CN116121151A - Aspergillus niger mutant strain ANPEP15M1 and application thereof - Google Patents

Abstract

The invention relates to the field of genetically engineered bacteria, in particular to an Aspergillus niger mutant strain ANPEP15M1 and application thereof. The mutant strain ANPEP15M1 has the accession number GDMCCNO:63131. the Aspergillus niger mutant strain can obviously improve the yield of acid protease, the biomass is obviously increased in the fermentation process, and after the recombinant engineering bacteria are fermented and cultured for 99 hours in a 7L fermentation tank by using a fermentation medium, the total enzyme activity of the acid protease of the recombinant strain reaches 26255U/mL, the fermentation efficiency is obviously superior to that of the existing production strain under the same condition, the strain is suitable for industrial production of the acid protease, the production efficiency is effectively improved, and the market prospect is wide.

Description

Aspergillus niger mutant strain ANPEP15M1 and application thereof

Technical Field

The invention relates to the field of genetically engineered bacteria, in particular to an Aspergillus niger mutant strain ANPEP15M1 and application thereof.

Background

Acidic proteases refer to hydrolases that have a lower pH optimum and hydrolyze proteins. The current commercial acid protease producing strains are mainly Aspergillus niger, aspergillus niger megaspore variety, aspergillus saitoi, rhizopus, duPont Penicillium, toxoplasma erythropolis, mucor minutissima, etc.

Aspergillus acid proteases (EC 3.4.23.18,EC 3.4.23.19) are a class of enzymes suitable for protein breakdown in an acidic environment (pH 2.0-5.0), including both Aspergillus protease I (Aspergillopepsin I) and Aspergillus protease II (Aspergillopepsin II). Because the aspergillus acid proteinase can improve the digestibility of the monogastric animals, especially young animals, on the protein component of the feed, and promote the growth and development of the monogastric animals, especially young animals. The conditions of acidic protease for decomposing protein are similar to the environment of digestive system in animal body, so that the digestion and absorption rate of protein can be improved by improving the hydrolysis efficiency of protein to animal body, so as to obtain good feeding effect. Meanwhile, with the popularization of biotechnology and the intensive research of synthetic biology, the acid protease is obtained through an industrial fermentation method, so that the acid protease is suitable for a natural enzyme preparation as a feed additive. On the other hand, the acid protease is added into animal daily ration as a feed additive, so that the feed conversion rate can be obviously improved, the waste of the feed is reduced, the pollution to the environment (the emission of nitrogen) is reduced, and the condition of protein feed resource deficiency in China is relieved.

The enzyme yield of the acid protease production strain is still not very high at present, so that the production cost of the enzyme is high, and the wide application of the acid protease is limited to a certain extent. The production strain or production method with higher digging yield and higher enzyme activity is highly demanded, and in addition, the acid protease is also beneficial to being widely applied to the fields of brewing industry, leather industry, clinical medicine, food industry and the like.

Disclosure of Invention

The invention aims to provide an Aspergillus niger mutant strain with high yield of acid protease.

It is another object of the present invention to provide the use of the above-mentioned Aspergillus niger mutant strain.

It is a further object of the present invention to provide a preparation comprising the above-mentioned Aspergillus niger mutant strain, or an acid protease produced by the above-mentioned Aspergillus niger mutant strain.

It is a further object of the present invention to provide a process for preparing an acid protease.

The Aspergillus niger strain is a mutant strain screened by a recombinant acid protease expression strain through an ultraviolet mutagenesis method, can remarkably improve the yield of the acid protease, and lays a foundation for low-cost and large-scale production of the acid protease.

The Aspergillus niger (Aspergillus niger) mutant strain ANPEP15M1, which is highly acid protease-producing according to the invention, was deposited at the Guangdong province microorganism strain collection (GDMCC) on day 1 and 11 of 2023 (address: building 5, post code 510070, 100. Hirship., guangzhou, inc.), accession number GDMCC NO:63131.

the invention provides a microbial preparation containing the aspergillus niger strain with high acid proteinase yield.

