CN116024219A

CN116024219A - Termite black-bone antibacterial peptide Oftermicin2 gene and application thereof

Info

Publication number: CN116024219A
Application number: CN202111256412.8A
Authority: CN
Inventors: 汤方; 丰凯
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2021-10-27
Filing date: 2021-10-27
Publication date: 2023-04-28
Anticipated expiration: 2041-10-27
Also published as: CN116024219B

Abstract

The invention discloses a targeted silencing black wing soil termite antibacterial peptideOftermicin2The dsRNA of the gene and the application thereof in termite control. Wherein, the black wing soil termitesOftermicin2The nucleotide sequence of the gene is SEQ ID NO:1. the invention is based on antibacterial peptidesOftermicin2The gene designs dsRNA, establishes the black wing soil termite by feeding methodOftermicin2RNA interference system and obtains obvious gene silencing effect in the black wing termite feedingOftermicin2RNAi technology applications provide technical support. In addition, the present patent utilizes established subterranean termitesOftermicin2RNA interference system for controlling black wing soil termiteOftermicin2The dsRNA is combined with biocontrol bacteria, so that the control effect of biocontrol bacteria can be obviously improved. The invention lays a theoretical foundation for the development of human and animal safety immunosuppressants, provides a new theory for biological control of pests, and finally provides a new strategy and a new approach for pest control for green agricultural production and sustainable development in China.

Description

Termite black-bone antibacterial peptide Oftermicin2 gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an Oftermitis melanogaster antibacterial peptide Oftermisin 2 gene and application thereof.

Background

Termites are one of the most well known pests in the world, a social insect, and have strong fertility and viability. Mainly endangering house construction, agriculture and forestry crops, reservoir earth dams, cable bridges, traffic facilities and the like, and frequently carrying out corrosion on non-cellulose substances. The black wing subterranean termite Odontotermes formosanus (Shiraki) belongs to higher termites, and is one type of subterranean termite. Most of the time the activity is underground. The bark, shallow woody layers and roots are mainly harmed by workers. The outer part of the damaged trunk forms a large ant road, and the growth vigor declines. When the tree enters the xylem, the trunk withers; especially for seedlings, death is very easy to occur. The mud is used as mud cover and mud line when the food is harmful, and the mud cover is formed by surrounding the whole dry body when the food is serious, and the characteristics are obvious. Subterranean termites are the primary pests of reservoirs and river dams and can often cause dam leakage, slumping and breach (Li Dong, et al, 2001; cai Banghua, et al, 1965; xu Zhenhai, 2004; xu Zhide, et al, 2007). Because the nest of the black wing subterranean termite is very hidden, the damage caused by the black wing subterranean termite is not easily detected, and when the damage is detected, the damage is very huge. In addition, the black wing soil termites are more omnivorous and have wider hazard range, and can be harmful to more than 100 plants including camphor trees, fir trees, magnolia grandiflora, maple and the like (Huang Qiu, etc.; 2005).

At present, the prevention and treatment of the black wing termites still mainly depend on the traditional chemical pesticides, but the problems of medicament residues and the like are increasingly serious, and the black wing termites have potential threat to human and animal health and ecological environment. Therefore, it is imperative to discover new biological control methods and to explore new control strategies for subterranean termites. RNA interference (RNAi) refers to the phenomenon of silencing target gene expression in eukaryotes by inducing homologous mRNA degradation from double-stranded RNA (ds RNA), and is generally performed by introducing exogenous dsRNA or small interfering RNA (small interfering RNA, si RNA) in studies of insect gene function. RNAi can achieve sustainable control of pest populations by selectively interfering with the expression of insect key genes, and is expected in the field of pest control. Insect antimicrobial peptides (antimicrobial peptides, AMPs) are a class of polypeptide substances with broad-spectrum antimicrobial activity that appear in the haemolymph of insects when they are infected with external stimuli or microorganisms. They are generally composed of 10-50 amino acid residues, are positively charged, amphiphilic, cationic, water-soluble polypeptides, and are linear or have a cyclic structure, which is formed by linking one or more pairs of dipeptide amino acid residues. In fully metamorphosed insects, the antimicrobial peptides are rapidly synthesized and secreted into the haemolymph by the fat body and various epithelial cells, whereas in non-fully metamorphosed insects, the antimicrobial peptides are first synthesized in healthy insect blood cells and secreted into the haemoglobins after being stimulated or infected. Silencing the gene can reduce the termite's ability to resist infection by pathogenic microorganisms, ultimately leading to their death, and therefore, it is expected that dsRNA is designed for antimicrobial peptide genes for termite control by RNA interference techniques.

