from Ni ⁺⁺Column outlet is collected not and Ni ⁺⁺Bonded sample (leakage liquid).Adopt 50 1 * Binding Buffer respectively; 75 60mM imidazoles; 75 100mM imidazoles; The washing of 30 150mM imidazoles gradients stay in the post small amount of sample and with the non-target protein of Ni++ post bonded.With 1 * Elute Buffer (1M imidazoles+0.5MNaCl+20mM TrisHCl pH7.9) wash-out and Ni++ post bonded target protein, fraction collection, the 1mL/ pipe.The Ni++ post continues wash-out with 1 * Elute Buffer, washes whole albumen in the sample post; Use 1 * Strip Buffer (100mM EDTA+0.5M NaCl+20mM TrisHCl pH7.9) to wash pillar again.By the distribution of SDS-PAGE check target protein in elutriant, carry out SDS-PAGE with reference to " molecular cloning ", with coomassie brilliant blue R250 dyeing check and analysis expression of results.The result as shown in Figure 9.Purification of samples detects through 10%SDS-PAGE, and the single band that is about 65kDa is arranged.

Protein content determines in the embodiment 6 fusion rotein Penharpin purification of samples

With 15mL through Ni ⁺⁺The fusion rotein Penharpin purification of samples of post wash-out, collection is packed in the treated dialysis tubing, puts into and fills the dialysis of 1000mL PBS damping fluid (PH6.9) beaker, spends the night.More than operation is all carried out at 4 ℃.Determine fusion rotein Penharpin content with the Bradford method, demarcate with mg/mL.

The concrete operations of Bradford method are as follows:

(1) 0,1,2,3,4,5,6 μ L 1mg/ml bovine serum albumin (B SA) standardized solution is added successively in the enzyme mark microwell plate, supply 50 μ L with PBS.

(2) in every hole, add 200 μ L Bradford reagent working fluids (0.1% Coomassie brilliant blue G250,5% ethanol, 8.5% phosphoric acid).Behind vibration, the mixing, room temperature was placed 2 minutes.

(3) survey the OD570 value (λ=570nm) of each concentration of B SA albumen with microplate reader.With the BSA protein concn is X-coordinate, is ordinate zou production standard curve with the OD570 value of each concentration of BSA albumen.

(4) use OD570 value, with the concentration of determining sample in the typical curve with the quadrat method working sample.

The antibacterial biological activity of embodiment 7 fusion rotein Penharpin

Adopt tetrazolium bromide (MTT) method, detect the activity of fusion rotein Penharpin gram positive bacterium and gram negative bacterium.Experimental strain comprises: streptococcus aureus (Staphylococcusaureus), bacillus pumilus (Bacillus pumilus), bacillus thuringiensis (Bacillusthuringiensis), subtilis (Bacillus megaterium), vibrio alginolyticus (Vibrioalginolyticus), Vibrio parahaemolyticus (Bibrio Parahemolyticus), e. coli jm109 (Escherichia coli JM109), Pseudomonas aeruginosa (Pseudomonas aeruginosa), Salmonella typhimurium (salmonella typhimurium) (Chinese typical culture collection center provides).Culturing bacterium is surveyed OD to logarithmic phase ₆₀₀, bacteria concentration is adjusted to 2-7 * 10 ⁵CFU/ml.Add testing sample 50 μ L with aseptic micro sample adding appliance in aseptic 96 hole microwell plates, use the broth culture doubling dilution, add 50 μ L bacterium liquid again in each hole, mixing is cultivated 12h for 37 ℃.Establish the positive (penbritin, Amp) control group, blank group simultaneously.Each hole adds tetrazolium bromide (MTT) the solution 10 μ L of 5mg/mL respectively, continues to cultivate 4h.Add 90 μ L DMSO in each hole, mixing also fully is dissolved among the DMSO blue colored crystal, measures OD ₅₇₀The bacteria living rate is calculated by following formula.

Bacteria living rate=(A ₅₇₀Sample preparation/A ₅₇₀Space management) * 100%.

Fusion rotein Penharpin the results are shown in Table 1 to the determination of activity of gram positive bacterium, gram negative bacterium.The bacteria living rate shows that fusion rotein Penharpin all has in various degree antibacterial activity to gram positive bacterium and gram negative bacterium, all has certain inhibitory or killing effect to various bacteria.The final concentration of fusion rotein Penharpin is 1.4pmol/mL in the experiment, to the rate of press down killing of streptococcus aureus be 22.8%, bacillus pumilus press down that the rate of killing is 40.4%, bacillus thuringiensis press down that the rate of killing is 31.2%, subtilis press down that the rate of killing is 47.4%, vibrio alginolyticus press down that the rate of killing is 23.4%, Vibrio parahaemolyticus press down that the rate of killing is 28.4%, e. coli jm109 press down that the rate of killing is 56.3%, Pseudomonas aeruginosa press down that the rate of killing is 38.5%, Salmonella typhimurium to press down the rate of killing be 43.8%.

