CN113088520A - dsRNA (double-stranded ribonucleic acid) and application thereof in termite control - Google Patents
dsRNA (double-stranded ribonucleic acid) and application thereof in termite control Download PDFInfo
- Publication number
- CN113088520A CN113088520A CN202110356103.1A CN202110356103A CN113088520A CN 113088520 A CN113088520 A CN 113088520A CN 202110356103 A CN202110356103 A CN 202110356103A CN 113088520 A CN113088520 A CN 113088520A
- Authority
- CN
- China
- Prior art keywords
- dsrna
- gene
- termites
- orco
- termite
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
- A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
- A01K67/0337—Genetically modified Arthropods
- A01K67/0339—Genetically modified insects, e.g. Drosophila melanogaster, medfly
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/05—Animals modified by non-integrating nucleic acids, e.g. antisense, RNAi, morpholino, episomal vector, for non-therapeutic purpose
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/70—Invertebrates
- A01K2227/706—Insects, e.g. Drosophila melanogaster, medfly
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Abstract
The invention discloses dsRNA (double-stranded ribonucleic acid) and application thereof in termite control, belonging to the technical field of biology. The invention discloses an application of dsRNA of a olfactory co-receptor Orco gene of odontotermes formosanus or a gene fragment thereof in controlling termites, wherein the dsRNA designed based on the Orco gene is introduced into the bodies of the termites, so that the Orco gene expression is obviously reduced, the foraging success rate is obviously reduced, and the result shows that the foraging capability of the odontotermes formosanus can be effectively inhibited by reducing the expression quantity of the olfactory co-receptor Orco gene of the odontotermes formosanus, the food source and the energy supply of the termites are cut off, and the termite damage can be effectively controlled; the Orco gene obtained by cloning can be used as a molecular target for termite control, provides a new technology and a new method for green termite control, and has good application prospect.
Description
Technical Field
The invention relates to the field of biotechnology, relates to dsRNA (double-stranded ribonucleic acid) and application thereof in termite control, and particularly relates to dsRNA designed based on Orco gene of odontotermes formosanus and application thereof in termite control.
Background
The olfactory co-receptor Orco plays an important role in the perception of chemical signals in insects and is highly conserved among different insects (see Journal of Insect Science, 2018, 18 (6): 18). During foraging, individuals of termites need to collaborate through close information exchange to complete foraging activities, including food searching, food positioning, and foraging with nestling termites (see "Ecology Letters, 2017, 20 (2): 212-) -221). It follows that the release, sensing and transmission of chemical signals between individuals plays a critical role in termite foraging. Research has shown that the olfactory co-receptor Orco plays an important role in the process of olfaction. In ants, the deletion of the Orco gene can reduce the olfactory sensitivity and cause abnormal behaviors (see Cell, 2017, 170 (4): 727-735).
Termites are social insects which are older than ants, have a 2.5 hundred million years of life history, are wide in distribution range and strong in adaptability, are usually concealed in behavior activities, and are not easy to perceive the harm. Foraging behavior is the primary behavior of the termite nest to obtain food and energy, and is also the fundamental behavior to sustain the development of individuals and populations. Meanwhile, foraging behavior is also an important way for termites to harm house buildings, garden trees and reservoir dams, which not only brings serious trouble to people's daily life, but also causes great loss to national economy. At present, the control of the termites mainly depends on the traditional chemical pesticide, but the chemical control can destroy the ecological environment and seriously threaten the health of people and livestock. Therefore, the development of new green termite prevention and control technology aiming at the particularity of termite damage activities is urgent.
In the foraging process of the termites, the workers move back and forth between the nest body and the food points by means of the trail pheromone, and more workers in the same nest are recruited to move to the food points to take the food. It is seen that the olfactory function plays a key role in the process of termites performing foraging activities. The RNAi technology can effectively inhibit the expression quantity of the Orco gene, so that the communication of chemical signals among the termite individuals is interfered, the foraging behavior of termite colonies is damaged, the food source and the energy supply of the termites can be cut off, and the termite damage can be effectively controlled. Therefore, based on the research and existing problems in the prior art, it is necessary to provide a new concept and a new method for controlling odontotermes formosanus.