Disclosure of Invention

The invention aims to provide an application of dsRNA of a black wing subterranean termite offtermicin 2 gene in termite control. The inventor discovers that the gene of the subterranean termite Oftermicin2 is designed based on the gene and is introduced into termites for the first time, so that the subterranean termites can be effectively prevented and treated.

Specifically, the invention provides an antibacterial peptide Oftermicin2 gene of black wing soil termite, and the nucleotide sequence of the Oftermicin2 gene is shown as SEQ ID NO:1. The corresponding amino acid sequence is shown as SEQ ID NO: 2.

The invention further provides application of the Oftermicin2 gene in termite control.

Meanwhile, the invention provides an Oftermicin2dsRNA for preventing termites, which consists of SEQ ID NO:1, and the nucleotide sequence shown in the specification.

The invention also provides DNA encoding the above-mentioned Oftermicin2 dsRNA.

Further, the present invention provides a recombinant expression vector comprising the DNA encoding dsRNA described above.

The invention also provides a host bacterium for transforming the recombinant expression vector.

In another aspect, the invention features a method of controlling termites, comprising the steps of:

as another method for controlling termites, termites can be co-fed with Oftermicin2dsRNA and serratia marcescens SM1, wherein the dsRNA consists of the amino acid sequence as set forth in SEQ ID NO:1, and the nucleotide sequence shown in the specification.

The beneficial effects are that: the invention designs dsRNA based on immune recognition protein Oftermicin2 gene, researches and establishes a feeding method to perform an Oftermicin2 RNA interference system, obtains obvious gene silencing effect when fed to the Alftermicin, and provides theoretical basis for Oftermicin2 RNAi technology application. Meanwhile, by constructing a dsRNA expression system using HT115 strain, the interference cost is reduced. The invention successfully interferes the expression of the immune recognition protein Oftermicin2 gene by using the system, and discovers that the sensitivity of the Oftermicin2 gene-silenced black-termitid to Serratia marcescens SM1 strain is obviously improved. Experiments show that the use of the Oftermicin2dsRNA and SM1 simultaneously improves the death rate of termites obviously, which proves that the control effect of biocontrol bacteria can be improved. The application provides a theoretical basis for the application of the Oftermicin2dsRNA in termite control.

Drawings

FIG. 1 is a view of total RNA electrophoresis of subterranean termites;

FIG. 2 shows the cloning sequence and deduced amino acid sequence of Oftermicin2;

FIG. 3 shows the amount of Oftermicin2 expressed after Serratia marcescens treatment of Solanum nigrum;

FIG. 4 is a graph showing the results of electrophoresis of recombinant plasmids L4440-dsOftermicin2 and L4440-dsGFP, wherein 1 is L4440-dsGFP and 2 is L4440-dsOftermicin2;

FIG. 5 shows the result of dsRNA electrophoresis, wherein 1 is dsGFP and 2 is dsOftermicin2;

FIG. 6 shows the relative expression levels of the target gene 6h after dsRNA feeding, wherein: different lower case letters represent significant differences between treatments;

FIG. 7 is a survival analysis after 6h of dsRNA treatment, wherein ABCDE is 14, 24, 34, 44, 54h, respectively; f is survival analysis graph, dashed line is time of treatment with SM 1.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

Experimental materials and methods involved in the examples:

(1) Test insects: the black wing soil termite is collected from period holding city of Jiangsu province, and after being collected back, the termite nest is placed in an insect incubator under the dark condition of 27 ℃ for breeding.