Table 1 fusion rotein Penharpin antibacterial activity is measured

The antimycotic biological activity of embodiment 8 fusion rotein Penharpin

Adopt tetrazolium bromide (MTT) method, detect the activity of fusion rotein Penharpin fungi.Experimental strain---aspergillus niger (Aspergillus niger) (Chinese typical culture collection center provides).Cultivate aspergillus niger 7 days to growing spore for 28 ℃.Use the aseptic water washing media surface, obtain spore suspension, spore concentration is adjusted to 2-7 * 10 ⁵Spores/mL.In aseptic 96 hole microwell plates, add testing sample 50 μ L with aseptic micro sample adding appliance, with Cha Shi substratum (Cha Shi substratum 200mL:NaNO ₃0.4g, K ₂HPO ₄0.2g, KCl 0.1g, MgSO ₄0.1g, FeSO ₄7H ₂O 0.004g, sucrose 6g) doubling dilution, in each hole, add 50 μ L spore suspensions again, mixing is cultivated 18h for 28 ℃.Establish the positive (amphotericin, AmB) control group, blank group simultaneously.Each hole adds tetrazolium bromide (MTT) the solution 10 μ L of 5mg/mL respectively, continues to cultivate 4h.Add 90 μ L DMSO in each hole, mixing also fully is dissolved among the DMSO blue colored crystal, measures OD ₅₇₀The fungi surviving rate is calculated by following formula.

Fungi surviving rate=(A ₅₇₀Sample preparation/A ₅₇₀Space management) * 100%.

Fusion rotein Penharpin the results are shown in Table 2 to the determination of activity of aspergillus niger.The black-koji mould survival rate shows that fusion rotein Penharpin has tangible anti-microbial activity to aspergillus niger.The final concentration of fusion rotein Penharpin is 1.4pmol/mL in the experiment, and aspergillus niger is had inhibitory or killing effect, and pressing down the rate of killing is 47.7%.

Table 2 fusion rotein Penharpin anti-mycotic activity is measured

The biological activity that embodiment 9 fusion rotein Penharpin resisting tobacco mosaic virus infect

1. the preparation of tobacco mosaic virus (TMV) (TMV) sample

Get the tobacco leaf of an amount of infection tobacco mosaic virus (TMV) (TMV), shred.The blade that shreds is put into mortar, add a spot of quartz sand and 0.2M PBS, in ice bath, thoroughly grind.Ground leaf tissue is centrifugal, 4 ℃ of centrifugal 30min of 4000rpm.Get supernatant and be viral crude extract.The sucrose solution of configuration 20%.20% sucrose solution is added to the centrifuge tube bottom, the viral suspension of slightly purifying is added in the superiors.20, the centrifugal 60min of 000g abandons supernatant liquor, gets precipitation.Precipitation fully is suspended in the 0.01mol/L PBS damping fluid (pH 7.4), and 12, the centrifugal 20min of 000rpm gets supernatant liquor.20% sucrose solution is added to the centrifuge tube bottom, and supernatant liquor is added in the superiors.20, the centrifugal 60min of 000g abandons supernatant liquor, gets precipitation.Precipitation fully is suspended in the 0.01mol/L PBS damping fluid (pH 7.4), and 12, the centrifugal 20min of 000rpm gets supernatant liquor.Supernatant liquor 20,000g are got precipitation from 60min.Precipitation is suspended in an amount of 0.01mol/L PBS damping fluid (pH 7.4), is the TMV viral sample of purifying.The tobacco mosaic virus (TMV) (TMV) that observation post obtains under transmission electron microscope.

2. fusion rotein Penharpin is to the prophylactic effect of tobacco mosaic virus (TMV) (TMV) infection

Get the potted plant tobacco plant of growing way unanimity, be divided into three groups (A, B, C) at random, every group of 9 samples.A, B, each group of C are smeared PBS, 2pmol/mL exciton Harpin sample and 2pmol/mL fusion rotein Penharpin sample respectively.Smear each sample after 5 days, with conventional frictional inoculation method inoculation TMV.The incidence of inoculation back observed and recorded sample.

Tobacco infects by following standard grading other to tobacco mosaic virus (TMV) (TMV):

(1) 0 grade: do not have any symptom

(2) 1 grades: bright arteries and veins or lobus cardiacus have slight floral leaf

(3) 3 grades: lobus cardiacus and middle leaf sheet floral leaf

(4) 5 grades: lobus cardiacus and middle leaf sheet floral leaf, the minority leaf malformation, shrinkage or plant are slightly downgraded

(5) 7 grades: heavy floral leaf, most leaf malformations, shrinkage or plant are obviously downgraded

(6) 9 grades: heavy floral leaf, deformity, plant is obviously downgraded even is dead

Tobacco is calculated by following formula respectively tobacco mosaic virus (TMV) (TMV) incidence of infection, disease index, relative control effect.

Sickness rate (%)=(respectively handle sample morbidity number/respectively handle gross sample given figure) * 100

Disease index=∑ (sick progression * sick sample number)/(the highest sick level * respectively handle gross sample given figure) * 100

Relative control effect (%)=[(contrast average disease index one and handle average disease index)/contrast average disease index] * 100

Fusion rotein Penharpin sees Table 3 to the prophylactic effect test-results that tobacco mosaic virus (TMV) (TMV) infects.After smearing fusion rotein Penharpin, exciton Harpin 5d, inoculate TMV, then the disease index of tobacco plant and sickness rate all contrast the minimizing that has by a relatively large margin than PBS, and relative control effect is respectively 76.6% and 38.7%, and sickness rate has reduced 70% and 33.3% respectively.The result shows that fusion rotein Penharpin, exciton Harpin all can prevent tobacco mosaic virus (TMV) (TMV) to the infecting of tobacco, and fusion rotein Penharpin that prevention tobacco mosaic virus (TMV) (TMV) is infected the effect of tobacco is good than exciton Harpin.