Disclosure of Invention
The invention aims to provide dsRNA (double-stranded ribonucleic acid) and application thereof in termite control, wherein the dsRNA designed based on Orco genes of odontotermes formosanus is introduced into the termite body, so that the odontotermes formosanus can be effectively controlled.
In order to achieve the purpose, the invention provides the following scheme:
the invention provides an application of dsRNA of odontotermes formosanus olfaction co-receptor Orco gene or gene fragment thereof in controlling termites.
Preferably, the nucleotide sequence of the odontotermes formosanus olfaction co-receptor Orco gene is shown in SEQ ID NO: 1 is shown.
Preferably, the gene segment of the odontotermes formosanus olfaction co-receptor Orco gene is shown in SEQ ID NO: shown in fig. 8.
The invention also provides dsRNA for controlling termites, which is expressed by SEQ ID NO: 8 by transcription of the nucleotide sequence shown in the figure.
The invention also provides a DNA for coding the dsRNA, and the nucleotide sequence of the DNA is shown as SEQ ID NO: shown in fig. 8.
The invention also provides a recombinant expression vector comprising the DNA encoding dsRNA.
The invention also provides a host bacterium for transforming the recombinant expression vector.
The invention also provides a method for controlling termites, which comprises the following steps: the dsRNA is introduced into the termite body, and the Orco gene expression level in the termite body is obviously reduced; the dsRNA consists of the sequence set forth in SEQ ID NO: 8 is transcribed by the gene segment of the odontotermes formosanus olfaction coreceptor Orco gene.
The invention discloses the following technical effects:
the invention designs dsRNA based on a conserved sequence of a termite Olfactory co-receptor gene Olfactory receptor (Orco) cDNA of the odontotermes formosanus, and inhibits the expression quantity of the Orco gene in the termite body by using RNAi technology. According to the invention, by blocking key genes of the olfaction system of the odontotermes formosanus, the frequency and the accumulated time of the odontotermes formosanus entering the food area are both obviously reduced, which indicates that the foraging success rate of the odontotermes formosanus is obviously reduced, so that the foraging capability of the odontotermes formosanus is inhibited, and the effect of preventing and controlling the odontotermes formosanus is finally achieved. The method can be applied to prevention and control of the odontotermes formosanus by the RNAi technology, and has the characteristics of strong specificity, excellent effect, environmental friendliness and the like.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without inventive exercise.
FIG. 1 is a graph showing the effect of dsRNA injection on the expression level of Orco gene mRNA in odontotermes formosanus; wherein, the termites injected with dsGFP are used as a control group, and the termites injected with dsRNA are used as a treatment group; beta-actin and GAPDH as reference genes; bar graph data mean ± standard deviation, denotes P < 0.01;
FIG. 2 is a graph of the effect of dsRNA injection on termite entry frequency into food areas; wherein, the termites injected with dsGFP are used as a control group, and the termites injected with dsRNA are used as a treatment group; bar graph data mean ± standard deviation, denotes P < 0.01;
FIG. 3 is a graph of the effect of dsRNA injection on the cumulative time that termites enter a food area; wherein, the termites injected with dsGFP are used as a control group, and the termites injected with dsRNA are used as a treatment group; bar graph data mean ± standard deviation, P < 0.05;
FIG. 4 is a map of a recombinant vector.
Detailed Description
The present invention will now be described in detail by way of examples, which should not be construed as limiting the invention but as providing more detailed descriptions of certain aspects, features and embodiments of the invention.
The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
EXAMPLE 1 cloning of Orco Gene sequences of Termite Black wing
1. Design of specific primers for RACE amplification
Searching is carried out from a transcriptome database of the odontotermes formosanus, and then sequence alignment is carried out by using NCBI Nucleotide-BLAST, so as to determine that 1 termite Orco gene fragment is obtained. Based on the Orco gene fragment obtained by the search, the following specific primers were designed online using NCBI Primer-BLAST:
3' -RACE gene specific primer I: TGGACACTGTGGTGCCTAACTCCG (SEQ ID NO: 2);
3' -RACE gene specific primer II: AGTGTACACATTGGCCCAGGTGTTTC (SEQ ID NO: 3);
5' -RACE gene specific primer I: TGGTGGTCCAGGCAAACCCGCT (SEQ ID NO: 4);
5' -RACE gene specific primer II: ACTGCCATTGCATGGTGACGCGA (SEQ ID NO: 5).