The invention provides application of the aspergillus niger strain for producing the acid protease in the production of the acid protease.

According to the method for preparing an acid protease of the present invention, the method comprises the step of fermenting the Aspergillus niger (Aspergillus niger) mutant strain ANPEP15M1 of the high acid protease.

According to the method for preparing the acid protease, fermentation is carried out at 30 ℃, ammonia is introduced when the pH value is reduced to 5.0 in the fermentation process, the pH value is controlled to be 4.8-5.2 by feeding ammonia water, the ventilation rate is 8L/min, and the rotating speed is high: 500-1000 rpm, and the DE value of the feed is controlled to be 10; and (3) controlling the DE value of the feed fed to the tank to be 20 after 36 hours, and then gradually increasing the rotating speed and culturing for 99 hours.

The beneficial effects of the invention are as follows:

the Aspergillus niger mutant strain can obviously improve the yield of acid protease, the biomass is obviously increased in the fermentation process, and after the recombinant engineering bacteria are fermented and cultured for 99 hours in a 7L fermentation tank by using a fermentation medium, the total enzyme activity of the acid protease of the recombinant strain reaches 26255U/mL, the fermentation efficiency is obviously superior to that of the existing production strain under the same condition, the strain is suitable for industrial production of the acid protease, the production efficiency is effectively improved, and the market prospect is wide.

Drawings

FIG. 1 shows a map of the recombinant expression acidic protease vector pAN-EXP-ANPEP of the present invention;

FIG. 2 shows a graph for verifying genetic stability of a high-yield acid protease Aspergillus niger ANPEP-15M1 strain;

FIG. 3 shows graphs of fermentation enzyme activity of high yield acid proteases ANPEP15 and ANPEP15M1 Aspergillus niger strains.

Aspergillus niger strain ANPEP15M1 was deposited with the microorganism culture Collection (GDMCC) of Guangdong, 1.11.2023 (address: building 5, 30, guangzhou Mitsui, 100, md., post code 510070) under the accession number GDMCC No:63131.

Detailed Description

The conception and the technical effects produced by the present invention will be clearly and completely described in conjunction with the embodiments below to fully understand the objects, features and effects of the present invention. It is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments, and that other embodiments obtained by those skilled in the art without inventive effort are within the scope of the present invention based on the embodiments of the present invention.

Molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the "guidelines for molecular cloning experiments" (third edition) j. Sambrook, or according to the kit and product instructions; the reagents and biological materials, unless otherwise specified, are commercially available.

The procedure and method for constructing the vector of the present invention are those conventionally used in the field of genetic engineering.

Definition:

"Gene" refers to a DNA fragment involved in the production of a polypeptide, including regions preceding and following the coding region, as well as intervening sequences (introns) between individual coding fragments (exons).

In this specification, an "expression vector" refers to a DNA construct comprising a DNA coding sequence operably linked to one or more suitable control sequences capable of effecting the expression of the coding sequence in a host. Such control sequences include promoters to effect transcription, optional operator sequences to control such transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences to control termination of transcription and translation. The vector may be a plasmid, phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or, in some cases, may integrate itself into the genome. Plasmids are the most commonly used form of expression vector. However, the present invention is intended to include other forms of expression vectors that serve equivalent functions, which are or will be known in the art.

"promoter" refers to regulatory sequences involved in binding RNA polymerase to initiate transcription of a gene. The promoter may be an inducible promoter or a constitutive promoter. A non-limiting example of an inducible promoter useful in the present invention is a glucoamylase promoter, which is an inducible promoter.

The term "host cell" refers to a cell or cell line into which a recombinant expression vector for polypeptide production can be transfected to express a polypeptide. Fungal cells can be transformed in a manner known per se by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall. The recombinant expression vector may be any vector, such as a plasmid or virus, which can be conveniently subjected to recombinant DNA procedures and results in expression of the nucleotide sequence. The choice of vector will generally depend on the compatibility of the vector with the production host into which the vector is to be introduced. The vector may be a linear or closed loop plasmid. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for ensuring self-replication. Alternatively, the vector may be a vector that is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated when introduced into the production host.