Table 3 fusion rotein Penharpin measures the prophylactic effect of tobacco mosaic virus infection

3. fusion rotein Penharpin infects the therapeutic action of tobacco mosaic virus (TMV) (TMV) to tobacco

Get the potted plant tobacco plant of growing way unanimity, be divided into three groups (A, B, C) at random, every group of 9 samples.Equivalent inoculation TMV.Behind the inoculation 5d, A, B, each group of C are smeared PB S, 2pmol/mL exciton Harpin sample and 2pmo1/mL fusion rotein Penharpin sample respectively.The inoculation back is observed and the record incidence.TMV infects and divides rank standard, sickness rate, and the method for calculation of disease index and relative control effect are with above-mentioned 2.

Fusion rotein Penharpin sees Table 4 to the therapeutic action test-results of the tobacco of infection tobacco mosaic virus (TMV) (TMV).Test-results shows, fusion rotein Penharpin and exciton Harpin all have certain result of treatment to the infection of TMV, disease index contrast reduces, its relative control effect is respectively 14.6% and 14.0%, and fusion rotein Penharpin infects the relative control effect of tobacco of TMV a little more than exciton Harpin to treatment.

Table 4 fusion rotein Penharpin measures the therapeutic action that tobacco infects tobacco mosaic virus (TMV)

The allergometry of embodiment 10 fusion rotein Penharpin evoking tobaccos

Adopt the blade puncture method to measure the anaphylaxis of fusion rotein Penharpin evoking tobacco.Stainless filiform needle cotton ball soaked in alcohol wiping, and calcination on spirit lamp, at tobacco surface puncture aperture, the sample 20 μ l with handling well are added in respectively on the above-mentioned aperture after cooling, and controlling water stain spot diameter is 2cm, indicates each hole processing.Adopt recombination engineering strain E.coli OrigamiB (DE3) pLysS (pET-pen-hrp) through abduction delivering, the extracting solution sample of preparation fusion rotein Penharpin.Through abduction delivering, prepare exciton Harpin extracting solution sample with E.coliOrigamiB (DE3) pLysS (pET-hrp).If E.coli OrigamiB (DE3) pLysS (pET) is through the prepared extracting solution sample of abduction delivering, and PBS (5mmol/L pH6.5) is contrast.Extracting solution sample, exciton Harpin extracting solution sample, E.coli OrigamiB (DE3) pLysS (pET) extracting solution sample and the PBS sample of above-mentioned fusion rotein Penharpin put in puncture place respectively.Tobacco is put 20 ℃ of-25 ℃ of hot-house cultures, respectively at observing blade reaction and level of response behind 12h, 24h, 36h and the 48h.

Behind the 12h, atrophy occurs around the hole of fusion rotein Penharpin and exciton Harpin sample puncture point sample, occur behind the 24h subsiding, occur withered spot behind the 36h, and contrast PBS does not have this phenomenon.Fusion rotein Penharpin induces the anaphylaxis of generation to the results are shown in Figure 10 on tobacco leaf.Test-results shows that fusion rotein Penharpin and exciton Harpin all can cause the anaphylaxis of tobacco.Fusion rotein Penharpin and exciton Harpin sample preparation group are compared, the anaphylaxis that fusion rotein Penharpin treatment group is caused is strong than the level of response of exciton Harpin treatment group, and E.coli OrigamiB (DE3) pLysS (pET) extracting solution sample preparation group and PBS treatment group are all reactionless.

Embodiment 11 fusion rotein Penharpin are to the inducing action of defensive material

Peroxidase (POD) and superoxide-dismutase (SOD) all are the enzymes that plays an important role in the plant defense, by measuring POD and SOD, determine the inducing action of fusion rotein Penharpin to defensive Substance P OD and SOD in the tobacco leaf.

1. sample preparation

Get the tobacco of three strain health, and smear three groups of sample: A, PBS damping fluid respectively; B, 2pmol/mL exciton Harpin sample; C, 2pmol/mL fusion rotein Penharpin.Smearing back 0h, 2h, 4h, 6h, 8h, 10h, 12h, 14h gathers the tobacco leaf sample, weighs, and places the EP pipe, and-20 ℃ of preservations are standby.

2. the active mensuration of peroxidase (POD)

Carry out (Hydo H et al.1971) with reference to the Hydo method.Adding 100 μ l50mM pH6.8 PBS in sample EP pipe grinds.4 ℃, the centrifugal 5min of 12000rpm, supernatant is enzyme extract.Reaction system is: 15 μ l enzyme extracts, 300 μ l 0.3%H2O2,285 μ l, 0.2% methyl catechol, 300 μ l0.1M pH6.8 PBS.Set contrast is not enzyme-added, adds pH6.8 PBS.25 ℃ of water-bath 10min, ice bath immediately after the reaction adds 300 μ l, 20% trichoroacetic acid(TCA) termination reaction.Survey OD450, and record.

