CN102776215B - Optimized lactase gene, and secretory expression method and application thereof - Google Patents

Abstract

The invention discloses an optimized lactase gene, and a secretory expression method thereof and application thereof. A lactase gene from aspergillus oryzae is modified according to preferred codons of pichia pastoris into the optimized lactase gene with a nucleotide sequence which is shown as SEQ ID NO.1. The optimized lactase gene reduces transcription energy shielding and improves transcription efficiency, the secretory expression level of the optimized lactase gene in the pichia pastoris is obviously improved, and the expressed recombination lactase has high enzyme activity. The result of a milk hydrolytic experiment shows that the lactose hydrolyzation rate of the produced recombination lactase can be above 80% at different temperatures, and the lactase hydrolyzation effect is good. The optimized lactase gene lays a foundation for further industrialized expanded production of lactase.

Description

Lactase gene and secretory expression method and the application optimized

Technical field

The present invention relates to Sumylact L optimized gene, relate in particular to the Sumylact L protogene that derives from aspergillus oryzae (Aspergillus oryzae) is carried out to codon optimized rear obtained Sumylact L optimized gene, the invention still further relates to the application of this Sumylact L optimized gene in preparation restructuring Sumylact L, belong to the preparation field of Sumylact L.

Background technology

Sumylact L (β-D-galactoside galactohydrolase, β-D-galactoside galactohydrolase, EC3.2.1.23) has hydrolysis and turns the dual function of glucosides.On the one hand, people utilize its hydrolysis function to produce low-lactose dairy product and remove the multiple untoward reaction that lactose-intolerant person causes because of edible milk-product; On the other hand, can utilize its effect that turns glucosides characteristic to produce oligomeric galactose (the Hydrolysis of lactose:aliterature review.Journal Name:Process Biochem. with excellent health functions; (United Kingdom); Journal Volu-me:20:11985, Medium:X; Size:Pages:2-12.).Sumylact L is extensively present in plant, microorganism and animal intestinal cell.At present, the Sumylact L of commercially producing is mainly derived from the microorganism fermentation of aspergillus (Aspergillus sp.) and these two genus of Crewe dimension Si Shi yeast (Kluyveromyces sp.).Crewe dimension Si Shi yeast is separated to from cow's milk, the natural pH (6.6～6.8) of the Sumylact L optimal pH of its generation and fresh milk is close, mainly be applicable to decompose the lactose in cow's milk and skim-milk, this enzyme is stable in pH6.2～7.0, more than 6.2～7.0 or the rapid decline of living of following enzyme.Optimum temperuture is 35～40 DEG C.Molecular weight is 135kDa.Process 1h for 40 DEG C, pH is stable between 6.5～8.5.40 DEG C of above just inactivations (Xie Yi etc., Fudan Journal (natural science edition), 1999, Vol.38, No.5:523-528) sharply.Lower from the Sumylact L pH of aspergillus gained, and at high temperature to have activity, molecular weight be 106kDa, 60 DEG C of optimum temperutures, optimal pH is 3.5～5.0.The maximum feature of the Sumylact L coming from mould is that thermostability is high, and optimum pH is low, is just not easy to be subject to like this microbiological contamination in foodstuffs industry, has more using value.

The Sumylact L of producing due to original strain yields poorly, and cannot meet industrial requirement, and therefore this area researchist attempts to utilize genetic engineering means to improve the expression amount of Sumylact L.Particularly utilize pichia spp and Aspergillus expression system to obtain greater advance on the expression level that improves Sumylact L.Berka (US 5, 736, 374) a kind of method that aspergillus Sumylact L is expressed that improves is disclosed, the aspergillus oryzae of galactopoiesis carbohydrase (A.oryaze) CCC28 bacterial strain is passed through ultraviolet by the method, NTG mutagenic treatment obtains the higher mutant strain CCC161 (ATCC74285) of Sumylact L expression amount, and (parent's Sumylact L secretory volume is 5U/ml, mutant strain secretory volume is 50U/ml), taking it as acceptor, the lactase gene of himself is placed under GalA promotor and is imported wherein, Sumylact L expressing quantity in positive colony screening is 1g/L fermented liquid, more than lactase activity reaches 500U/ml, 100 times are improved than original bacterium.The inventor discloses the structure of recombinant yeast pichia pastoris of the clone of the Sumylact L encoding gene that a kind of character is good, high efficient expression Sumylact L and the high density fermentation of recombination yeast and has produced in a large number the method for Sumylact L, in recombination yeast, the expression amount of Sumylact L can reach 6mg/ml fermented liquid, enzyme work reaches 3600U/ml, the recombination yeast of high efficient expression Sumylact L can be used to the cheap Sumylact L (Granted publication number: CN 1233826C, denomination of invention: a kind of reformed lactase of Pichia pastoris and application thereof) of producing of heavy industrialization.Machida, M. wait and reported a kind of lactase gene (Machida that separates, clones from aspergillus oryzae (Aspergillus oryzae), M., Asai, K., Sano, M., et.al, Genome sequencing and analysis of Aspergillus oryzae, Nature, 2005,438 (7071), 1157-1161), the secreting, expressing level of this lactase gene in yeast cell is lower, and expressed Sumylact L enzyme is lived not high, has limited its application in industrialization expanding production.

Summary of the invention

One of the object of the invention is to provide a kind of codon through transformation and the good Sumylact L optimized gene of mRNA secondary structural stability, and the secreting, expressing amount of this Sumylact L optimized gene in host cell is high;

The recombinant host cell that two of the object of the invention is to provide the recombinant expression vector that contains this Sumylact L optimized gene and contains this recombinant expression vector;

Three of the object of the invention is that described Sumylact L optimized gene and the recombinant expression vector that contains this optimized gene and recombinant host cell are applied to Restruction Sumylact L;

For achieving the above object, first the present invention modifies aspergillus oryzae (Aspergillus oryzae) lactase gene transformation and obtains Sumylact L optimized gene (lacm), and its nucleotides sequence is classified as shown in SEQ ID No.1.