The designed primer is sent to Wuhan engine biotechnology limited company for synthesis.
2. Preparation of template for RACE amplification
5 mature workers with consistent size and good growth condition are selected and put into a 2mL centrifugal tube, the tube is placed in liquid nitrogen to rapidly cool the sample, and total RNA is extracted by adopting an RNAioso Plus (Trizol) method. Subsequently, RACE templates required for full-length cloning of the Orco gene were synthesized according to the protocol of the SMARTER RACE cDNA Amplification Kit.
3. Cloning of full-Length sequence of Orco Gene
The RACE template prepared above and the designed specific primer are used for amplification to obtain the full-length sequence of the odontotermes formosanus Orco gene, and a PCR reaction system comprises: mu.L of gold medal Mix, 2. mu.L of forward and reverse primers (10. mu.M) each, and 1. mu.L of RACE template. PCR reaction procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 15sec, renaturation extension at 72 ℃ for 20sec, 38 cycles; extension at 72 ℃ for 5 min. And detecting by 1% agarose gel electrophoresis.
Use kit
The Gel Extraction Kit recovered the PCR product. The recovered DNA fragment was introduced into pMD18-T vector by T-A cloning to construct recombinant vector pMD18-T-Orco (shown in FIG. 4); meanwhile, pMD18-T-Orco is transferred into Trans-T1 competent cells and inoculated on an LB solid culture medium containing the benzyl-resistant bacteria for culture, and then white single colonies are picked and inoculated into an LB liquid culture medium containing the benzyl-resistant bacteria for continuous culture. And (3) sending the bacterial liquid containing the detected target band to Wuhan Pongzhike biotechnology limited company for sequencing, comparing a sequencing result with an NCBI database to obtain a complete sequence of the gene, wherein the nucleotide length is 1737bp, and the nucleotide sequence is SEQ ID NO: 1, or a fragment thereof.
Example 2 Synthesis of Orco Gene dsRNA of Termite Black wing
1. Primer required for synthesizing Orco gene dsRNA of odontotermes formosanus
Nucleotide sequence based on odontotermes formosanus Orco gene SEQ ID NO: 1, respectively designing an upstream primer 5'-TAACTCCGCAGACCTGTTCC-3' (SEQ ID NO: 6) and a downstream primer 5 'GAATTTGGCTCCAGAGATGC-3' (SEQ ID NO: 7) both containing a T7 promoter (GGATCCTAATACGACTCACTATAGGG), and sending the designed primers to Wuhan Pongziaceae biotechnology Limited for synthesis.
2. Preparation of template for Orco Gene dsRNA Synthesis
Combining primers required by dsRNA synthesis, which all contain a T7 promoter, with plasmids containing an Orco gene for PCR amplification, wherein a PCR reaction system comprises: mu.L of gold medal Mix, 2. mu.L of forward and reverse primers (10. mu.M) each, and 1. mu.L of cDNA template. PCR reaction procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10sec, annealing at 60 ℃ for 15sec, renaturation extension at 72 ℃ for 10sec, 38 cycles; extension at 72 ℃ for 5 min. Obtaining a DNA fragment with the length of 577bp, wherein the nucleotide sequence is SEQ ID NO: 8 (both ends contain the T7 promoter). The PCR product was purified using phenol/chloroform/isoamyl alcohol (25: 24: 1) as a template for Orco gene dsRNA synthesis.
3. Synthesis of Orco Gene dsRNA
And (2) preparing a reaction system in an enzyme-free PCR tube by using the synthesized dsRNA template to carry out in-vitro transcription synthesis on dsRNA, wherein the transcription reaction program comprises the following steps: reacting at 37 ℃ for 4h, adding DNase I, and reacting at 37 ℃ for 30 min. And (3) measuring the concentration and purity of the dsRNA by using an ultraviolet spectrophotometer, detecting the quality of the dsRNA by agarose gel electrophoresis, and storing the dsRNA in a refrigerator at the ultralow temperature of-80 ℃ for later use.