After tobacco leaf was smeared processing through fusion rotein Penharpin, peroxidase (POD) is active to be increased.Peroxidase (POD) determination of activity the results are shown in Figure 11.Tobacco leaf POD activity 4h after handling through fusion rotein Penharpin promptly begins to raise, and reaches peak value when 10h, is about 1.8 times of initial value, and enzyme value alive falls back near initial level during to 14h.The activity of the blade POD that exciton Harpin handles also reaches peak value at 10h, is about 1.5 times of initial value.The no considerable change alive of the enzyme of PBS treatment group.Fusion rotein Penharpin treatment group is compared with exciton Harpin treatment group, and the POD enzyme work of the blade of fusion rotein Penharpin treatment group all is higher than exciton Harpin treatment group at each time point.

3. the active mensuration of superoxide-dismutase (SOD)

Adopt NBT (chlorination nitro nitrogen blue tetrazole) photoreduction method, measure the activity of superoxide-dismutase (SOD).Adding 100 μ l 50mM pH7.8 PBS damping fluids in sample EP pipe grinds.4 ℃ of centrifugal 5min of 12000rpm.Supernatant is enzyme extract.Reaction system is: 10 μ l enzyme extracts; 60 μ l 220mM methionine(Met)s; 60 μ l 1.25mM NBT; 60 μ l 0.33mM riboflavin; 810 μ l pH7.8 PBS.Set contrast is not enzyme-added, adds pH7.8 PBS damping fluid.25 ℃, 4000lux illumination is reaction 20min down, dark immediately termination reaction after the reaction.Survey OD570, and record.

After tobacco leaf was smeared processing through fusion rotein Penharpin, the activity of superoxide-dismutase (SOD) increased.Fusion rotein Penharpin induces SOD, and the SOD determination of activity the results are shown in Figure 12.SOD promptly begins to raise handling back 4h through fusion rotein Penharpin, reaches peak value when 6h, and for initial value 1.5 times fall after rise then gradually, and the enzyme value of living falls back near initial level during to 14h.The activity of the blade SOD that exciton Harpin handles reaches peak value at 10h, is about 1.2 times of initial value.The enzyme of PBS treatment group no obvious variation alive.Compare with exciton Harpin treatment group, the SOD enzyme of the blade of fusion rotein Penharpin treatment group is lived and is reached maximum within a short period of time.

SEQUENCE?LISTING

(1) general information:

(i) denomination of invention: fusion rotein Penharpin and preparation method and purposes

(ii) sequence number: 6

(2) information of SEQ ID No.1:

＜110〉Wuhan University

＜120〉fusion rotein Penharpin and preparation method and purposes

＜130〉fusion rotein Penharpin nucleotide sequence

<160>2

<170>PatentIn?version?3.1

<210>1

<211>1422

<212>DNA

＜213〉recombinant DNA

<220>

<221>CDS

<222>(1)..(1422)

<223>

<220>

<221>pen?gene

<222>(1)..(153)

<223>

<220>

<221>linker?DNA

<222>(154)..(198)

<223>

<220>

<221>hrp?gene

<222>(199)..(1422)