The present invention is not changing aspergillus oryzae (Aspergillus oryzae) Sumylact L protogene (laco) (nucleotide sequence shown in SEQ ID NO.2) under the prerequisite of its protein amino acid sequence, consider codon usage frequency, the adjustment of GC content, the deletion of unstable sequence, the influence factors such as mRNA secondary structure, according to the preference codon of pichia pastoris phaff, aspergillus oryzae (Aspergillus oryzae) lactase gene (laco) is transformed, wherein, change altogether 379 bases, relate to 311 amino acid, modify the GC content of the Sumylact L optimized gene (lacm) (SEQID NO.1) obtaining after transformation and reduce to 48.5% by 51.5%, in addition, after optimizing, the mRNA secondary structure free energy of lactase gene has also obtained raising by a relatively large margin, has reduced and has transcribed energy barrier, has improved and has transcribed efficiency, has effectively improved its secreting, expressing amount in pichia spp.

The recombinant host cell that the present invention provides on the other hand the recombinant expression vector that contains described Sumylact L optimized gene and contained this recombinant expression vector;

Preferably, described recombinant expression vector is recombinant eukaryon expression vector, and more preferably recombinant yeast expression vector most preferably is recombinant yeast pichia pastoris (Pichia pastoris) expression vector.

Be connected and just can obtain the recombinant yeast expression vector of secreting, expressing Sumylact L in yeast cell with the expression regulation sequence of yeast exercisable described Sumylact L optimized gene; In order to reach better secreting, expressing effect, the present invention preferably obtains the restructured Pichia pastoris in expression carrier of secreting, expressing restructuring Sumylact L in Pichia pastoris by exercisable described Sumylact L optimized gene being connected with the expression regulation sequence of pichia spp.

Yeast of the present invention comprises any in the each primary yeast of optimized gene that can express coding Sumylact L.Selecting the suitable yeast for expressing restructuring Sumylact L is within those of ordinary skill in the field's limit of power.At the yeast host of selecting for expressing, suitable host can comprise that displaying has for example good secretion capacity, low proteolytic activity, good soluble protein and produces and overall firm yeast.These yeast include but not limited to ascosporogenous yeast (Endomycetale (Endomycetales), sporidium yeast and belong to the yeast of imperfect fungi (gemma guiding principle (Blastomycetes)) class.Described ascosporogenous yeast is divided into two sections, that is: Spermophthoraceae (Spermophthoraceae) and Saccharomycetaceae (Saccharomycetaceae).The latter comprises four subfamilies, for example Schizosaccharomyces of Schizosaccharomycoideae((Schizosaccharomyces)), Nadsonioideae, Lipomycoideae and for example Pichia of Saccharomycoideae((Pichia), genus kluyveromyces (Kluyveromyces) and yeast belong (Saccharomyces).Sporidium yeast comprises that Leucosporidium genus, Rhodosporidium (Rhodosporidium), lock are thrown yeast belong (Sporidiobolus), Filobasidium belongs to and Filobasidiella (Filobasidiella).

Preferably, yeast of the present invention is pichia spp (Pichia pastoris).

Expression regulation sequence for Yeast expression carrier is well-known for those of ordinary skill in the field, includes but not limited to from the promoter region such as following gene: alcoholdehydrogenase (ADH), Hydratase, phosphoenolpyruvate, glucokinase, GPI, glyceraldehyde-3-phosphate dehydrogenase (GAP or GAPDH), hexokinase, phosphofructokinase, 3-phoshoglyceric acid mutase and pyruvate kinase (PYK).Other suitable promoter sequence for yeast host comprises for glycerol 3-phosphate acid kinase (Hitzeman et al., J.Biol.Chem. (1980) 255:2073) and other sucroclastic promotor such as pyruvic carboxylase, triosephosphate isomerase and phosphoglucose isomerase (Holland et al., Biochemistry (1978) 17:4900; Hess etal., J.Adv.ENZYME REG. (1968) 7:149).Yeast enhanser also can use together with Yeast promoter.In addition, synthetic promoter also can play the effect of Yeast promoter.Yeast promoter can comprise the promotor in the non-yeast source of the natural generation with combining yeast RNA polymerase and initial ability of transcribing, other controlling elements that can comprise part Yeast expression carrier comprises for example terminator from GAPDH or enolase gene (Holland et al., J.Biol.Chem. (1981) 256:1385).Suitable Select gene for yeast is the trp1 gene being present in yeast plasmid, and described trp1 gene is provided for the selective marker of the yeast mutant that lacks the ability of growing in tryptophane.

Further, the invention provides a kind of method of utilizing described lactase gene Restruction Sumylact L, comprising: being connected and obtaining recombinant expression vector with expression vector the Sumylact L optimized gene operability shown in SEQ ID NO.1; By described recombinant expression vector transformed host cell, obtain recombinant bacterial strain; Cultivate recombinant bacterial strain, the expression of induction restructuring Sumylact L, reclaims and the expressed restructuring Sumylact L of purifying, to obtain final product.

In the method for above-mentioned Restruction Sumylact L, described recombinant expression vector is preferably recombinant eukaryon expression vector, more preferably restructured Pichia pastoris in expression carrier; Described host cell is preferably yeast, more preferably pichia spp (Pichia pastoris) cell.

The method that Sumylact L optimized gene is transformed in yeast host is well-known to those of ordinary skill in the field.For example, yeast conversion can be carried out according to the method to describe in Publication about Document: Hsial et al., P.Natl.Acad.SCI.USA (1979) 76:3829 and Van Solingen et al., J.Bact. (1977) 130:946, also can be according to conventionally at SAMBROOK et al., method described in Molecular Cloning:A Lab Manual (2001) transforms, such as by modes such as core injection, electroporation or protoplast fusions, Sumylact L optimized gene is incorporated in yeast cell, as long as built recombinant host cell bacterial strain (introduce in yeast cell by recombinant yeast expression vector and separate the recombination yeast host cell with suitable expression vector), under the condition that is suitable for producing restructuring Sumylact L, cultivate recombinant host cell bacterial strain, the method of cultivating recombinant host cell bacterial strain depends on the character of expression carrier used thereof and the characteristic of host cell, this belongs to conventional technique means concerning those of ordinary skill in the field, it includes but not limited to fermentor tank, vibration flask, fluidized bed bio reactor, hollow fiber bio-reactor, the methods such as spinner culture system and steel basin bioreactor system, each of these methods can adopt in batches, the method such as feed supplement or continuous mode is carried out, simultaneously gather cell or gather culture supernatants with pattern in batches or continuously.At the assimilable source that contains carbon, nitrogen and inorganic salt with optionally contain VITAMIN, amino acid, somatomedin and other well-known albumen is cultivated recombinant host cell in cultivating the liquid nutrient medium of fill-in.For cultivating, the liquid nutrient medium of host cell can optionally contain microbiotic or anti-mycotic agent includes but not limited to the host cell of antibiotic compound to select to contain expression vector to prevent undesirable microorganism growth and/or to contain.