(2) Culture of Serratia marcescens SM1

Culture medium: bacterial basal medium (g/L): peptone 10g, beef extract 20g, naCl 2g, K ₂ HPO ₄ 2g, 18g of agar with pH of 7.2-7.4.

Bacterial seed medium (g/L): peptone 10g, yeast extract 20g, naCl 2g, K ₂ HPO ₄ 2g。

Bacterial fermentation medium (g/L): peptone 10g, soybean oil 30g, naCl 2g, K ₂ HPO ₄ 2g。

The separated Serratia marcescens strain SM1 is transferred into a bacterial basal medium, cultured for 24 hours under the dark condition of 27 ℃, and single colony is obtained after streak separation. The single colony was taken out, placed in a 250mL conical flask containing 50mL of seed culture medium after sterilization, and cultured in a constant temperature shaker at 30℃and 200r/min for 12 hours, followed by seed liquid culture. Then, 70ml of the seed solution after the cultivation was added to 250ml of the fermentation medium, and the mixture was cultured in a shaking incubator at a rotation speed of 200r/min for 36 hours at a temperature of 30℃and taken out for use after the cultivation.

(3) Determination of Serratia marcescens SM1 fermentation broth concentration

Within a certain range, as the number of cells in Serratia marcescens SM1 fermentation broth increases, so does the OD600 value.

The present invention will be described in further detail with reference to the following specific examples, which will aid in understanding the present invention, but the scope of the present invention is not limited to the following examples.

EXAMPLE 1 cloning of the Oftermicin2 Gene

(1) Primer design: according to the sequence of the Oftermicin2 obtained by transcriptome data, primer5 software is used for designing a primer:

Oftermicin2F：CCAAACCTGCAACAAAGC；

Oftermicin2R:TTGGCTTGTAAGAACAAACTGC。

(2) Amplification of cDNA and TA cloning:

trizol method extracts total RNA from termites.

Total RNA extraction results from black-wing termites (see fig. 1). The OD260/OD280 ratio of the RNA detected by the nucleic acid detector is 1.855 and is 1.8-2.0, which indicates that the quality of the RNA is qualified, and the next experiment can be carried out.

cDNA was synthesized by reverse transcription using total RNA as a template and referring to TaKaRa First Strand cDNA Synthesis Kit. The reverse transcription system is shown in Table 1.

TABLE 1

The cDNA is used as a template, and primer Oftermicin2F, oftermicin R is used for amplification to obtain 267bp fragment, the sequence is shown as SEQ ID NO.1, the full-length sequence comprises a 186bp open reading frame, and 62 amino acid polypeptides are encoded, as shown in figure 2. The PCR amplification reaction system is shown in Table 2, and the PCR amplification reaction conditions are: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 56℃for 30s, extension at 72℃for 30s, for a total of 35 cycles; finally, the extension is carried out for 10min at 72 ℃. PCR amplified products were detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. And (5) purifying and recycling the PCR products identified to be correct through a gel recycling kit. The TA cloning conditions are shown in Table 3. The gel recovery product was ligated with pClone007 at room temperature for 1-5min, the ligation product transformed into e.coli DH5 a competent cells, the ligation product transformed:

(1) E.coli DH5 alpha competent cells are taken out from a refrigerator at the temperature of minus 80 ℃ and dissolved in ice water;

(2) Adding 10uL of the ligation product into 100uL E.coli DH5α competent cells by using a pipette, and ice-setting for 30min;

(3) Heat shock is carried out for 45s in a water bath at 42 ℃, and the obtained product is immediately placed in ice water for standing for 2min after being taken out;

(4) Adding a liquid culture medium of SOC or LB, and carrying out shaking culture at 37 ℃ and 200rpm for 1h;

(5) 200uL of bacterial liquid is coated on LB solid medium containing Amp penicillin (final concentration 50 mug/mL), and the culture is inverted and carried out overnight in a 37 ℃ incubator.