<223>

<400>1

tac?agg?ggc?ggt?tac?aca?ggc?ccg?ata?ccc?agg?cca?cca?ccc?att?gga 48

Tyr?Arg?Gly?Gly?Tyr?Thr?Gly?Pro?Ile?Pro?Arg?Pro?Pro?Pro?Ile?Gly

1 5 10 15

aga?cca?ccg?ttc?aga?cct?gtt?tgc?aat?gca?tgc?tac?aga?ctt?tcc?gtc 96

Arg?Pro?Pro?Phe?Arg?Pro?Val?Cys?Asn?Ala?Cys?Tyr?Arg?Leu?Ser?Val

20 25 30

tca?gat?gct?cgc?aat?tgc?tgc?atc?aag?ttc?gga?agc?tgt?tgt?cac?tta 144

Ser?Asp?Ala?Arg?Asn?Cys?Cys?Ile?Lys?Phe?Gly?Ser?Cys?Cys?His?Leu

35 40 45

gta?aaa?gga?ggt?ggc?tct?gga?tct?ggc?ggt?tct?tct?aga?ggt?ggc?tct 192

Val?Lys?Gly?Gly?Gly?Ser?Gly?Ser?Gly?Gly?Ser?Ser?Arg?Gly?Gly?Ser

50 55 60

gga?tct?atg?cgg?ggt?tct?cat?cat?cat?cat?cat?cat?ggt?atg?gct?agc 240

Gly?Ser?Met?Arg?Gly?Ser?His?His?His?His?His?His?Gly?Met?Ala?Ser

65 70 75 80

atg?act?ggt?gga?cag?caa?atg?ggt?cgg?gat?ctg?tac?gac?gat?gac?gat 288

Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Asp?Leu?Tyr?Asp?Asp?Asp?Asp

85 90 95

aag?gat?cca?acc?ctt?atg?cag?agt?ctc?agt?ctt?aac?agc?atg?agt?tcg 336

Lys?Asp?Pro?Thr?Leu?Met?Gln?Ser?Leu?Ser?Leu?Asn?Ser?Met?Ser?Ser

100 105 110

ttg?caa?acc?tct?gca?tca?ttg?ttc?ccc?gtg?tcg?ctc?aac?agc?gat?gtg 384

Leu?Gln?Thr?Ser?Ala?Ser?Leu?Phe?Pro?Val?Ser?Leu?Asn?Ser?Asp?Val

115 120 125

agc?gcc?aac?acc?agc?act?tcc?agc?aaa?gag?ctc?aag?gct?gtg?atc?gat 432

Ser?Ala?Asn?Thr?Ser?Thr?Ser?Ser?Lys?Glu?Leu?Lys?Ala?Val?Ile?Asp

130 135 140

cag?ctg?gtt?cag?gcg?ctg?acc?caa?agt?ggg?cag?ctc?gat?gaa?acc?tca 480

Gln?Leu?Val?Gln?Ala?Leu?Thr?Gln?Ser?Gly?Gln?Leu?Asp?Glu?Thr?Ser

145 150 155 160

ccg?ctc?ggc?aaa?atg?ctc?gcc?aag?gcc?atg?gct?gcg?gat?ggc?aag?tcg 528

Pro?Leu?Gly?Lys?Met?Leu?Ala?Lys?Ala?Met?Ala?Ala?Asp?Gly?Lys?Ser

165 170 175

gct?aac?agc?atc?gat?gac?atc?act?gca?tcg?ctc?gac?aag?ctg?atc?cac 576

Ala?Asn?Ser?Ile?Asp?Asp?Ile?Thr?Ala?Ser?Leu?Asp?Lys?Leu?Ile?His

180 185 190

gaa?aag?ctc?ggc?aac?aat?ttc?ggt?gcc?tct?gcc?ggc?atc?ggc?gcg?ggt 624

Glu?Lys?Leu?Gly?Asn?Asn?Phe?Gly?Ala?Ser?Ala?Gly?Ile?Gly?Ala?Gly

195 200 205

ggc?ggt?ggc?ggt?ggc?att?ggc?ggg?gcg?ggt?tct?ggt?tcg?ggt?gtc?ggt 672

Gly?Gly?Gly?Gly?Gly?Ile?Gly?Gly?Ala?Gly?Ser?Gly?Ser?Gly?Val?Gly

210 215 220

ggc?ggt?ctg?agc?agc?gac?gcg?ggt?gcc?ggg?caa?tcc?gat?ctg?atg?agc 720

Gly?Gly?Leu?Ser?Ser?Asp?Ala?Gly?Ala?Gly?Gln?Ser?Asp?Leu?Met?Ser

225 230 235 240

cag?gtc?ctg?aac?ggc?ctc?ggc?aaa?gcc?gtg?ctg?gac?gat?ctg?ctg?aca 768

Gln?Val?Leu?Asn?Gly?Leu?Gly?Lys?Ala?Val?Leu?Asp?Asp?Leu?Leu?Thr

245 250 255

ccg?agt?ggt?gaa?ggc?gga?aca?acc?ttt?tcc?agt?gat?gac?atg?ccg?acc 816