Being used for is well-known in other method of yeast host cell expressing heterologous albumen to those of ordinary skill in the field.Can use those of ordinary skill in the field's well-known standard fed-batch fermentation methods (standard feed batch fermentation method) that yeast host bacterial strain is grown in fermentor tank in the amplification stage.Described fermentation method can utilize path or express the difference in master mode through adjusting to solve the carbon of specific yeast host.For example, Saccharomyces cerevisiae host's fermentation may need single glucose, compound nitrogen source (for example caseic hydrolysate) and multivitamin to supplement.The growth limitation nutrient substance that is generally carbon can be to allow maximum growth in the amplification stage adds fermentor tank.In addition, the common Application Design of fermentation method is the fermention medium of the carbon that contains q.s, nitrogen, basic salt, phosphorus and other less important nutrient substance (such as VITAMIN, trace mineral and salt etc.).

Restructuring Sumylact L of the present invention carries out purifying after expressing in recombination system, can adopt method known in multiple affiliated field purifying or concentrated restructuring Sumylact L from yeast host cell, any following methods or means all can be used for purifying the present invention Sumylact L of recombinating, for example: affinity chromatography, negatively charged ion or cation-exchange chromatography (for example DEAESEPHAROSE), silica gel chromatography, reversed-phase HPLC, gel-filtration (for example SEPHADEX G-75), hydrophobic interaction chromatograph, size exclusion chromatogram, immobilized metal ion afinity chromatography, ultrafiltration/filter thoroughly, ethanol precipitation, ammonium sulfate precipitation, chromatofocusing, displcement chromatography, electrophoretic procedures (including but not limited to preparative isoelectrofocusing), difference solvability (including but not limited to ammonium sulfate precipitation), SDS-PAGE or extraction.For example, can be centrifugal or filter fermentation culture to remove cell debris, by supernatant concentration or be diluted to wanted volume or thoroughly filter in suitable buffer with adjusting preparation for being further purified.Preferred, can, by the centrifugal removal bacterial sediment of supernatant liquor after fermentation, upper clear enzyme solution be filtered, discard filtered solution, obtain concentrated enzyme liquid; Wherein, described filtration can be divided into twice, filters for the first time and adopts 0.1 μ m microfiltration membrane to filter, and with the impurity of removing cell debris residual in upper clear enzyme solution and may existing, collects filtered solution; Filter is for the second time that the primary filtered solution ultra-filtration membrane that process molecular weight cut-off is 10kDa is again filtered.

Unless otherwise defined, otherwise all technology used herein and scientific terminology all have with those skilled in the art and conventionally understand identical implication.

Term " yeast host " or " yeast host cell " comprise the yeast that can be used as or be used as the receptor of recombinant vectors or other transfer DNAs.Described term comprises the offspring of the original yeast host cell that receives recombinant vectors or other transfer DNA.Due to accidentally or the sudden change of having a mind to, the offspring of single parental cell can be in form or with the genome of original parent complementation or total DNA in full accord.

Term " recombinant host cell " or " host cell " mean to comprise the cell of exogenous polynucleotide, and no matter use which kind of method to insert to produce recombinant host cell, for example, directly absorb, known additive method in transduction, f pairing or affiliated field.Exogenous polynucleotide can remain the nonconformity carrier of for example plasmid or can be integrated in host genome.

Term " polynucleotide " means deoxyribonucleotide, dezyribonucleoside, ribonucleoside or ribonucleotide and the polymkeric substance thereof of sub-thread or bifilar form.Unless specific limited, otherwise the nucleic acid of the known analogue that contains natural nucleotide contained in described term, described analogue has and is similar to the binding characteristic of reference nucleic acid and carries out metabolism in the mode of the Nucleotide that is similar to natural generation.Unless in addition specific limited, otherwise described term also means oligonucleotide analogs, it comprises PNA(peptide nucleic acid(PNA)), in antisense technology DNA analogue (thiophosphatephosphorothioate, phosphamide acid esters etc.) used.Unless otherwise, otherwise specific nucleic acid sequence is also impliedly contained its conservative varient of modifying (including, but is not limited to degenerate codon replaces) and complementary sequence and the clear and definite sequence of appointment.Specific; can realize degenerate codon and replace (Batzer et al., Nucleic Acid Res.19:5081 (1991) through mixing sequence that base and/or Hypoxanthine deoxyriboside residue replace by producing the 3rd of one of them or one above selected (or all) codon; Ohtsuka et al., J.Biol.Chem.260:2605-2608 (1985); Cassol et al., (1992); Rossolini et al., Mol Cell.Probes 8:91-98 (1994)).

Term " polypeptide ", " peptide " and " albumen " exchange in this article and use to mean the polymkeric substance of amino-acid residue., be equally applicable to describe peptide and describe albumen and vice versa for the description of polypeptide.Described term is applicable to natural generation aminoacid polymers and one of them or aminoacid polymers that more than one amino-acid residue is non-naturally encoded amino acids.As used herein, the amino acid chain of any length contained in described term, and it comprises full-length proteins (being antigen), and wherein amino-acid residue connects via covalency peptide bond.

Term " expression " refers to foreign gene transcribing and/or translating in host cell.

Term " conversion " refers to foreign gene to be incorporated into the method in host cell.

Term " foreign gene " refers to specific host cell, and this gene order is the source that belongs to external, or from identical source but its original series carried out modifying or transformation.

Brief description of the drawings

The codon usage frequency of Fig. 1 Sumylact L protogene (laco).

The codon usage frequency of Fig. 2 Sumylact L optimized gene of the present invention (lacm).

Fig. 3 Sumylact L protogene (laco) mRNA secondary structure figure.