Example 3 detection of interference Effect of Orco Gene dsRNA of Termite Black wing
1. Injection of termite Orco gene dsRNA
40 mature workers with consistent size and good growth condition are picked for dsRNA injection. After the white ants are subjected to cryoanesthesia on ice, injection is carried out at the membrane between the second thoracic node and the third thoracic node on the side surface of the chest of the worker ant. dsRNA in a volume of 150nL and a total amount of 2-3 mug was introduced into the bodies of odontotermes formosanus by microinjection. The termites were fed in a 9cm diameter dish, which had 7.5% glucose-wetted filter paper as the food. 20 termites injected with dsRNA served as the treatment group, and 20 termites injected with an equal amount of dsGFP served as the control group.
2. Detecting the expression quantity of mRNA of Orco gene fragment of termite
After 2d of dsRNA injection, 5 good termites were selected from the treated group and the control group, respectively, and used as a biological replicate to measure the mRNA expression level of the Orco gene fragment.
Total RNA was extracted by the RNAioso Plus (Trizol) method. The extracted RNA was reverse transcribed with reference to the PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) Kit instructions. Subsequently, the mRNA expression levels of the target gene Orco and the reference genes β -actin and GAPDH were detected by using the Real-time PCR method, and the interference efficiency of the dsRNA of the Orco gene was analyzed. Each treatment set 9 biological replicates from 3 different nests.
The results show that the mRNA expression data do not fit a normal distribution. Therefore, when the termites injected with dsRNA were tested using Wilcoxon test, the expression level of Orco gene in the termites was found to be significantly reduced (as shown in fig. 1, n ═ 9 and P ═ 0.008).
Example 4 Effect of Orco Gene dsRNA on termite entry frequency into food area
1. Special foraging behavior testing device for black-wing soil termites
The termite foraging behavior test device consists of a disc with the diameter of 300mm, and wet filter paper is paved at the bottom. The 'Y' profile (the length of the line is 100mm) with the center as the center and an angle of 120 degrees is drawn. Optimal doses of trace information elements were drawn evenly on the left and middle "Y" lines using a microsyringe, and the right "Y" line was compared with the same dose of hexane. A filter paper having a diameter of 2mm and impregnated with 7.5% glucose was used as food areas and placed near the intersections of the extensions of the left and right ends of the "Y" shape and the edges of the apparatus, respectively.
2. Detecting termite frequency of entering food area
When the experiment is started, 10 termites are placed at the intersection point of the extension line of the Y-shaped middle line of the test field and the edge, an EthoVision XT track tracking system is used for carrying out real-time tracking and quantitative determination on the behavior track of the termites injected with dsRNA, shooting is stopped after 15min, and data is collected to analyze the frequency of the termites entering the food area. Termites injected with dsRNA were treated, and termites injected with the same amount of dsGFP were control. Each treatment set 6 biological replicates from 3 different nests.
The result shows that the frequency data of the termites entering the food area conform to normal distribution, and the independent sample T test is adopted to analyze the data difference significance; termites injected with dsRNA entered the food area at a significantly lower frequency than the control group (F ═ 0.243 and P ═ 0.003 as shown in fig. 2).
Example 5 Effect of Orco Gene dsRNA on cumulative time to termite entry into food area
1. Special foraging behavior testing device for black-wing soil termites
The termite foraging behavior test device consists of a disc with the diameter of 300mm, and wet filter paper is paved at the bottom. The 'Y' profile (the length of the line is 100mm) with the center as the center and an angle of 120 degrees is drawn. Optimal doses of trace information elements were drawn evenly on the left and middle "Y" lines using a microsyringe, and the right "Y" line was compared with the same dose of hexane. A filter paper having a diameter of 2mm and impregnated with 7.5% glucose was used as food areas and placed near the intersections of the extensions of the left and right ends of the "Y" shape and the edges of the apparatus, respectively.
2. Detecting cumulative time of termite entering food area
When the experiment is started, 10 termites are placed at the intersection point of the extension line of the Y-shaped middle line of the test field and the edge, an EthoVision XT track tracking system is used for tracking and quantitatively measuring the behavior track of the termites injecting dsRNA in real time, shooting is stopped after 15min, and data is collected to analyze the accumulated time of the termites entering the food area. Termites injected with dsRNA were treated, and termites injected with the same amount of dsGFP were control. Each treatment set 6 biological replicates from 3 different nests.