According to the invention, a vector comprising a polynucleotide sequence encoding an acid protease is integrated into a host cell. The host cell may be selected from any suitable microorganism, such as bacteria, fungi, yeast and algae.

The term "selectable marker" or "selectable marker" refers to a gene that can be expressed in a host cell to facilitate selection of those hosts that contain the introduced nucleic acid or vector.

The host cells are cultured in a nutrient medium suitable for producing the polypeptides using methods known in the art. For example, the cells may be cultured in a suitable medium and under conditions that allow expression and/or isolation of the polypeptide by shake flask culture, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentation) in a laboratory or industrial fermentor.

The invention provides a filamentous fungus expression host strain for high yield of acid protease.

The filamentous fungi have strong protein secretion capacity, the total extracellular protein amount secreted by certain filamentous fungi reaches 40g/L, and the high-efficiency protein secretion capacity is incomparable with prokaryotic expression hosts such as bacteria. Filamentous fungi also possess various post-translational processing capabilities, such as glycosylation modifications, signal peptide cleavage, disulfide bond formation, and the like. Filamentous fungi such as Aspergillus oryzae, aspergillus niger and Trichoderma reesei are food safety strains and are recognized by the U.S. food and drug administration as strain GRAS (Generally recognized as safe). In the production of industrial enzymes, filamentous fungus fermentation is the core, and nearly 40% of enzyme production from filamentous fungus fermentation is the international market enzyme preparations.

The acid proteases described herein may be used as feed additives or in the preparation of feed. Depending on the use and/or mode of application and/or mode of administration, the feed may be in solution or in solid or semi-solid form. In some embodiments of the present invention, when the acid protease is used as a feed additive, at least one enzyme may be additionally added, and the at least one enzyme may be selected from, but is not limited to, enzymes such as alpha-amylase, amyloglucosidase, phytase, pullulanase, beta-glucanase, cellulase, xylanase, and the like.

The high yield acid protease strains or acid proteases of the invention may be used for the production of protein hydrolysates from, for example, vegetable proteins such as soy, pea, lupin or rapeseed proteins, milk such as casein, meat proteins or fish proteins. The enzyme(s) described herein may be used in protein hydrolysates to improve solubility, homogeneity, or fermentability, reduce antigenicity, reduce bitterness of hydrolysates, or for other purposes in the manufacture of food, feed, ethanol production, or pharmaceutical products.

Experimental materials and reagents:

and (3) strain: aspergillus niger (Aspergillus niger) strain.

Instrument and apparatus:

constant temperature incubator: LHS-150SC in a Shanghai-constant temperature incubator; constant temperature shaking table: hua Li reaches a constant temperature shaking table HZ2410K6; ultra clean bench: suzhou clean bench SW-CJ2FD; shanghai stirring type bioreactor: bairens Biochemical Equipment Co.Ltd.

Configuration of the medium and reagents:

TZ solid medium: beef extract (Guangdong Cryptographic microorganism Co., ltd.) 8g/L, yeast extract 2g/L, peptone 5g/L, naCl 2g/L, starch 10g/L, agar 17g/L.pH 5.8.

CD medium: sucrose 30g/L, naNO ₃ 2g/L，K ₂ HPO ₄ 1g/L，MgSO ₄ 0.5g/L，KCl 0.5g/L，FeSO ₄ 0.01g/L, or 15g/L agar, pH 7.3.

Regeneration medium plates: 8g/L of nutrient juice powder, 2g/L of yeast extract, 5g/L of peptone, 2g/L of NaCl, 10g/L of starch, 17g/L of agar, pH 5.8 and 0.8M KCl (g/L) or sorbitol 1M.

Shake flask fermentation medium: maltodextrin 80g/L, bean cake powder 20g/L, corn steep liquor 30mL/L, pH5.5, triangular flask liquid volume 100mL/500mL, and 115 ℃ sterilization 20min.