Fig. 4 Sumylact L optimized gene of the present invention (lacm) mRNA secondary structure figure.

The structure schematic diagram of Fig. 5 yeast recombinant expression plasmid pPIC9-laco (lacm).

Fig. 6 turns the PCR qualification electrophorogram of the yeast transformant of lacm and laco gene; 1: negative control; 2-6: the PCR that turns Sumylact L optimized gene (lacm) yeast transformant detects, and taking MF1 and MR1 as primer amplification, amplifies the lacm full length gene fragment of about 3kb; 8-12: the PCR that turns Sumylact L protogene (laco) yeast transformant detects, and taking 5AOX and MR2 as primer amplification, amplifies the fragment of the approximately 1.6kb size that comprises part promotor and laco gene; M:1kb DNA marker.

Fig. 7 turns laco (1#), turns lacm(Y7#) 3 liters of fermentor tanks of yeast strain in Sumylact L enzyme slip-knot fruit.

The SDS-PAGE of Fig. 8 Y7# yeast strain Sumylact L expression amount in methanol induction different time in 3 liters of fermentor tanks; M: molecular weight of albumen marker.

The effect test of the prepared restructuring Sumylact L hydrolysed milk of Fig. 9 the present invention.

Embodiment

Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiment are only exemplary, scope of the present invention are not formed to any restriction.It will be understood by those skilled in the art that lower without departing from the spirit and scope of the present invention and can the details of technical solution of the present invention and form be modified or be replaced, but these amendments and replacement all fall within the scope of protection of the present invention.

Illustrate: in following specific embodiment, the genetic recombination of using learns a skill and is the routine techniques in this area.The technology not describing in detail in following examples, all carry out according to the related Sections in following laboratory manual or document or part, comprise: Sambrook et al, Molecular Cloning, A Laboratory Manual (the 3rd edition .2001); Kriegler, Gene Transfer and Expression:A Laboratory Manual (1990); Current Protocols in Molecular Biology (Ausubel et al, 1994).

The optimization design of embodiment 1 lactase gene and synthetic

1.1 bacterial strains and plasmid

Aspergillus oryzae (Aspergillus oryzae) is preserved by inventor laboratory;

Intestinal bacteria (Escherichia coli) bacterial strain TOP10 and cloning vector pSP72 are purchased from Beijing Quanshijin Biotechnology Co., Ltd; The full gene fragment of lacm is synthetic by Beijing AudioCodes biotech company.

The optimization design of 1.2 lactase genes

First the present invention analyzes the sequence of the Sumylact L original gene (laco) that clone obtains from aspergillus oryzae (Aspergillus oryzae), do not changing under the prerequisite of protein amino acid sequence, consider codon usage frequency, the adjustment of GC content, the influence factor such as deletion, mRNA secondary structural stability of unstable sequence, transforms lactase gene sequence according to the preference codon of pichia pastoris phaff.Codon service condition before and after lactase gene optimization as depicted in figs. 1 and 2.The Sumylact L protogene total length 3015bp in aspergillus oryzae source, 1005 amino acid of encoding altogether.Wherein 19 of front 57 alkali yl codings amino acid are signal peptide sequence.Compare by GenBankBlast, the lactase gene similarity in the Sumylact L protogene in aspergillus oryzae source and Aspergillus source is the highest.When expressing in pichia spp, Sumylact L protogene need remove the signal peptide sequence carrying, taking the alpha factor on expression vector pPIC9 as signal peptide, therefore remove the Sumylact L protogene (laco) of self signal peptide by 2958 based compositions, 986 amino acid (SEQ ID NO.2) of encoding.Do not changing under the prerequisite of aminoacid sequence, the present invention modifies transformation to laco gene, 379 bases are changed altogether, relate to 311 amino acid, GC% content is reduced to 48.5% (table 1) by original 51.5%, and Sumylact L optimized gene (lacm) sequence obtaining is shown in SEQ ID NO.1; And, gene (lacm) (SEQ ID NO.1) after optimization is by software prediction (RNA structure 4.5), its mRNA secondary structure free energy is compared laco (SEQ ID NO.2) and has been obtained raising by a relatively large margin, be conducive to like this reduce and transcribe energy barrier, improve and transcribe efficiency, and then improve expressing quantity (table 2).Meanwhile, before and after optimizing also there is very large change in the secondary structure of the mRNA of gene, and the mRNA secondary structure of optimized gene (lacm) has reduced hairpin structure, simpler, is conducive to transcribe (Fig. 3,4) of gene.

Table 1 lactase gene is optimized the change list of front and back GC content

The mRNA secondary structure free energy comparison of table 2 laco and lacm

Note: mRNA secondary structure free energy uses RNA structure 4.5 softwares to calculate.

1.3 lactase genes (lacm) after codon optimized synthetic

By lacm(SEQ IDNO.1) be connected on carrier pSP72 after synthetic.

Structure and the screening of embodiment 2 Sumylact L recombinant pichia yeast strains

1.1 bacterial strains and plasmid

Top10 competent escherichia coli cell is purchased from Beijing Quanshijin Biotechnology Co., Ltd;

Expression vector pPIC9 and pichia spp F-strain GS115 are Invitrogen company product.

By lacm(SEQ ID NO.1) be connected to after synthetic and on carrier pSP72, obtain plasmid pSP72-lacm; By laco(SEQ ID NO.2) be connected to after synthetic and on carrier pSP72, obtain plasmid pSP72-laco.

1.2 reagent, substratum and other solution

Ortho-nitrophenyl β-D-synthesis (oNPG) is Applichem company product;

YPD substratum: peptone 20g/L, yeast extract 10g/L, glucose 20g/L (solid medium is containing 1.5% agar powder), 108 DEG C of sterilizing 15min.

10 × YNB(yeast is without amino acid nitrogenous source): 134g YNB solid is dissolved in 1L deionized water, filtration sterilization, 4 DEG C of preservations.

500 × vitamin H: vitamin H 20mg/100mL water, filtration sterilization, 4 DEG C of preservations.

10 × glucose: 200g D-Glucose is dissolved in 1000mL water, filtration sterilization, 4 DEG C of preservations.

MD substratum: YNB 13.4g/L, glucose 20g/L, vitamin H 4x10 ^-4g/L, agarose 20g/L.