The transformation product is cultivated in LB (amp+) solid medium for 12-16 h. Positive clones were selected, identified by bacterial liquid PCR, and the recombinant plasmid containing the correct insert was designated pClone007-Oftermicin2 and sequenced by the company.

TABLE 2

TABLE 3 Table 3

EXAMPLE 2 Induction of expression of Oftermicin2 by Serratia marcescens SM1 on subterranean termites

Contamination experiment: filter paper was first laid on the bottom of each 6cm dish and wetted with water. And then placing 20 head black wing soil termite workers with better activity and mature development into the culture dish. Each concentration (2.139X 10) was measured using Serratia marcescens SM1 fermentation medium as control (ck) ¹¹ cells/ml、2.139×10 ¹⁰ cells/ml、2.139×10 ⁹ cells/ml) were dropped on the subterranean termites using a 0.12. Mu.L micropipette, and each group was repeated three times. After dripping, placing in dark environment at 25deg.C, observing and collecting samples, collecting samples at 3, 6, 12, and 24 hr respectively, and placingPlacing at-80deg.C for preservation.

As shown in FIG. 3, it was found by fluorescent quantitative experiments that the concentration was 2.139X 10 ⁹ After cells/ml of SM1 is used for treating the black wing termites, the Oftermicin2 is obviously up-regulated in the treatment of 3 hours, 6 hours and 12 hours; with a concentration of 2.139X 10 ¹⁰ After cells/ml of SM1 is used for treating the black wing termites, the Oftermicin2 is obviously up-regulated in 3 hours, 6 hours and 12 hours, and the expression level is obviously down-regulated in 24 hours; 2.139 ×10 ¹¹ After cells/ml of SM1 is used for treating the black wing termites, the expression quantity of Oftermicin2 is up-regulated only at 6h and 12h, and the expression quantity is obviously down-regulated at 24 h.

EXAMPLE 3 Synthesis and inducible expression of dsRNA of termite Oftermicin2 Gene

(1) Primer design of dsRNA of termite Oftermicin2 gene.

The potential RNAi target site is predicted at 6 bp-182 bp of Oftermicin2 through on-line software. According to the sequence of the Oftermicin2 obtained by cloning, primer5 software is used for designing a primer:

dsOftermicin2F：ATTTGCGGCCGC AAGACCGTTACTAGCCTACTTGT；

dsOftermicin2R：CCCAAGCTTT GCCGTTAGGATTATACACACAT，

and upstream and downstream of the enzyme cutting sites NotI and HindIII (bold letters are enzyme cutting sites, italics are protective bases). Meanwhile, the primers for designing GFP are as follows:

dsGFP F：ATCGGAGCTCAGTTGAACGGATCCATCTTCA；

dsGFP R：CCCAAGCTTAGAACTTTTCACTGGA，

and upstream and downstream, restriction sites (SacI) and HindIII were introduced. All primers were synthesized by Tianjin Optimu Biotechnology Co.

(2) Synthesis of dsRNA of termite Oftermicin2 gene.

PCR amplification is carried out by using the full-length plasmid pClone007-Oftermicin2 with correct sequencing as a template and using designed upstream and downstream primers dsOftermicin2F and dsOftermicin2R for synthesizing dsRNA; the PCR amplification reaction conditions were: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 49℃for 30s, extension at 72℃for 30s, for a total of 35 cycles; finally, the extension is carried out for 10min at 72 ℃. PCR amplified products were detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. And (5) purifying and recycling the PCR products identified to be correct through a gel recycling kit.

(3) Construction of dsRNA expression vectors.

The 500bp fragment was cloned using the existing GFP nucleic acid sequence in the laboratory as template. And the target fragment and the L4440 vector are linked after enzyme digestion, so that the L4440-dsOftermicin2 and L4440-dsGFP recombinant plasmid are successfully constructed. The results of the electrophoresis of the L4440-dsOftermicin2 and L4440-dsGFP recombinant plasmids are shown in FIG. 4, wherein 1 is L4440-dsGFP and 2 is L4440-dsOftermicin2.