Pro?Ser?Gly?Glu?Gly?Gly?Thr?Thr?Phe?Ser?Ser?Asp?Asp?Met?Pro?Thr

260 265 270

ctg?gaa?aaa?gtc?gcc?cgg?ttc?atg?gac?gac?aac?aag?gcc?cag?ttc?cct 864

Leu?Glu?Lys?Val?Ala?Arg?Phe?Met?Asp?Asp?Asn?Lys?Ala?Gln?Phe?Pro

275 280 285

act?cgg?gac?ggc?ggc?tcg?tgg?atg?aac?gag?ctg?aag?gaa?gac?aat?ggc 912

Thr?Arg?Asp?Gly?Gly?Ser?Trp?Met?Asn?Glu?Leu?Lys?Glu?Asp?Asn?Gly

290 295 300

ctg?tat?gca?cag?gaa?acc?gct?cag?ttt?cgt?tcg?gct?ctc?gac?gtc?att 960

Leu?Tyr?Ala?Gln?Glu?Thr?Ala?Gln?Phe?Arg?Ser?Ala?Leu?Asp?Val?Ile

305 310 315 320

ggt?caa?cag?ctc?ggc?cag?caa?caa?ggt?gat?gcc?agt?ggc?gtt?acc?agt 1008

Gly?Gln?Gln?Leu?Gly?Gln?Gln?Gln?Gly?Asp?Ala?Ser?Gly?Val?Thr?Ser

325 330 335

ggc?ggc?ggt?ctg?ggt?tcg?ccc?gtg?agt?gac?agc?tcc?ctg?ggt?aat?cct 1056

Gly?Gly?Gly?Leu?Gly?Ser?Pro?Val?Ser?Asp?Ser?Ser?Leu?Gly?Asn?Pro

340 345 350

gca?atc?gat?gcc?aac?aca?ggt?ccc?gcg?gcc?aat?ggc?aat?gcc?agc?gtc 1104

Ala?Ile?Asp?Ala?Asn?Thr?Gly?Pro?Ala?Ala?Asn?Gly?Asn?Ala?Ser?Val

355 360 365

gac?gta?ggt?caa?ctg?atc?ggt?caa?ctc?atc?gac?cgt?ggt?ttg?cag?tcg 1152

Asp?Val?Gly?Gln?Leu?Ile?Gly?Gln?Leu?Ile?Asp?Arg?Gly?Leu?Gln?Ser

370 375 380

gtt?tcg?tcg?ggt?ggc?ggt?ctg?ggt?aca?ccg?gtc?gac?aat?tcc?acg?cag 1200

Val?Ser?Ser?Gly?Gly?Gly?Leu?Gly?Thr?Pro?Val?Asp?Asn?Ser?Thr?Gln

385 390 395 400

ccg?aca?ggt?ggc?acg?cca?gcg?gct?aac?ccg?acg?ggc?aac?gtg?tcc?aat 1248

Pro?Thr?Gly?Gly?Thr?Pro?Ala?Ala?Asn?Pro?Thr?Gly?Asn?Val?Ser?Asn

405 410 415

cag?gac?ctg?ggt?caa?ctg?ctg?aac?ggc?ttg?ctg?caa?cgc?ggg?ctg?gaa 1296

Gln?Asp?Leu?Gly?Gln?Leu?Leu?Asn?Gly?Leu?Leu?Gln?Arg?Gly?Leu?Glu

420 425 430

gcg?acg?ctt?cag?gat?gct?ggc?aac?acc?ggc?gcc?gac?ctg?caa?tcg?agc 1344

Ala?Thr?Leu?Gln?Asp?Ala?Gly?Asn?Thr?Gly?Ala?Asp?Leu?Gln?Ser?Ser

435 440 445

gct?gcg?caa?gtg?gca?gct?cag?ctg?atc?aat?gcg?ctg?ttg?caa?ggc?acc 1392

Ala?Ala?Gln?Val?Ala?Ala?Gln?Leu?Ile?Asn?Ala?Leu?Leu?Gln?Gly?Thr

450 455 460

aat?aac?cag?act?aac?cag?gct?gtg?gcc?tga 1422

Asn?Asn?G1n?Thr?Asn?Gln?Ala?Val?Ala

465 470

<210>2

<211>473

<212>PRT

＜213〉recombinant DNA

<400>2

Tyr?Arg?Gly?Gly?Tyr?Thr?Gly?Pro?Ile?Pro?Arg?Pro?Pro?Pro?Ile?Gly

1 5 10 15

Arg?Pro?Pro?Phe?Arg?Pro?Val?Cys?Asn?Ala?Cys?Tyr?Arg?Leu?Ser?Val

20 25 30

Ser?Asp?Ala?Arg?Asn?Cys?Cys?Ile?Lys?Phe?Gly?Ser?Cys?Cys?His?Leu

35 40 45

Val?Lys?Gly?Gly?Gly?Ser?Gly?Ser?Gly?Gly?Ser?Ser?Arg?Gly?Gly?Ser

50 55 60

Gly?Ser?Met?Arg?Gly?Ser?His?His?His?His?His?His?Gly?Met?Ala?Ser