MM substratum: YNB 13.4g/L, methyl alcohol 0.5%, vitamin H 4x10 ^-4g/L, agarose 20g/L.

BMGY substratum: peptone 20g/L, yeast extract 10g/L, YNB 13.4g/L, vitamin H 4x10 ^-4g/L, glycerine 10ml/L, with the preparation of pH6.0 phosphate buffered saline buffer.

BMMY substratum: peptone 20g/L, yeast extract 10g/L, YNB 13.4g/L, vitamin H 4x10 ^-4g/L, methyl alcohol 5mL/L, with the preparation of pH6.0 phosphate buffered saline buffer.

1mol/L sorbyl alcohol: 182.1gD-sorbyl alcohol is dissolved in 1L water to filtration sterilization, 4 DEG C of preservations.

Basal salts(fermention medium): KH ₂pO ₄12g/L, NH ₄h ₂pO ₄80g/L, K ₂sO ₄43g/L, MgSO ₄7H ₂o 26g/L, Ca ₂sO ₄2.86g/L, KOH 3.0g/L.

Trace salt solution (PTM) used in fermentation: copper sulfate 4.0g/L, sodium iodide 0.18g/L, manganous sulfate 1.8g/L, Sodium orthomolybdate 0.4g/L, boric acid 0.02g/L, cobalt chloride 1.5g/L, zinc chloride 10g/L, ferrous sulfate 34g/L, vitamin H 0.25g/L, sulfuric acid 3ml/L; Filtration sterilization, 4 DEG C of preservations.

The structure of 1.3 Sumylact L protogenes and optimized gene yeast recombinant expression vector

Extract respectively pSP72-lacm and pPIC9 plasmid, and with SnaBI and NotI, these two recombinant plasmids are carried out to double digestion processing respectively, and lacm gene (SEQ IDNO.1) is cut to product with expression vector pPIC9 enzyme and reclaim and be connected, cut and check order positive colony is identified by enzyme, having built thus yeast recombinant expression vector pPIC9-lacm (Fig. 5).

With reference to the construction process of yeast recombinant expression vector pPIC9-lacm, Sumylact L protogene (laco) (SEQ IDNO.2) is cut to product with expression vector pPIC9 enzyme to be reclaimed and is connected, cut and check order positive colony is identified by enzyme, building and obtain yeast recombinant expression vector pPIC9-laco(Fig. 5).

1.4 Sumylact L protogenes and the expression of optimized gene in pichia spp

With BglII respectively enzyme cut recombinant expression plasmid pPIC9-lacm and pPIC9-laco, make plasmid linearization, transformed respectively pichia spp Host Strains GS115 according to Pichia anomala expression handbook.Coat on MD flat board with every plate 200 μ l bacterium liquid measures, 28 DEG C are cultured to and grow transformant.5 clones of random choose are extracted genome, utilize CTAB method to extract genomic dna, then taking genomic dna as template, carry out pcr amplification detection with special primer.The primer 5AOX (5 ' GACTGGTTCCAATTGACAAGC) that detects the employing laco inner primer MR2 of gene (5 ' GGTTACCAGCACTGGTAGGAAG) and pPIC9 carrier promotor place to turning the PCR of Sumylact L protogene (laco) Yeast genome carries out pcr amplification, can amplify the fragment of 1.6kb size; The PCR that turns the Yeast genome of optimized gene (lacm) detects, 5 ' terminal specific primer MF1 (5 ' TCCATCAAG CACCGTTTGAATG) with modifying gene lacm carries out pcr amplification with 3 ' terminal specific primer MR1 (5 ' GTAAGCTCCCTTT CTCTGCTCG), can amplify the full length gene fragment (Fig. 6) of 3kb size.

Detect and show through pcr amplification, laco and lacm gene are all successfully transformed in Pichia pastoris.

1.5 galactopoiesis carbohydrase recombinant yeast pichia pastoris are in the screening of shaking table level

First adopt plate screening method to carry out primary dcreening operation to transformant.Transformant longer on MD flat board is copied on the numbered MM flat board of tool and (on flat board, evenly scribbles the X-gal that 80 μ l concentration are 20mg/ml) with aseptic toothpick, be replicated on the MD flat board with identical numbering simultaneously, MM replica plate and MD replica plate are placed in to 28 DEG C of incubators cultivations, positive strain can show blueness on flat board, determines accordingly positive rate and Sumylact L Pichiapastoris expression strain.Subsequently the transformant of dull and stereotyped primary dcreening operation is carried out to multiple sieve.With aseptic toothpick, primary dcreening operation is had to enzyme corresponding clone alive and chooses shaking table cultivation 48h(28 DEG C in 10mL BMGY substratum, 200rpm), then centrifugal (6000rpm, 8min), discard substratum supernatant, add 5mL BMMY, shaking table is cultivated (28 DEG C, 200rpm), add 0.5% methyl alcohol every 24h during this time, centrifugal (6000rpm, 8min after induction 60h, 4 DEG C), collect supernatant liquor and measure enzyme activity.Sieve again result and carry out revision test again, confirm enzyme activity.

Screening assay turn 800 of the yeast transformants of lacm gene, find on average approximately to have in 800 yeast transformants 30% transformant (240) to there is the activity of Sumylact L.

Same screening assay turn 1000 of the yeast transformants of Sumylact L protogene (laco), finds the average activity that approximately has 28% transformant (280) to there is Sumylact L in 1000 yeast transformants; The enzyme the highest (4321.8U/ml) alive of the 1# transformant of its transfer laco gene; Turn in 800 yeast transformants of lacm enzyme live the highest transformant Y7# the enzyme of shaking table level live (1411.8U/ml) be 3.3 times (table 3) that turns the 1# transformant (433.6U/ml) of laco gene; Wherein there is the enzyme of 75% the transformant that turns lacm gene to live all higher than the galactopoiesis carbohydrase recombinant yeast pichia pastoris (comprising the highest 1# transformant that turns laco gene of enzyme work) that turns laco gene.

The definition of lactase activity

The activity of the Sumylact L of 1 unit is that per minute decomposes o-NP-β-D galactoside (ONPG) and generates the required enzyme amount of 1 μ moL o-nitrophenol (ONP) at pH5.2,60 DEG C.