Specifically, taking L4440-dsOftermicin2 as an example, carrying out double digestion on the PCR product with NotI and HindIII, and recovering a target fragment; simultaneously, the two enzymes are used for double enzyme digestion of the expression vector L4440, and the target vector is recovered. The target fragment double cleavage system and the vector double cleavage system are shown in tables 4 and 5, respectively. The target fragment and the target vector are connected for 16h at 16 ℃ under the action of T4DNA ligase. The ligation product was transformed into E.coli DH 5. Alpha. Competent cells, LB (double antibody against ampicillin and tetracycline) solid medium for 12h. After positive clones were selected and identified by restriction enzyme, the recombinant plasmid containing the correct insert was designated as L4440-dsOftermicin2 and was sequenced by company.

TABLE 4 Table 4

TABLE 5

(4) Induction expression and extraction of dsRNA.

HT115 strain dsRNA containing L4440-dsOftermicin2 and L4440-dsGFP recombinant plasmids are respectively subjected to induction expression (figure 5), target bands are 183bp and 500bp, the expected sizes of the dsOftermicin2 and the dsGFP are consistent, and the construction of the interference vector is successful. The total RNA after induction of expression was then digested with DNase I and RNase A.

Taking L4440-dsOftermicin2 as an example, a recombinant plasmid of properly sequenced L4440-dsOftermicin2 was transformed into HT115 (DE 3) competent bacteria, and coated on a plasmid containing ampicillin (50. Mu.g. Multidot.mL) ^-1 ) And tetracycline (12.5. Mu.g.mL) ^-1 ) The double antibody is cultured on LB solid medium at 37 ℃ in an inverted way overnight. The monoclonal was inoculated into an ampicillin-containing medium (50. Mu.g. ML) ^-1 ) And tetracycline (12.5. Mu.g.mL) ^-1 ) In LB liquid medium of double antibody, 37 ℃,220 r.min ^-1 When the culture was performed with shaking until the OD600 of the bacterial liquid was about 0.5-0.6, IPTG (final concentration of 0.8 mM) was added, the culture was continued with shaking at 37℃for 220 r.min-1 for 3 hours, and then dsRNA was extracted with TaKaRa RNAiso Plus. dsRNA was digested using RNAse H and DNAse I. Quantification was performed using Eppendorf BioSpectrometer basic to give a final concentration of 1. Mu.g/. Mu.L. Storing in-80 deg.c refrigerator for use.

Example 4 detection of the amount of Oftermicin2 expressed after RNAi.

The dsRNA of Oftermicin2 was first mixed with Nile Blue and 400. Mu.l was then added dropwise to the filter paper at the bottom of a 6cm dish. The treatment group was 1. Mu.g/. Mu.L of dsOftermicin2 (dsOftermicin 2), and the control group was dsGFP and 20% Nile Blue in water (ck). 20 termites were added to each dish and each group was repeated 3 times. Placing in dark environment at 25deg.C, observing and collecting sample at 6 hr, collecting termite with blue intestinal tract, and storing at-80deg.C.

The genes were subjected to a fluorescent quantitative PCR (qRT-PCR) experiment to examine the changes in the expression levels of the genes at different times. The fluorescent quantitative primers were as follows (RPS 18 and GAPDH as reference genes):

q-Oftermicin2 F：CCGTTACTAGCCTACTTGTCTTT

q-Oftermicin2 R：GTCCATCACAGAACGCTCTTA

q-RPS18F：ATGGCAAACCCCCGTCAGTA

q-RPS18R：CATACCACGATGCGCACGAA

q-GAPDHF：TCGTATTGGCCGTCTTGTGC

q-GAPDHR：AGCGACCATGGGTGGAATCAT；

the fluorescent quantitative PCR reaction system is as follows:

the reaction procedure:

95℃30s

{95℃5s，60℃34s}30cycles

{95℃15s，60℃1min，95℃15s}

experimental design 3 biological replicates. After Ct values of the target gene and the reference gene were obtained, 2 was used ^-ΔΔt The method calculates the relative expression amount of mRNA of the target gene. And performing significant difference analysis on the obtained data by using InStat software.