Seed pot medium: maltodextrin 80g/L, bean cake powder 40g/L, corn steep liquor 10mL/L, pH5.5, and sterilizing at 121deg.C for 30min.

Fermentation tank medium: maltodextrin 40g/L, bean cake powder 20g/L, corn steep liquor 20mL/L, (NH) ₄ )2SO ₄ 4g/L, calcium chloride: 2g/L, disodium hydrogen phosphate: 2g/L, potassium dihydrogen phosphate: 3g/L, defoamer, controlling the pH of the fermentation tank to be 5.2-5.5, and sterilizing at 121 ℃ for 35min.

Cleavage enzyme solution: 1% lywallase, dissolved with 1M sorbitol.

KCl solution: 0.6M KCl solution.

Sorbitol solution: 1M sorbitol.

S/C solution: 1M sorbitol, 50mM CaCl ₂ 。

PEG solution: 25% PEG8000, 50mM CaCl ₂ ，10mM Tris-Hcl，pH 7.5。

Fulin reagent: sodium tungstate (Na) was added to a 2000mL grind reflux apparatus ₂ WO ₄ 2H 20) 100g, sodium molybdate (Na ₂ MO ₂ 2H 20) 25g, 700mL of water, 50mL of 85% phosphoric acid, 100mL of concentrated hydrochloric acid, and reflux with slow fire for 10H. Taking down reflux condenser, adding 50g of lithium sulfate, 50mL of water and a few drops of concentrated bromine water (99%) and boiling for 15min to remove excessive bromine (green after cooling, bromine water needs to be added again and excessive bromine needs to be removed by boiling), cooling, adding water to 1000mL, mixing uniformly, filtering, and storing the prepared reagent in a brown bottle until the reagent is golden yellow. When in useOne part of the furin reagent is mixed with two parts of water and shaken well.

0.4mol/L trichloroacetic acid solution: 65.4g of trichloroacetic acid was weighed and dissolved in 1000mL of distilled water.

0.4mol/L sodium carbonate solution: 42.4g of anhydrous sodium carbonate is weighed, heated and dissolved by a small amount of distilled water, and then dissolved to 1000mL.

0.1mol/L lactic acid buffer (ph=3.5): solution A (0.1 mol/L lactic acid solution): 10.6g of 80-90% lactic acid is weighed and dissolved in a small amount of distilled water, and the volume is fixed to 1000mL. Liquid B (0.1 mol/L sodium lactate solution): 16.0g of 70% sodium lactate is weighed and dissolved in a small amount of distilled water, and the volume is fixed to 1000mL. When in use, two parts of A solution and one part of B solution are taken and evenly mixed, and the buffer solution with the pH value of 3.5 is obtained.

2% casein (casein) solution: 2g of casein is weighed, firstly, a small amount of 0.1mol/L lactic acid is used for wetting, then 4-5mL of concentrated lactic acid solution is added, then 80mL of lactic acid buffer solution with the pH of 0.1mol/L and 3.5 is used for diluting, heating is carried out in a boiling water bath, stirring is carried out at all times to dissolve, and after cooling, 0.1mol/LpH =3.5 of lactic acid buffer solution is used for fixing the volume to 100mL.

100. Mu.g/mL L-tyrosine standard solution: a. weighing 0.100g of L-tyrosine which is dried to constant weight at 105 ℃ in advance, accurately obtaining 0.002g, dissolving the L-tyrosine by 60mL of 0.2mol hydrochloric acid, and then fixing the volume to 100mL to obtain 1mg/mL tyrosine standard solution; b. 10.00mL of 1mg/mL tyrosine standard solution is sucked up, and the volume is fixed to 100mL by 0.2mol/L hydrochloric acid, and the concentration of the solution is 100 mug/mL.

EXAMPLE 1 cloning expression of the acid protease ANPEP Gene of Aspergillus niger Aspergillus niger CBS 513.88

The total genomic DNA of Aspergillus niger CBS 513.88.513.88 was extracted. And then amplifying by using the genome total DNA as a template and using the upstream primer and the downstream primer.