The measuring method that enzyme is lived: will express the dilution of supernatant 0.1mol/L pH5.2 acetate buffer solution, get 200 μ L diluents and add 800 μ L 0.25%ONPG (o-NP-β-D galactopyranosides, 0.1mol/L pH5.2 acetate buffer solution preparation), 60 DEG C of water-bath 15min, add 1mL10% trichoroacetic acid(TCA) termination reaction, add again 1mL 1mol/L sodium carbonate nitrite ion, OD ₄₂₀measure lactase activity, replace supernatant diluent in contrast with 0.1mol/L pH5.2 acetate buffer solution simultaneously, calculate the content of hydrolysate p-nitrophenol, calculate the activity of enzyme by typical curve.

Table 3 part turns the enzyme activity determination result of Sumylact L optimized gene yeast

Note: the contrast 1# in table 3 is for turning the transformant of laco gene (SEQ ID NO.2); All the other are the transformant that turns lacm gene (SEQ ID NO.1).

The fermentation of 1.6 Sumylact L recombinant yeast pichia pastoris

Respectively to turn the recombinant yeast pichia pastoris bacterium 1# that the Sumylact L expression amount of Sumylact L protogene (laco) is the highest and to produce enzymic fermentation through the Y7# that turns Sumylact L optimized gene (lacm) significantly improving than the work of control strain enzyme in multiple sieve experiment is carried out to the fermentor tank level induction of 3 liters, laboratory.

Respectively above-mentioned 2 strain yeast transformants are chosen in 40ml YPD substratum with aseptic toothpick, shaking table is cultivated after (28 DEG C, 200rpm) 48h, be transferred in 200ml YPD substratum, shaking table is cultivated (28 DEG C, 200rpm) 24h as ferment-seeded bacterium liquid, is inoculated in 3 liters of fermentor tanks.

Fermentor tank parameter is set to pH5.5, 30 DEG C of temperature, stir speed (S.S.) is 1000rpm, air flow is 200, initial inoculum is 200ml bacterium liquid, when dissolved oxygen drops to minimum, then while starting to rise to 100% again, start to mend sugar (40% glucose+12mlPTM salt of 300ml), mend after sugared 4-5h, start mixed feeding (40% glucose+1mlPTM salt+7ml methyl alcohol of 80ml), after mixed feeding 2-4h, start stream and add methyl alcohol (500ml methyl alcohol+12mlPTM salt) induction product enzyme, start after induction, getting fermented sample every 12h measures thalline weight in wet base and sample enzyme and lives and keep sample, enzyme work increases along with the prolongation of induction time, in the time that enzyme work starts to decline, stop fermentation, lower tank, by centrifugal fermented liquid (10000rpm, 10min, 4 DEG C), clear enzyme solution in collection.From 3 liters of horizontal fermentation results of lab scale, the activity that turns yeast transformant 1# Sumylact L after methanol induction 132h of Sumylact L protogene laco is 4321.8U/ml; Turn Sumylact L optimized gene lacm yeast transformant Y7# Induction 132h after for 13021.1U/ml, its enzyme work is 3.0 times (Fig. 7, Fig. 8) of 1# transformant.

As can be seen here, the optimized gene (SEQ ID NO.1) that the present invention obtains the Sumylact L in aspergillus oryzae source after the comprehensive reformations such as codon optimized, GC content change can significantly improve the secreting, expressing amount of Sumylact L albumen in pichia spp, has significantly improved the enzyme of Sumylact L and has lived.With domestic and international part Study comparison, the recombinate final expression amount of Sumylact L of the present invention reaches higher expression level, for further industrialization expanding production is laid a good foundation.

The milk hydrolysising experiment of experimental example 1 Sumylact L

One, experiment material

1, for examination material: turn Pichi strain transformants such as () Y7#, Y1#, Y3#, Y231# of lacm through fermentation, micro-filtration, ultrafiltration and concentration, remove yeast thalline, the Sumylact L enzyme liquid (30000U/ml) obtaining;

2, milk sample: the pure milk sample (Lilezhen packaging) that the company of Erie of selling on market produces.

Two, experimental technique

By measuring lactase activity, the enzyme work of Sumylact L sample is adjusted to 30000U/ml.Under sterile state, measure pure milk 1L, mix, in the ratio of 1:1000, zymin is added in 1L milk, after mixing, carry out packing, each triangular flask liquid amount 20ml, numbering, each treatment condition is done three repetitions.And the milk sample that does not add zymin sample of simultaneously getting same amount in contrast.Study Sumylact L under differing temps (6 DEG C, 10 DEG C, 15 DEG C, 25 DEG C), the degree of the lactose in hydrolyzed bovine Ruzhong in different time.

According to sample time, take out corresponding sample bottle, measure pH value record.Get 0.4ml milk sample and add in EP pipe, add 0.4mL 20% plumbic acetate, vibrate to remove Deproteinization, then add 0.4mL potassium oxalate-disodium phosphate soln (take 3g potassium oxalate and 7g Sodium phosphate dibasic, be dissolved in water and be settled to 100ml), remove Pb ²⁺, thermal agitation, after the centrifugal 10min of 12000rpm, get 0.8mL supernatant liquor, once centrifugal again with the same terms, get 0.7mL supernatant liquor to EP pipe, freezing, by the lactose-content in the each processing sample of high-performance liquid chromatogram determination, draws the lactose hydrolysis ratio under each condition.

Three, experimental result

Experimental result is shown in Fig. 9 (Fig. 9 result is the average result of the Sumylact L hydrolysed milk experiment of above-mentioned yeast transformant fermentative production).Experimental result shows, the prepared restructuring Sumylact L sample lactose hydrolysis ratio under differing temps of the present invention all can reach more than 80%, and hydrolysis effect is good, has good application prospect.