In order to detect the change of the expression quantity of the target gene under sampling at different intervals after the feeding of the Oftermicin2dsRNA, the control group and the treatment group of the black wing termite cDNA samples are subjected to real-time fluorescence quantitative PCR detection, and the result shows that the interference efficiency is 71.84% after 6 hours after the feeding of the dsRNA, and the relative expression quantity of the target gene is obviously lower than that of the other two groups (figure 6).

Example 5 variation of sensitivity of subterranean Solanum nigrum to Serratia marcescens SM1 after RNAi

dsRNA was first mixed with Nile Blue and 400. Mu.L was then added dropwise to the filter paper at the bottom of a 6cm dish. The treatment group was 1. Mu.g/. Mu.L of dsOftermicin2, and the control group was dsGFP and 20% Nile Blue in water. And selecting the highest time for down-regulating the Oftermicin2 expression quantity to start the bioassay. 20 termites were added to each dish and each group was repeated 3 times. The bioassay experiments were performed by setting the normal fermentation medium treatment (CK), SM1 treatment (CK-SM 1), dsGFP treatment (dsGFP), SM1 treatment after dsGFP interference (dsGFP-SM 1), dsOftermicin2 treatment (dsOftermicin 2), and SM1 treatment after dsOftermicin2 interference (dsOftermicin 2-SM 1). The data were observed and recorded in a dark environment at 25 ℃.

After feeding dsOfermicin 26 h to the black-fin termites, carrying out SM1 infection experiments, and carrying out biological measurement to find that the survival rate of the black-fin termites after RNAi is obviously reduced compared with that of the black-fin termites without RNAi, and analyzing data for 14, 24, 34, 44 and 54h, wherein the death rate of dsOfermicin 2 groups treated by SM1 is highest at 14h, 24h and 34h and respectively reaches about 10%, about 50% and about 90%; at 44h and 54h, mortality was 100% for dsOftermicin2 treated with SM1, with mortality reaching around 50% for both the CK group treated with SM1 and the dsGFP group treated with SM1, higher than for the control group (CK group and dsGFP group) but lower than for dsOftermicin2 group treated with SM 1.

It is also evident from the survival curves that the survival rate of SM1 treated dsOftermicin2 group was significantly lower than that of the control group (CK group and GFP group) (fig. 7).

In conclusion, the technology of propagating dsRNA by bacteria is utilized for the first time to synthesize the subterranean termite Oftermicin2dsRNA, a subterranean termite Oftermicin2 RNA interference system by a feeding method is established, and obvious gene silencing effect is obtained when the subterranean termite is fed in the subterranean termite, so that technical support is provided for the application of the subterranean termite Oftermicin2 RNAi technology. The system is used for successfully interfering the expression of the antibacterial peptide Oftermicin2 gene, and the fact that the sensitivity of the Oftermicin2 gene-silenced black-termicin to Serratia marcescens SM1 strain is obviously improved is found. Experiments show that the use of the Oftermicin2dsRNA and SM1 simultaneously improves the death rate of termites obviously, which proves that the control effect of biocontrol bacteria can be improved. The application provides a theoretical basis for the application of the Oftermicin2dsRNA in termite control. The invention lays a theoretical foundation for the development of human and animal safety immunosuppressants, provides a new theory for biological control of pests, and finally provides a new strategy and a new approach for pest control for green agricultural production and sustainable development in China.

The invention provides a termite control thought and method, the method and the way of realizing the technical scheme are a plurality of, the above is only the preferred embodiment of the invention, it should be pointed out that a plurality of improvements and modifications can be made by the person skilled in the art without departing from the principle of the invention, and the improvements and modifications are also considered as the protection scope of the invention. The components not explicitly described in this embodiment can be implemented by using the prior art.