ANPEP-F(5’→3’)：atggtcgtcttcagcaaaaccgctg

ANPEP-R(5’←3’)：gcctgagcggcgaatcccagctta

PCR amplification conditions were 98℃for 2min; 10S at 98 ℃; 15S at 55℃and 1.5min 30 cycles at 72 ℃; and at 72℃for 5min. The size of the extension fragment is 1.2K, and the PCR amplification product is recovered by the gel recovery kit and sent to sequencing analysis. The result shows that the nucleotide sequence of the amplified product is SEQ ID NO. 1.

SEQ ID NO:1

ATGGTCGTCTTCAGCAAAACCGCTGCCCTCGTTCTGGGTCTGTCCTCCGCCGTC

TCTGCGGCGCCGGCTCCTACTCGCAAGGGCTTCACCATCAACCAGATTGCCCG

GCCTGCCAACAAGACCCGCACCATCAACCTGCCAGGCATGTACGCCCGTTCCC

TGGCCAAGTTTGGCGGTACGGTGCCCCAGAGCGTGAAGGAGGCTGCCAGCAA

GGGTAGTGCCGTGACCACGCCCCAGAACAATGACGAGGAGTACCTGACTCCCG

TCACTGTCGGAAAGTCCACCCTCCATCTGGACTTTGACACCGGATCTGCAGATC

TCTGGGTCTTCTCGGACGAGCTCCCTTCCTCGGAGCAGACCGGTCACGATCTGT

ACACGCCTAGCTCCAGCGCGACCAAGCTGAGCGGCTACACTTGGGACATCTCC

TACGGTGACGGCAGCTCGGCCAGCGGAGACGTGTACCGGGATACTGTCACTGT

CGGCGGTGTCACCACCAACAAGCAGGCTGTTGAAGCAGCCAGCAAGATCAGC

TCCGAGTTCGTTCAGAACACGGCCAATGACGGCCTTTTGGGACTGGCCTTTAG

CTCCATCAACACTGTCCAGCCCAAGGCGCAGACCACCTTCTTCGACACCGTCA

AGTCCCAGCTGGACTCTCCCCTTTTCGCCGTGCAGCTGAAGCACGACGCCCCC

GGTGTTTACGACTTTGGCTACATCGATGACTCCAAGTACACCGGTTCTATCACCT

ACACGGATGCCGATAGCTCCCAGGGTTACTGGGGCTTCAGCACCGACGGCTAC

AGTATCGGTGACGGCAGCTCCAGCTCCAGCGGCTTCAGCGCCATTGCTGACAC

CGGTACCACCCTCATCCTCCTCGATGACGAAATCGTCTCCGCCTACTACGAGCA

GGTTTCTGGCGCTCAGGAGAGCGAGGAAGCCGGTGGCTACGTTTTCTCTTGCT

CGACCAACCCCCCTGACTTCACTGTCGTGATTGGCGACTACAAGGCCGTTGTTC

CGGGCAAGTACATCAACTACGCTCCCATCTCGACTGGCAGCTCCACCTGCTTTG

GCGGTATCCAGAGCAACAGCGGTCTGGGACTGTCCATCCTGGGTGATGTTTTCT

TGAAGAGCCAGTACGTGGTCTTCAACTCTGAGGGCCCTAAGCTGGGATTCGCCGCTCAGGCTTAG。

EXAMPLE 2 construction of recombinant vector

The acid protease gene fragment recovered after amplification is used as a template, an upstream primer is introduced into a NotI (GCGGCCGC) enzyme cutting site, and a downstream primer is introduced into a PmeI (GAATTTC) enzyme cutting site. The primer sequences were as follows:

NotI-ANPEP-F(5’→3’)：

ACGGCGGCCGCATGGTCGTCTTCAGCAAAACCGCTGCCCTCGTTCTGGG；

Pmei-ANPEP-R(5’←3’)：

GCGAAATTTCCTAAGCCTGAGCGGCGAATCCCAGCTTAGGGCCCTC。

reaction conditions: 98 ℃ for 2min; 10S at 98 ℃; 15S at 55℃and 1.5min 30 cycles at 72 ℃; and at 72℃for 5min.