Sequence table

Lactase gene and secretory expression method and application that <110> optimizes

<120> Biological Technology institute, Chinese Academy of Agricultural Sciences

<130> DQXL-0016

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 2958

<212> DNA

<213> artifical sequence

<400> 1

tccatcaagc atcgtctcaa tggcttcacg atcctggaac atccggatcc ggcgaaaaga 60

gacttgctgc aagacattgt tacatgggat gacaaatctc tgttcatcaa tggagagagg 120

attatgttat tcagcggaga agtgcatcct ttcagattgc cagtaccttc gctttggctt 180

gatatcttcc acaagatcag agctcttggt ttcaactgtg tatctttcta tattgattgg 240

gctcttctgg agggaaagcc tggcgactac agagcagaag gcatctttgc tctggaaccc 300

ttcttcgatg cagccaagga agcaggcatt tatctgatcg cccgccccgg ttcgtacatc 360

aatgccgagg tctcaggcgg tggcttccct ggatggttgc agagggtcaa tggcactctt 420

cgctcgtctg atgagccatt ccttaaagct actgataact atatcgccaa tgccgctgct 480

gccgtggcga aggctcaaat cacgaatgga gggccagtaa ttctctacca gcccgaaaac 540

gaatacagcg gtggctgctg cggtgtcaaa taccccgatg cagactacat gcagtatgtt 600

atggatcagg cccggaaggc tgacattgtt gtacctttca tcagcaacga tgcctcacct 660

tctgggcaca atgctcctgg aagtggaacg ggcgctgttg atatttatgg tcacgatagc 720

tatccccttg gctttgattg cgcaaaccca tccgtatggc ccgagggtaa actgcccgac 780

aacttccgca cgctccatct tgagcagagc ccatcaactc cgtattcact tcttgagttc 840

caagcgggtg ctttcgaccc atggggtgga cccggctttg aaaaatgcta tgccctcgtt 900

aaccacgaat tctcgagagt tttctatagg aacgacttga gtttcggagt ttctaccttt 960

aacttataca tgactttcgg cggaacaaac tggggtaacc tcggacatcc cggtggatat 1020

acatcctacg actacggctc gcctataact gaaacgcgaa acgttacacg ggagaagtac 1080

agcgacataa agctccttgc caactttgtc aaagcatcgc catcctatct caccgctact 1140

cccagaaacc tgactactgg tgtttacaca gacacatctg acctggctgt caccccgtta 1200

atgggtgata gtccaggctc attcttcgtg gtcagacata cggactattc cagccaagag 1260

tcaacctcgt acaaacttaa gcttcctacc agtgctggta acctgactat tccccagctg 1320

gagggcactc taagtctcaa cggacgtgac tcaaaaattc atgttgttga ttataatgtg 1380

tctggaacga acattatcta ttcgacagct gaagtcttca cctggaagaa gtttgacggt 1440

aacaaggtcc tggtgttata cggcggaccg aaggaacacc atgaattggc cattgcctcc 1500

aagtcaaatg tgaccatcat cgaaggttcg gactctggaa ttgtctcaac gaggaagggc 1560

agctctgtta tcattggctg ggatgtctct tctactcgtc gcatcgttca agtcggtgac 1620

ttgagagtgt tcctgcttga tagaaactct gcttacaact actgggtccc cgaactcccc 1680

acagaaggta cttctcccgg gttcagcact tcgaagacga ccgcctcctc cattattgtg 1740

aaggccggct acctcctccg aggggctcac ctggatggtg ctgatcttca tcttactgct 1800

gatttcaatg ccaccacccc gattgaagtg atcggtgctc caacaggcgc caagaatctg 1860

ttcgtgaatg gtgaaaaggc tagccacaca gtcgacaaaa acggcatctg gagtagtgag 1920

gtcaagtacg cggctccaga gatcaagctc cccggtttga aggatttgga ctggaagtat 1980

ctggacacgc ttcccgaaat taagtcttcc tatgatgact cggcctgggt ttcggcagac 2040

cttccaaaga caaagaacac tcaccgtcct cttgacacac caacatcgct atactcctct 2100

gactatggct tccacactgg ctacctgatc tacaggggtc acttcgttgc caacggcaag 2160

gaaagcgaat tttttattcg cacacaaggc ggtagcgcat tcggaagttc cgtatggctg 2220

aacgagacgt atctgggctc ttggactggt gccgattatg cgatggacgg taactctacc 2280

tacaagctat ctcagctgga gtcgggcaag aattacgtca tcactgtggt tattgataac 2340

ctgggtctcg acgagaattg gacggtcggc gaggaaacca tgaagaatcc tcgtggtatt 2400

cttagctaca agctgagcgg acaagacgcc agcgcaatca cctggaagct cactggtaac 2460

ctcggaggag aagactacca ggataaggtt agaggacctc tcaacgaagg tggactgtac 2520

gcagagcgcc agggcttcca tcagcctcag cctccaagcg aatcctggga gtcgggcagt 2580

ccccttgaag gcctgtcgaa gccgggtatc ggattctaca ctgcccagtt cgaccttgac 2640

ctcccgaagg gctgggatgt gccgctgtac ttcaactttg gcaacaacac ccaggcggct 2700

cgggcccagc tctacgtcaa cggttaccag tatggcaagt tcactggaaa cgttgggcca 2760

cagaccagct tccctgttcc cgaagggatc ctgaactacc gcggaaccaa ctatgtggca 2820

ctgagtcttt gggcattgga gtcggacggt gctaagctgg gtagcttcga actgtcctac 2880

accaccccag tgctgaccgg atacggggat gttgagtcac ctgagcagcc caagtatgag 2940

cagcggaagg gagcatac 2958

<210> 2

<211> 2958

<212> DNA

<213> Aspergillus oryzae

<400> 2

tccatcaagc accgtttgaa tggtttcact atcctggagc atccagatcc tgctaaaaga 60

gacttgctgc aagacattgt tacttgggac gacaaatctt tgttcatcaa cggagagaga 120

attatgttat tctctggaga agttcaccct ttcagattgc cagttccttc tttgtggctt 180

gatatcttcc acaagatcag agctcttggt ttcaactgtg tctctttcta cattgactgg 240

gctcttttgg agggtaagcc tggtgactac agagctgagg gtatcttcgc tctggaacct 300

ttcttcgacg ctgccaagga ggctggtatt tacttgatcg ccagaccagg ttcttacatc 360

aacgccgagg tctccggtgg tggtttccct ggttggttgc aaagagtcaa tggtaccctt 420

agatcctctg acgagccatt cttgaaggct actgacaact acatcgccaa cgccgctgct 480

gccgtcgcta aggctcaaat caccaatggt ggtccagtta ttttgtacca gccagaaaac 540

gagtactccg gtggctgttg tggtgtcaaa tacccagatg ctgactacat gcagtacgtt 600

atggatcaag ccagaaaggc tgacattgtt gtccctttca tctctaacga tgcctctcct 660

tctggtcaca acgctcctgg atccggaact ggtgctgttg acatttacgg tcacgattcc 720

tatccattgg gttttgactg cgctaaccca tccgtatggc cagagggtaa attgccagac 780