Sequence listing

<110> university of Nanjing forestry

<120> subterranean termite antibacterial peptide Oftermicin2 gene and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 189

<212> DNA

<213> nucleotide sequence of Oftermicin2 Gene (Artificial Sequence)

<400> 1

atgaagaccg ttactagcct acttgtcttt ctggtcgtcg tctgcttgct cattgcacag 60

cacccggcag acgcagcctg cgacttccaa cagtgttggg ccacgtgcca ggcacagcac 120

caaatctact tcataagagc gttctgtgat ggacccgatt gcaaatgtgt gtataatcct 180

aacggctag 189

<210> 2

<211> 62

<212> PRT

<213> Oftermicin2 amino acid sequence (Artificial Sequence)

<400> 2

Met Lys Thr Val Thr Ser Leu Leu Val Phe Leu Val Val Val Cys Leu

1 5 10 15

Leu Ile Ala Gln His Pro Ala Asp Ala Ala Cys Asp Phe Gln Gln Cys

20 25 30

Trp Ala Thr Cys Gln Ala Gln His Gln Ile Tyr Phe Ile Arg Ala Phe

35 40 45

Cys Asp Gly Pro Asp Cys Lys Cys Val Tyr Asn Pro Asn Gly

50 55 60

<210> 3

<211> 18

<212> DNA

<213> Oftermicin2F(Artificial Sequence)

<400> 3

ccaaacctgc aacaaagc 18

<210> 4

<211> 22

<212> DNA

<213> Oftermicin2R(Artificial Sequence)

<400> 4

ttggcttgta agaacaaact gc 22

<210> 5

<211> 35

<212> DNA

<213> dsOftermicin2F(Artificial Sequence)

<400> 5

atttgcggcc gcaagaccgt tactagccta cttgt 35

<210> 6

<211> 32

<212> DNA

<213> dsOftermicin2R(Artificial Sequence)

<400> 6

cccaagcttt gccgttagga ttatacacac at 32

<210> 7

<211> 31

<212> DNA

<213> dsGFP F(Artificial Sequence)

<400> 7

atcggagctc agttgaacgg atccatcttc a 31

<210> 8

<211> 25

<212> DNA

<213> dsGFP R(Artificial Sequence)

<400> 8

cccaagctta gaacttttca ctgga 25

<210> 9

<211> 23

<212> DNA

<213> q-Oftermicin2 F(Artificial Sequence)

<400> 9

ccgttactag cctacttgtc ttt 23

<210> 10

<211> 21

<212> DNA

<213> q-Oftermicin2 R(Artificial Sequence)

<400> 10

gtccatcaca gaacgctctt a 21

<210> 11

<211> 20

<212> DNA

<213> q-RPS18F(Artificial Sequence)

<400> 11

atggcaaacc cccgtcagta 20

<210> 12

<211> 20

<212> DNA

<213> q-RPS18R(Artificial Sequence)

<400> 12

cataccacga tgcgcacgaa 20

<210> 13

<211> 20

<212> DNA

<213> q-GAPDHF(Artificial Sequence)

<400> 13

tcgtattggc cgtcttgtgc 20

<210> 14

<211> 21

<212> DNA

<213> q-GAPDHR(Artificial Sequence)

<400> 14

agcgaccatg ggtggaatca t 21

Claims

1. Antibacterial peptide of black wing soil termiteOftermicin2A gene, wherein theOftermicin2The nucleotide sequence of the gene is shown in SEQ ID NO:1.

2. The method of claim 1Oftermicin2The application of the gene in termite control.

3. A dsRNA for controlling termites, characterized in that it consists of SEQ ID NO:1, and the nucleotide sequence shown in the specification.

4. A DNA encoding the dsRNA of claim 2.

5. A recombinant expression vector comprising the DNA encoding the dsRNA of claim 4.

6. A host bacterium transformed with the recombinant expression vector of claim 5.

7. A method for controlling termites is characterized by usingOftermicin2Co-feeding termites with dsRNA and serratia marcescens SM1, wherein the dsRNA consists of the amino acid sequence as set forth in SEQ ID NO:1, and the nucleotide sequence shown in the specification.