PCR amplification was performed using the above primers to obtain a DNA band of about 1.2kb in size, and the target fragment of the acid protease gene of Aspergillus niger having the cleavage site was recovered.

The amplified protease gene fragment with the enzyme cutting site and the Aspergillus niger expression plasmid pAN-EXP are respectively subjected to restriction enzyme NotI and PmeI enzyme cutting. After the target fragment and the Aspergillus niger expression plasmid pAN-EXP are digested, the two fragments are respectively recovered by electrophoresis, and the two fragments are subjected to enzyme ligation reaction by using T4 DNA ligase. After the enzymatic ligation reaction, E.coli Top10 competent cell transformation was performed. 100 μl of E.coli competent cells were taken, added to Eppendorf tubes of the ligation solution under aseptic conditions, mixed well and placed in an ice bath for 30 minutes. After ice bath, the cell suspension in the transformation reaction was added into a thermostatic water bath tank with a temperature of 42 ℃ adjusted, the temperature was kept for 2 minutes, 1ml of LB culture solution was rapidly poured into the tank, and the tank was placed on a shaking table with a temperature of 37 ℃ for 1 hour. Then, the solution was spread on an LB ampicillin dish and left at room temperature for about 15 minutes, so that the spread solution was dried and prevented from flowing. Then, the cells were placed in an incubator at 37℃overnight. The following day the dishes were removed and single colonies were picked. Colony PCR verifies that the correctly connected transformant is sent to sequencing, and after the sequencing is correct, the plasmid of the correct transformant is extracted, so that the Aspergillus niger expression vector pAN-EXP-ANPEP for expressing the acid protease is obtained, and the plasmid map is shown in figure 1.

EXAMPLE 3 construction of recombinant expression acid protease Strain

1. Aspergillus niger protoplast preparation

Aspergillus niger strains were grown on TZ medium at 32℃for 4 days, standard colonies were selected and streaked on CD solid medium, grown for 4 days at 32℃and 4 cc agar blocks were removed from the CD plates and placed in a 60ml triangular flask of CD fluid, grown for 4 days at 34 ℃. Collecting mycelium, cleaning the mycelium once by using 1M sorbitol, weighing wet weight, and mixing the mycelium with the sorbitol according to the mass volume ratio of 1:25 adding the lyase solution, and carrying out enzymolysis for 2.5 hours to 3 hours at the temperature of 30 ℃ and the speed of 80 r/min. The protoplast solution was filtered, and the filtrate was recovered. Centrifuging at 4000r/min for 10min, and discarding supernatant. Centrifuge with pre-chilled 0.6M KCl solution. The protoplast sediment is resuspended in a proper amount of 0.6M KCl solution, and the thallus concentration reaches (1-3) x 10 ⁶ And (5) placing the mixture in an ice bath for standby. The purified protoplast was diluted with an osmotic stabilizer for protoplast regeneration, spread on a plate of a protoplast regeneration medium, and cultured at 32℃for 4 to 5 days, and then observed for regeneration of the protoplast. Meanwhile, sterile water is used as a control after the protoplast is swelled and broken, so that errors caused by colonies formed by non-protoplasts are eliminated.

2. Aspergillus niger protoplast transformation

About 5. Mu.g of the Aspergillus niger expression vector pAN-EXP-ANPEP plasmid expressing the acid protease was added to 200. Mu.l of the prepared protoplast suspension, respectively, and gently mixed with a gun head. 50 μl of PEG solution is added, mixed by gentle inversion, ice-bath is carried out for 20-30min, 1ml of LPEG buffer is slowly added, after 20min standing at room temperature, 2ml of S/C solution is added, mixed gently, spread on a regeneration medium plate of 100 μg/ml hygromycin, and cultured at 34 ℃ for 5-6 days.