aacttccgta cgttgcacct tgagcaaagc ccatccactc catattcttt gcttgagttc 840

caagctggtg ctttcgaccc atggggtggt ccaggttttg aaaaatgtta cgccttggtt 900

aaccacgagt tctcgagagt tttctacaga aacgacttgt ctttcggtgt ttctaccttt 960

aacttataca tgactttcgg tggtactaac tggggtaact tgggacatcc aggtggatac 1020

acttcctacg actacggttc ccctattact gaaaccagaa acgttaccag agagaagtac 1080

tccgacatta agttgcttgc caactttgtc aaagcatctc catcctactt gaccgctact 1140

ccaagaaacc tgactactgg tgtttacact gacacctctg acttggctgt caccccatta 1200

atgggtgact ccccaggttc cttcttcgtc gtcagacaca cggactactc ctctcaagag 1260

tcaacctcct acaaattgaa gcttcctacc tctgctggta acctgactat tccacagttg 1320

gagggcactc taagtttgaa cggtcgtgac tctaaaattc acgttgttga ttacaatgtt 1380

tctggaacta acattatcta ctctaccgct gaggtcttca cctggaagaa gtttgacggt 1440

aacaaggtct tggttttata cggtggacca aaggaacacc acgaattggc cattgcctcc 1500

aagtcaaacg tgaccatcat cgaaggttct gactctggaa ttgtctccac cagaaagggt 1560

tcttctgtta tcattggttg ggacgtctct tctactcgta gaatcgttca agtcggtgac 1620

ttgagagtct tcttgcttga cagaaactct gcttacaact actgggtccc agaattgcca 1680

acagaaggta cttctcccgg gttctccact tccaagacta ccgcctcctc cattattgtc 1740

aaggccggtt acttgctcag aggtgctcac ctggacggtg ctgatttgca ccttactgct 1800

gatttcaacg ccaccacccc aattgaagtt atcggtgctc caactggtgc caagaatttg 1860

ttcgtcaacg gtgaaaaggc ttcccacacc gtcgacaaga acggtatctg gtccagtgag 1920

gtcaagtacg ctgctccaga gatcaagttg ccaggtttga aggacttgga ctggaagtac 1980

ctggacaccc ttccagagat taagtcttcc tacgatgact ctgcctgggt ttccgcagac 2040

ttgccaaaga ccaagaacac tcaccgtcct cttgacactc caacatcctt gtactcctct 2100

gactacggtt tccacactgg ttacttgatc tacagaggtc acttcgttgc caacggtaag 2160

gaatccgaat tctttattag aactcaaggt ggttccgcat tcggaagttc cgtttggttg 2220

aacgagacct acctgggttc ttggactggt gccgattacg ctatggacgg taactctacc 2280

tacaagttgt ctcaactcga gtctggcaag aattacgtca tcactgttgt tattgataac 2340

ctgggtttgg acgagaactg gactgtcggc gaggaaacca tgaagaaccc tcgtggtatt 2400

ttgagctaca agttgtccgg acaagacgcc tccgctatca cctggaagtt gactggtaac 2460

ctcggtggag aagactacca agacaaggtt agaggacctc tcaacgaagg tggactgtac 2520

gctgagagac aaggtttcca tcaacctcaa cctccatccg aatcctggga gtccggttct 2580

ccacttgaag gtttgtctaa gccaggtatc ggattctaca ctgcccaatt cgaccttgac 2640

ttgccaaagg gttgggatgt cccattgtac ttcaacttcg gtaacaacac ccaagctgct 2700

cgggcccaat tgtacgtcaa cggttaccaa tacggtaagt tcactggaaa cgttggtcca 2760

caaacctcct tccctgttcc agaaggtatc ttgaactaca gaggaaccaa ctacgttgca 2820

ttgagtttgt gggctttgga gtccgacggt gctaagctgg gttccttcga attgtcctac 2880

accaccccag ttttgaccgg atacggtgac gttgagtctc ctgagcagcc aaagtacgag 2940

cagagaaagg gagcttac 2958

Claims (13)

1. Sumylact L optimized gene, is characterized in that: its nucleotides sequence is classified as shown in SEQ ID No.1.

2. contain the recombinant expression vector of Sumylact L optimized gene described in claim 1.

3. recombinant expression vector according to claim 2, is characterized in that: described recombinant expression vector is recombinant eukaryon expression vector.

4. recombinant expression vector according to claim 3, is characterized in that: described recombinant eukaryon expression vector is recombinant yeast expression vector.

5. recombinant expression vector according to claim 4, is characterized in that: described recombinant yeast expression vector is recombinant yeast pichia pastoris (Pichia pastoris) expression vector.

6. a host cell, is characterized in that: contain the recombinant expression vector of claim 2-5 described in any one.

7. host cell according to claim 6, is characterized in that: described host cell is yeast cell.

8. host cell according to claim 7, is characterized in that: described host cell is pichia spp (Pichia pastoris) cell.

9. the application of Sumylact L optimized gene claimed in claim 1 in Restruction Sumylact L.

10. application according to claim 9, is characterized in that, comprising: being connected and obtaining recombinant expression vector with expression vector the Sumylact L optimized gene operability shown in SEQ ID NO.1; By described recombinant expression vector transformed host cell, obtain recombinant bacterial strain; Cultivate recombinant bacterial strain, the expression of induction restructuring Sumylact L, reclaims and the expressed restructuring Sumylact L of purifying.

11. application according to claim 10, is characterized in that: described recombinant expression vector is recombinant eukaryon expression vector; Described host cell is yeast.

12. application according to claim 11, is characterized in that: described recombinant expression vector is recombinant yeast expression vector; Described yeast is pichia spp (Pichia pastoris) cell.

13. application according to claim 12, is characterized in that: described recombinant yeast expression vector is restructuring yeast expression vector.