The result shows that the data of the accumulated time when the termites enter the food area conform to normal distribution, and the data difference significance is analyzed by adopting independent sample T test; the cumulative time for dsRNA-injected termites to enter the food area was significantly reduced compared to the control group (as shown in fig. 3, F-0.014, P-0.010).
From the results of examples 4-5, it can be seen that the frequency and the cumulative time of entering the food area by termites injected with dsRNA are both significantly reduced, thereby indicating that the foraging success rate of the termites is reduced and the foraging capacity of the termites is significantly inhibited after the Orco gene is silenced by the RNAi technology.
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> university of agriculture in Huazhong
<120> dsRNA and application thereof in termite control
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1737
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcagtggtat caacgcagag tacatgggga tagtagaagc tgctgacatg tagcctcaac 60
aatttcgtct ctttatgagt gtcttttgtt tgactttaat tgaaaaaaag taatttgatt 120
gccatctgtt aggtctatat ttaagtttgt tttttataac ttttaaagtt gtgtgaagtg 180
aggcgctaca ttataaaaga tgtacaagtt caggttacac ggtctggtcg cggacttgtg 240
gccgctgatc agaatcatgc aaatgaccgg cttctttttg ctggactatc acgaagacat 300
gagcttcggc tggacatcca tcaggaccgg gtacgcttca actgtgtctt gtttcatggt 360
catacaatac ctgctcttat tcatcaacct catgaagcaa gccgaagatg tcaatgacct 420
gacagccaac acgatcaccg tacttttctt cctccattcg ctgataaaat ttttctactt 480
tgcgatccgt cgcgccaagt tctaccgaac tttggcaaca tggaacaacg ccaacagcca 540
tccgttgttt tccgaaaacc aatcgcgtca ccatgcaatg gcagtcacta gcatgaggcg 600
tctggtcatg tacgtgggca tcggcatcat cctcagcggg tttgcctgga ccaccatcac 660
cttcttcgga gagagtgtgc acaaaataaa ggacccagat aatttgaatg agactatttt 720
agaggaggta ccgcgtctca tgctacgttc gtggtatccc tggaatgcta tgtctggcgg 780
aggatacgtc gtgtccttca tcatccagat cctgtggcta tttctggctc tgtcacatgc 840
catgatgatg gacactatgt tctgctgttg gctcatctac acgtgtgagc aactcattca 900
tctgaaagag atcatgaagc cgctgatgga gctcagttca tcgctggaca ctgtggtgcc 960
taactccgca gacctgttcc gtgccgccag caccaatacc aacgctgctg taccttcagg 1020
tgatggtgag ggtattcgag ctatatacag caaccagcac gacttctcca atttccgact 1080
gaatacaggc acccttgtca acgtaaacag tggctctatt ggaccaaacg gactgacaaa 1140
gaaacaggag ctcctagtac ggtccgccat caagtactgg gtggagagac acaaacacgt 1200
ggttcgattc gtcagtaata ttggagacac gtacgggtcg gcactgctgc tacatatgct 1260
gaccagcaca gtgacattga cactgctcgc ctaccaggcc acgaagattg acactgtaga 1320
tgtctatgcc tgcaccgtga tcggctatct agtgtacaca ttggcccagg tgtttctctt 1380
ctgcttcttt ggcaaccgtc tcatcgagga gagctcatca gtgatggagg ctgcctacag 1440
cagtcagtgg tatgacgggt cggaggaaac caagactttt atccagattg tatgtcaaca 1500
atgtcagaaa ccaatgagca tctctggagc caaattcttc acagtgtcgc tcgatttgtt 1560
tgcttcggtt cttggtgctg tagtgaccta cttcatggtg ctggtacagc tcaactagac 1620
cgatacgtaa atgatgctga gatgacagta accattattc tactccaaaa catgtgtatt 1680
acacttagct aactgacaac atgtcgcgtc gaacacaaaa aaaaaaaaaa aaaaaaa 1737
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tggacactgt ggtgcctaac tccg 24
<210> 3
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agtgtacaca ttggcccagg tgtttc 26
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tggtggtcca ggcaaacccg ct 22
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
actgccattg catggtgacg cga 23
<210> 6
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggatcctaat acgactcact atagggtaac tccgcagacc tgttcc 46
<210> 7
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ggatcctaat acgactcact ataggggaat ttggctccag agatgc 46
<210> 8
<211> 577
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
taactccgca gacctgttcc gtgccgccag caccaatacc aacgctgctg taccttcagg 60
tgatggtgag ggtattcgag ctatatacag caaccagcac gacttctcca atttccgact 120
gaatacaggc acccttgtca acgtaaacag tggctctatt ggaccaaacg gactgacaaa 180
gaaacaggag ctcctagtac ggtccgccat caagtactgg gtggagagac acaaacacgt 240
ggttcgattc gtcagtaata ttggagacac gtacgggtcg gcactgctgc tacatatgct 300
gaccagcaca gtgacattga cactgctcgc ctaccaggcc acgaagattg acactgtaga 360
tgtctatgcc tgcaccgtga tcggctatct agtgtacaca ttggcccagg tgtttctctt 420
ctgcttcttt ggcaaccgtc tcatcgagga gagctcatca gtgatggagg ctgcctacag 480
cagtcagtgg tatgacgggt cggaggaaac caagactttt atccagattg tatgtcaaca 540
atgtcagaaa ccaatgagca tctctggagc caaattc 577
Claims (8)
1. Application of dsRNA of odontotermes formosanus olfaction co-receptor Orco gene or gene fragment thereof in controlling termites.