65 70 75 80

Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Asp?Leu?Tyr?Asp?Asp?Asp?Asp

85 90 95

Lys?Asp?Pro?Thr?Leu?Met?Gln?Ser?Leu?Ser?Leu?Asn?Ser?Met?Ser?Ser

100 105 110

Leu?Gln?Thr?Ser?Ala?Ser?Leu?Phe?Pro?Val?Ser?Leu?Asn?Ser?Asp?Val

115 120 125

Ser?Ala?Asn?Thr?Ser?Thr?Ser?Ser?Lys?Glu?Leu?Lys?Ala?Val?Ile?Asp

130 135 140

Gln?Leu?Val?Gln?Ala?Leu?Thr?Gln?Ser?Gly?Gln?Leu?Asp?Glu?Thr?Ser

145 150 155 160

Pro?Leu?Gly?Lys?Met?Leu?Ala?Lys?Ala?Met?Ala?Ala?Asp?Gly?Lys?Ser

165 170 175

Ala?Asn?Ser?Ile?Asp?Asp?Ile?Thr?Ala?Ser?Leu?Asp?Lys?Leu?Ile?His

180 185 190

Glu?Lys?Leu?Gly?Asn?Asn?Phe?Gly?Ala?Ser?Ala?Gly?Ile?Gly?Ala?Gly

195 200 205

Gly?Gly?Gly?Gly?Gly?Ile?Gly?Gly?Ala?Gly?Ser?Gly?Ser?Gly?Val?Gly

210 215 220

Gly?Gly?Leu?Ser?Ser?Asp?Ala?Gly?Ala?Gly?Gln?Ser?Asp?Leu?Met?Ser

225 230 235 240

Gln?Val?Leu?Asn?Gly?Leu?Gly?Lys?Ala?Val?Leu?Asp?Asp?Leu?Leu?Thr

245 250 255

Pro?Ser?Gly?Glu?Gly?Gly?Thr?Thr?Phe?Ser?Ser?Asp?Asp?Met?Pro?Thr

260 265 270

Leu?Glu?Lys?Val?Ala?Arg?Phe?Met?Asp?Asp?Asn?Lys?Ala?Gln?Phe?Pro

275 280 285

Thr?Arg?Asp?Gly?Gly?Ser?Trp?Met?Asn?Glu?Leu?Lys?Glu?Asp?Asn?Gly

290 295 300

Leu?Tyr?Ala?Gln?Glu?Thr?Ala?Gln?Phe?Arg?Ser?Ala?Leu?Asp?Val?Ile

305 310 315 320

Gly?Gln?Gln?Leu?Gly?Gln?Gln?Gln?Gly?Asp?Ala?Ser?Gly?Val?Thr?Ser

325 330 335

Gly?Gly?Gly?Leu?Gly?Ser?Pro?Val?Ser?Asp?Ser?Ser?Leu?Gly?Asn?Pro

340 345 350

Ala?Ile?Asp?Ala?Asn?Thr?Gly?Pro?Ala?Ala?Asn?Gly?Asn?Ala?Ser?Val

355 360 365

Asp?Val?Gly?Gln?Leu?Ile?Gly?Gln?Leu?Ile?Asp?Arg?Gly?Leu?Gln?Ser

370 375 380

Val?Ser?Ser?Gly?Gly?Gly?Leu?Gly?Thr?Pro?Val?Asp?Asn?Ser?Thr?Gln

385 390 395 400

Pro?Thr?Gly?Gly?Thr?Pro?Ala?Ala?Asn?Pro?Thr?Gly?Asn?Val?Ser?Asn

405 410 415

Gln?Asp?Leu?Gly?Gln?Leu?Leu?Asn?Gly?Leu?Leu?Gln?Arg?Gly?Leu?Glu

420 425 430

Ala?Thr?Leu?Gln?Asp?Ala?Gly?Asn?Thr?Gly?Ala?Asp?Leu?Gln?Ser?Ser

435 440 445

Ala?Ala?Gln?Val?Ala?Ala?Gln?Leu?Ile?Asn?Ala?Leu?Leu?Gln?Gly?Thr

450 455 460

Asn?Asn?Gln?Thr?Asn?Gln?Ala?Val?Ala

465 470

(3) information of SEQ ID No.2:

＜110〉Wuhan University

＜120〉fusion rotein Penharpin and preparation method and purposes

＜130〉fusion rotein Penharpin aminoacid sequence

<160>1

<170>PatentIn?version?3.1

<210>1

<211>473

<212>PRT

＜213〉polypeptide

<220>

<221>Penharpin?PEPTIDE

<222>(1)..(473)

<223>

<220>

<221>Pen-2PEPTIDE

<222>(1)..(51)

<223>

<220>

<221>linker?PEPTIDE

<222>(52)..(66)

<223>

<220>

<221>Harpin?PEPTIDE

<222>(67)..(473)