3. Aspergillus niger transformant selection and shake flask culture

Among transformants grown on hygromycin resistant plates, 24 single colonies with larger colonies were picked up and cultured in shake flask-packed fermentation medium flasks for 5 days at 32 ℃.

Example 4 acid protease enzyme Activity assay

4.1 drawing of a Standard Curve

Preparation of tyrosine solutions of different concentrations (preparation according to Table 1)

TABLE 1

Tyrosine 100 μg/mL (mL)	0	1	2	3	4	5	6	7	8	9	10
												Water (mL)	10	9	8	7	6	5	4	3	2	1	0
Final concentration (μg/mL)	0	10	20	30	40	50	60	70	80	90	100

5mL of 0.4mol/L sodium carbonate solution and 1mL of Fulin reagent are added into each lmL of tyrosine solutions with different concentrations, the color development is carried out for 20min at 40 ℃, and the optical density OD value of 660nm is measured by a colorimetry method. The OD values are obtained as the horizontal coordinates, the numbers of the tyrosine mugs (namely, 0, 10, 20, 30, 40, 50, 60, 70, 80, 90 and 100) are obtained as the vertical coordinates, a standard curve is drawn, and the amount of the tyrosine corresponding to each OD value is obtained as the K value.

Blank preparation: lmL distilled water is used for replacing 1mL of standard tyrosine liquid, and the following steps are prepared with a standard curve.

4.2 preparation of enzyme solution to be tested

Weighing an enzyme sample 1.000g to 50mL test tube, adding 19mL of 0.1mol/L lactic acid buffer solution, placing in a vortex mixer, vibrating until the solution is completely dissolved, placing in a water bath kettle at 40 ℃ for leaching for 60min, repeatedly vibrating for 3-4 times in the leaching process, and taking supernatant after leaching as enzyme liquid to be detected.

4.3 measurement

Taking 1mL of proper diluted enzyme solution (the OD value is preferably between 0.2 and 0.4 in the measurement), preheating for 2min in a water bath at 40 ℃, adding 1mL of 2% casein which is also preheated, precisely preserving the temperature for 10min, adding 2mL of 0.4mol/L trichloroacetic acid, stopping the reaction, continuously placing in the water bath at 40 ℃ for 10min, completely precipitating, and filtering. 1mL of filtrate was taken, and the following procedure was followed with the standard curve. Meanwhile, trichloroacetic acid is added for inactivation, casein is added for precipitation and filtration after 10min, the color development is used as a blank as a contrast, and the optical density value is measured by taking a contrast tube as a blank.

Acid protease activity (μg tyrosine/min·g or μ/g) =4/10×k×n

Wherein:

k-the number of tyrosine μg corresponding to the O.D value found from the standard curve.

N-dilution fold.

4/10-4 is the total volume (mL) of the reaction solution; 10 is the reaction time (min)

The result is about an integer.

EXAMPLE 5 screening of high enzyme Activity strains by enzyme Activity assay

The acid protease enzyme activity assay according to example 4 showed that the ANPEP15 shake flask enzyme activity was highest among 24 transformants and that the enzyme activity was 276U/ml. The recombinant strain of Aspergillus niger with the highest acid protease activity was named Aspergillus niger recombinant strain ANPEP15.

TABLE 2

EXAMPLE 6 mutagenesis of recombinant Aspergillus niger strains protoplast ARTP

Diluting the prepared Aspergillus niger recombinant strain ANPEP15 protoplast to 10 under aseptic condition ⁶ And (3) opening ARTP ultraviolet sterilization and preheating for 20min per mL, and setting mutagenesis treatment parameters. The plasma working gas is helium, the working power supply power is set to 120W, the gas flow rate is 10L/min, and the irradiation distance is 2mm. The protoplast suspension was pipetted onto small plates, each plate being coated with 10 μl of bacterial suspension. The irradiation treatment time is 0 to 240 seconds. The protoplasts after irradiation treatment were washed with 0.6M KCl and applied to a screenAnd (3) a flat plate. The lethality of the strain was calculated by colony forming units and the lethality was plotted as such.