2. The use of claim 1, wherein the nucleotide sequence of the odontotermes formosanus olfactory co-receptor Orco gene is as set forth in SEQ ID NO: 1 is shown.
3. The use of claim 1, wherein the nucleotide sequence of the gene fragment of the odontotermes formosanus olfaction co-receptor Orco gene is as shown in SEQ ID NO: shown in fig. 8.
4. A dsRNA for controlling termites consisting of a sequence as set forth in SEQ ID NO: 8 by transcription of the nucleotide sequence shown in the figure.
5. A DNA encoding the dsRNA of claim 4.
6. A recombinant expression vector comprising the DNA encoding dsRNA of claim 5.
7. A host bacterium transformed with the recombinant expression vector of claim 6.
8. A method of controlling termites, comprising the steps of: the dsRNA is introduced into the termite body, and the Orco gene expression level in the termite body is obviously reduced; the dsRNA consists of the sequence set forth in SEQ ID NO: 8 is transcribed by the gene segment of the odontotermes formosanus olfaction coreceptor Orco gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110356103.1A CN113088520A (en) | 2021-04-01 | 2021-04-01 | dsRNA (double-stranded ribonucleic acid) and application thereof in termite control |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110356103.1A CN113088520A (en) | 2021-04-01 | 2021-04-01 | dsRNA (double-stranded ribonucleic acid) and application thereof in termite control |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113088520A true CN113088520A (en) | 2021-07-09 |
Family
ID=76672751
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110356103.1A Pending CN113088520A (en) | 2021-04-01 | 2021-04-01 | dsRNA (double-stranded ribonucleic acid) and application thereof in termite control |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113088520A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116286818A (en) * | 2023-02-16 | 2023-06-23 | 北京林业大学 | dsRNA of target anoplophora glabripensis olfactory coexpression receptor gene and application thereof |
| CN117106052B (en) * | 2023-09-28 | 2024-02-06 | 广东省农业科学院植物保护研究所 | Application of dopamine transporter in regulation and control of individual division of solenopsis invicta workers |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105755003A (en) * | 2016-04-05 | 2016-07-13 | 中国农业科学院植物保护研究所 | SiRNA based on Sitobion avenae SaveOrco gene design and application thereof |
| US20160286807A1 (en) * | 2010-10-25 | 2016-10-06 | Vanderbilt University | Composition for inhibition of insect host sensing |
| CN107529746A (en) * | 2015-03-25 | 2018-01-02 | 范德比尔特大学 | Binary composition as the sense of smell agent interfering of ORCO mediations |
| CN110468131A (en) * | 2019-08-13 | 2019-11-19 | 华南师范大学 | DsRNA, encoding gene based on the design of American cockroach Orco gene and the preparation method and application thereof |
-
2021
- 2021-04-01 CN CN202110356103.1A patent/CN113088520A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160286807A1 (en) * | 2010-10-25 | 2016-10-06 | Vanderbilt University | Composition for inhibition of insect host sensing |
| CN107529746A (en) * | 2015-03-25 | 2018-01-02 | 范德比尔特大学 | Binary composition as the sense of smell agent interfering of ORCO mediations |
| CN105755003A (en) * | 2016-04-05 | 2016-07-13 | 中国农业科学院植物保护研究所 | SiRNA based on Sitobion avenae SaveOrco gene design and application thereof |
| CN110468131A (en) * | 2019-08-13 | 2019-11-19 | 华南师范大学 | DsRNA, encoding gene based on the design of American cockroach Orco gene and the preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| YONGYONG GAO等: "Silencing Orco Impaired the Ability to Perceive Trail Pheromones and Affected Locomotion Behavior in Two Termite Species", 《JOURNAL OF ECONOMIC ENTOMOLOGY》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116286818A (en) * | 2023-02-16 | 2023-06-23 | 北京林业大学 | dsRNA of target anoplophora glabripensis olfactory coexpression receptor gene and application thereof |