<223>

<400>1

Tyr?Arg?Gly?Gly?Tyr?Thr?Gly?Pro?Ile?Pro?Arg?Pro?Pro?Pro?Ile?Gly

1 5 10 15

Arg?Pro?Pro?Phe?Arg?Pro?Val?Cys?Asn?Ala?Cys?Tyr?Arg?Leu?Ser?Val

20 25 30

Ser?Asp?Ala?Arg?Asn?Cys?Cys?Ile?Lys?Phe?Gly?Ser?Cys?Cys?His?Leu

35 40 45

Val?Lys?Gly?Gly?Gly?Ser?Gly?Ser?Gly?Gly?Ser?Ser?Arg?Gly?Gly?Ser

50 55 60

Gly?Ser?Met?Arg?Gly?Ser?His?His?His?His?His?His?Gly?Met?Ala?Ser

65 70 75 80

Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Asp?Leu?Tyr?Asp?Asp?Asp?Asp

85 90 95

Lys?Asp?Pro?Thr?Leu?Met?Gln?Ser?Leu?Ser?Leu?Asn?Ser?Met?Ser?Ser

100 105 110

Leu?Gln?Thr?Ser?Ala?Ser?Leu?Phe?Pro?Val?Ser?Leu?Asn?Ser?Asp?Val

115 120 125

Ser?Ala?Asn?Thr?Ser?Thr?Ser?Ser?Lys?Glu?Leu?Lys?Ala?Val?Ile?Asp

130 135 140

Gln?Leu?Val?Gln?Ala?Leu?Thr?Gln?Ser?Gly?Gln?Leu?Asp?Glu?Thr?Ser

145 150 155 160

Pro?Leu?Gly?Lys?Met?Leu?Ala?Lys?Ala?Met?Ala?Ala?Asp?Gly?Lys?Ser

165 170 175

Ala?Asn?Ser?Ile?Asp?Asp?Ile?Thr?Ala?Ser?Leu?Asp?Lys?Leu?Ile?His

180 185 190

Glu?Lys?Leu?Gly?Asn?Asn?Phe?Gly?Ala?Ser?Ala?Gly?Ile?Gly?Ala?Gly

195 200 205

Gly?Gly?Gly?Gly?Gly?Ile?Gly?Gly?Ala?Gly?Ser?Gly?Ser?Gly?Val?Gly

210 215 220

Gly?Gly?Leu?Ser?Ser?Asp?Ala?Gly?Ala?Gly?Gln?Ser?Asp?Leu?Met?Ser

225 230 235 240

Gln?Val?Leu?Asn?Gly?Leu?Gly?Lys?Ala?Val?Leu?Asp?Asp?Leu?Leu?Thr

245 250 255

Pro?Ser?Gly?Glu?Gly?Gly?Thr?Thr?Phe?Ser?Ser?Asp?Asp?Met?Pro?Thr

260 265 270

Leu?Glu?Lys?Val?Ala?Arg?Phe?Met?Asp?Asp?Asn?Lys?Ala?Gln?Phe?Pro

275 280 285

Thr?Arg?Asp?Gly?Gly?Ser?Trp?Met?Asn?Glu?Leu?Lys?Glu?Asp?Asn?Gly

290 295 300

Leu?Tyr?Ala?Gln?Glu?Thr?Ala?Gln?Phe?Arg?Ser?Ala?Leu?Asp?Val?Ile

305 310 315 320

Gly?Gln?Gln?Leu?Gly?Gln?Gln?Gln?Gly?Asp?Ala?Ser?Gly?Val?Thr?Ser

325 330 335

Gly?Gly?Gly?Leu?Gly?Ser?Pro?Val?Ser?Asp?Ser?Ser?Leu?Gly?Asn?Pro

340 345 350

Ala?Ile?Asp?Ala?Asn?Thr?Gly?Pro?Ala?Ala?Asn?Gly?Asn?Ala?Ser?Val

355 360 365

Asp?Val?Gly?Gln?Leu?Ile?Gly?Gln?Leu?Ile?Asp?Arg?Gly?Leu?Gln?Ser

370 375 380

Val?Ser?Ser?Gly?Gly?Gly?Leu?Gly?Thr?Pro?Val?Asp?Asn?Ser?Thr?Gln

385 390 395 400

Pro?Thr?Gly?Gly?Thr?Pro?Ala?Ala?Asn?Pro?Thr?Gly?Asn?Val?Ser?Asn

405 410 415

Gln?Asp?Leu?Gly?Gln?Leu?Leu?Asn?Gly?Leu?Leu?Gln?Arg?Gly?Leu?Glu

420 425 430

Ala?Thr?Leu?Gln?Asp?Ala?Gly?Asn?Thr?Gly?Ala?Asp?Leu?Gln?Ser?Ser

435 440 445

Ala?Ala?Gin?Val?Ala?Ala?Gln?Leu?Ile?Asn?Ala?Leu?Leu?Gln?Gly?Thr

450 455 460

Ash?Ash?Gln?Thr?Asn?Gln?Ala?Val?Ala

465 470

(4) information of SEQ ID No.3:

＜110〉Wuhan University

＜120〉fusion rotein Penharpin and preparation method and purposes

＜130〉primer PEN1 nucleotide sequence

<160>1

<170>PatentIn?version?3.1

<210>1

<211>26

<212>DNA

＜213〉oligonucleotide

<400>1

gtgaattcta?caggggcggt?tacaca 26

(5) information of SEQ ID No.4:

＜110〉Wuhan University

＜120〉fusion rotein Penharpin and preparation method and purposes

＜130〉primer PEN2 nucleotide sequence

<160>1

<170>PatentIn?version?3.1

<210>1

<211>48

<212>DNA

＜213〉oligonucleotide

<400>1

ggtctagaag?aaccgccaga?tccagagcca?cctcctttta?ctaagtga 48

(6) information of SEQ ID No.5:

＜110〉Wuhan University

＜120〉fusion rotein Penharpin and preparation method and purposes

＜130〉primer HRP1 nucleotide sequence

<160>1

<170>PatentIn?version?3.1

<210>1

<211>43

<212>DNA

＜213〉oligonucleotide

<400>1

ggtctagagg?tggctctgga?tctatgcggg?gttctcatca?tca 43

(7) information of SEQ ID No.6:

＜110〉Wuhan University

＜120〉fusion rotein Penharpin and preparation method and purposes

＜130〉primer HRP2 nucleotide sequence

<160>1

<170>PatentIn?version?3.1

<210>1

<211>38

<212>DNA

＜213〉oligonucleotide

<400>1

ggctgcagaa?gctttcaggc?cacagcctgg?ttagtctg 38

Claims (15)

1. fusion rotein Penharpin, it is characterized in that this albumen has aminoacid sequence and the connection peptides sequence between the aminoacid sequence of the aminoacid sequence of prawn peptide Pen-2 and exciton Harpin of aminoacid sequence, the exciton Harpin of prawn peptide Pen-2.

2. protein according to claim 1 is characterized in that: described connection peptides sequence is made of 1-20 amino acid.

3. fusion rotein Penharpin according to claim 1 is characterized in that: the aminoacid sequence of described fusion rotein is shown in SEQ ID No.2.

4. an isolated DNA molecule is characterized in that: the described fusion rotein Penharpin of this dna molecule encode claim 1.

5. dna molecular according to claim 4 is characterized in that: the nucleotide sequence of described dna molecular is shown in SEQ ID No.1.

6. a carrier is characterized in that comprising the described dna molecular of claim 4.

7. carrier according to claim 6 is characterized in that comprising recombinant expression plasmid carrier pET-pen-hrp.

8. a host cell is characterized in that comprising the described carrier of claim 6.

9. host cell according to claim 8 is characterized in that comprising a kind of recombination engineering strain Escherichia coli OrigamiB (DE3) pLysS (pET-pen-hrp), CCTCC No:M208071.

10. method that produces the described fusion rotein Penharpin of claim 1 is characterized in that this method may further comprise the steps:

Cultivate the described host cell of claim 8, can express described fusion rotein condition, comprising induce or non-inductive condition under, express described fusion rotein Penharpin, then separation, this fusion rotein of purifying Penharpin.

11. a pharmaceutical composition is characterized in that said composition comprises the described fusion rotein Penharpin of claim 1 of effective dose.

12. described fusion rotein Penharpin of claim 1 or the application of the described pharmaceutical composition of claim 11 in controlling plant diseases.

13. the application of fusion rotein Penharpin in the medicine of preparation treatment or prevention bacterial-infection resisting.

14. the application of fusion rotein Penharpin in the medicine of preparation treatment or prevention anti-fungal infection.

15. the application of fusion rotein Penharpin in the medicine of preparation treatment or prevention anti-virus infection.

Images