The protoplast after mutagenesis treatment is coated on a PDA flat plate, placed in a constant temperature incubator at 32 ℃ for 4-5 days, colonies are picked out for culture in a 250mL shake flask, and strains with the highest acid protease yield are selected for carrying out multi-round mutagenesis screening by the method.

The detection of the enzyme activity of the acid protease shows that the highest enzyme activity of a shake flask is selected from 2000 mutant strains, the enzyme activity is 416U/ml, and the same ratio of the enzyme activity is improved by 50%. The recombinant strain of Aspergillus niger that was the most mutagenized was designated as recombinant strain ANPEP15M1 of Aspergillus niger.

The high yield acid protease Aspergillus niger ANPEP15M1 was serially passaged 6 times to verify the passaging stability, and the results are shown in FIG. 2. The result shows that the high-yield acid protease mutant strain ANPEP15M1 keeps a relatively stable fermentation level all the time from 1 generation to 6 generation, which proves that the strain has good genetic stability and is suitable for industrial production.

EXAMPLE 7 fermentation of high acid protease ANPEP-15M1 Aspergillus niger Strain

Adopting a 7L stirring type bioreactor, wherein the initial liquid loading amount is 4L, the inoculation amount is 500mL, and the seed transfer condition is that the concentration of the thalli is increased, the microscopic thalli is deeply dyed, and the visual field is clear and sterile; fermenting at 30 ℃, when the pH value in the fermentation process is reduced to 5.0, starting to introduce ammonia, controlling the pH value to be 4.8-5.2 by adding ammonia water in a flowing way, and controlling the ventilation rate to be 8L/min, wherein the rotating speed is as follows: 500-1000 rpm, and the DE value of the feed is controlled to be 10; and controlling the DE value of the feed fed to the tank from 36 hours to 20. The rotation speed is gradually increased in the later period, and the culture is carried out for 99 hours, and the enzyme activity is measured by sampling at regular time. And centrifuging the thalli to obtain a fermentation supernatant which is crude enzyme liquid, and carrying out protein electrophoresis SDS-PAGE detection and enzyme activity detection. And (3) fermenting and culturing the recombinant engineering bacteria for 99 hours by using a 7L fermentation tank with a fermentation medium, wherein the total enzyme activity of the acid protease of the recombinant strain reaches 26255U/mL. The fermentation efficiency of the high-yield acid protease ANPEP15M1 Aspergillus niger strain is obviously better than that of the existing production strain under the same condition, and the invention is applicable to the industrial production of acid protease and effectively improves the production efficiency. The fermenter fermentation data are shown in FIG. 3.

The present invention has been described in detail in the above embodiments, but the present invention is not limited to the above examples, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the present invention. Furthermore, embodiments of the invention and features of the embodiments may be combined with each other without conflict.

Claims (6)

1. An aspergillus niger (aspergillus niger) mutant strain ANPEP15M1 with high yield of acid protease, characterized in that said mutant strain ANPEP15M1 has the accession number GDMCCNO:63131.

2. use of an aspergillus niger mutant strain ANPEP15M1 of the high acid protease yield according to claim 1.

3. The use according to claim 2, characterized in that the aspergillus niger mutant strain ANPEP15M1 is used for the preparation of acid proteases.

4. A method for preparing an acid protease, comprising the step of fermenting the high acid protease-producing aspergillus niger mutant strain ANPEP15M1 of claim 1.

5. The method for producing an acid protease according to claim 4, wherein the ammonia is introduced at 30℃when the pH is lowered to 5.0 during fermentation, and the pH is controlled to 4.8 to 5.2 by feeding ammonia water, the ventilation amount is 8L/min, and the rotation speed is set at: 500-1000 rpm, the DE value of the feed is controlled to be 10, the DE value of the feed is controlled to be 20 after the feed is discharged from a tank for 36 hours, and then the rotational speed is gradually increased for culture.

6. A composition comprising the acid protease produced by the high acid protease of Aspergillus niger mutant strain ANPEP15M1 of claim 1 or the Aspergillus niger mutant strain ANPEP15M1.

Images