| CN116286818B (en) * | 2023-02-16 | 2023-10-13 | 北京林业大学 | dsRNA of target anoplophora glabripensis olfactory coexpression receptor gene and application thereof |
| CN117106052B (en) * | 2023-09-28 | 2024-02-06 | 广东省农业科学院植物保护研究所 | Application of dopamine transporter in regulation and control of individual division of solenopsis invicta workers |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113088520A (en) | dsRNA (double-stranded ribonucleic acid) and application thereof in termite control | |
| CN104610440B (en) | Applications of the ABC transporter gene ABCH1 and its specific dsRNA in diamondback moth preventing and treating and Bt resistance managements | |
| CN110468131B (en) | dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana Orco gene, coding gene, preparation method and application thereof | |
| CN106754948B (en) | Nilaparvata lugens NlMLP gene, encoding protein and application thereof | |
| CN108823212B (en) | American cockroach amputation regenerates correlation Wingless signal path gene and its application of dsRNA | |
| Li et al. | Single-cell RNA sequencing reveals the landscape of maize root tips and assists in identification of cell type-specific nitrate-response genes | |
| CN104513863A (en) | Insect pest detecting method for tobaccos based on DNA bar codes | |
| CN111748533B (en) | Termite SelT gene and application of dsRNA (double-stranded ribonucleic acid) thereof in combination with metarhizium anisopliae in termite control | |
| CN105755003B (en) | SiRNA and its application based on the design of grain aphid Sitobion avenae olfactory receptor SaveOrco gene | |
| CN113234724B (en) | dsRNA (double-stranded ribonucleic acid) for preventing and treating termites and application thereof | |
| CN110951730B (en) | dsRNA of cryptopteris viridis V-ATPase-A gene, artificial feed and application thereof | |
| CN109182548A (en) | Detect the primer and method of Agasicles hygrophila GR gene expression characteristics | |
| CN114478735A (en) | Aphid high-lethal gene and application thereof in aphid prevention and treatment | |
| CN113122546A (en) | SeBP gene of odontotermes formosanus and application of dsRNA thereof in combining metarhizium anisopliae in termite control | |
| CN105695467B (en) | The siRNA of conservative olfactory receptor Orco gene design based on grain aphid Sitobion avenae and its application | |
| CN105647927A (en) | Potato stu-miR156 member and application thereof | |
| CN110511933A (en) | A kind of rat long-chain non-coding lncRNA-lncMSTRG10078 and its application for resisting cellular damage | |
| CN109913480A (en) | A kind of locust uridine diphosphate glucuronatetransferase gene and its application | |
| CN108753791A (en) | The application of green plant bug decapentaplegic genes and its RNAi in pest control | |
| CN113881679B (en) | miR-71-5 mimic for enhancing termite killing effect of metarhizium anisopliae | |
| CN104059979B (en) | For the identification of the multiple PCR primer of leopard and method and their application in qualification leopard | |
| CN105695468B (en) | The siRNA of conserved sequence design based on grain aphid Sitobion avenae olfactory receptor SaveOrco and its application | |
| CN113881683B (en) | Migratory locust zen gene dsRNA and application thereof | |
| CN110628771B (en) | Kit for preventing and treating harmonia axyridis | |
| CN109777803A (en) | A kind of gene ZSWa significantly increasing cell ABCC1 gene expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210709 |
|
| RJ01 | Rejection of invention patent application after publication |