CN113234724A - dsRNA (double-stranded ribonucleic acid) for preventing and treating termites and application thereof - Google Patents

Abstract

The invention discloses dsRNA (double-stranded ribonucleic acid) for preventing and treating termites and application thereof, and relates to the technical field of biology; the invention designs dsRNA for preventing and controlling termites based on the conserved sequence of cDNA of blue light receptor Cry2 genes of odontotermes formosanus and odontotermes formosanus, wherein the dsRNA is dsRNA-1 or dsRNA-2; wherein the dsRNA-1 consists of a sequence as shown in SEQ ID NO: 10 is transcribed; the dsRNA-2 consists of a sequence shown as SEQ ID NO: 13 is transcribed; according to the termite control method, the key genes in a termite magnetic induction mechanism are blocked, so that the magnetic orientation behavior of the termites disappears, and the movement turning angle is also obviously increased, so that the foraging orientation and the homing capability of the termites are interfered, and the effect of controlling the termites is finally achieved. The invention can be applied to the prevention and treatment of termites by the RNAi technology, and the prevention and treatment technology has the characteristics of strong specificity, excellent effect and the like for preventing and treating the termites.

Description

dsRNA (double-stranded ribonucleic acid) for preventing and treating termites and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to dsRNA (double-stranded ribonucleic acid) for preventing and treating termites and application thereof.

Background

Termites feed on various celluloses, and are one of insects which can efficiently degrade lignocellulose in natural environment. Termite has wide food habits, and the harm of the termite relates to various aspects closely related to human life, such as agriculture, forestry, water conservancy, transportation, house construction and the like. Termites have long been controlled by various methods including liquid poisoning, powder poisoning, nest digging, bait trapping, and light trapping. Although the above methods have some effects in termite control, the current chemical control methods relied upon can severely damage the ecological environment and threaten human health safety. Therefore, the development of new techniques and methods for termite control has become an urgent need in the field of termite control.

Termites living in a concealed environment can go out to forage and return to nests orderly. After the termites are out for foraging, the termites must return to the nest to provide food for other grades, and the accurate out-foraging and homing capacity of the termites is important for the survival of the whole nest group (see Animal identification, 2020, 23: 1051-.

Accordingly, based on the research and problems in the prior art, it is necessary to provide a new technology capable of controlling termites, and there is no report on controlling termite damage by interfering with the foraging orientation and homing ability of termites.

Disclosure of Invention

The invention aims to provide dsRNA for controlling termites and application thereof, so as to solve the problems in the prior art.

In order to achieve the above objects, the present invention provides a dsRNA for controlling termites, which is dsRNA-1 or dsRNA-2; wherein the dsRNA-1 consists of a sequence as shown in SEQ ID NO: 10 is transcribed; the dsRNA-2 consists of a sequence shown as SEQ ID NO: 13 is transcribed.

The invention also provides a template DNA for synthesizing the dsRNA-1 or dsRNA-2, wherein the nucleotide sequence of the template DNA of the dsRNA-1 is shown as SEQ ID NO: 10 is shown in the figure; the nucleotide sequence of the template DNA of the dsRNA-2 is shown as SEQ ID NO: shown at 13.

The invention also provides a use of said dsRNA or said template DNA, said use comprising any one of:

(1) the dsRNA or the template DNA is applied to the prevention and the treatment of termites;

(2) the dsRNA or the template DNA is applied to the preparation of a termite control product;

(3) the dsRNA or the template DNA is applied to the interference of termite magnetic orientation behavior;

(4) the dsRNA or the template DNA is applied to the preparation of a product interfering the magnetic directional behavior of the termites;

(5) the dsRNA or the template DNA is applied to interfere the foraging orientation and the homing capability of the termites;

(6) the dsRNA or the template DNA is applied to the preparation of a product for interfering the foraging orientation and the homing ability of the termites;

(7) the use of said dsRNA or said template DNA for reducing termite motion turning;

(8) the dsRNA or the template DNA is applied to the preparation of a product for reducing the movement turning angle of termites.

The invention also provides a method for preventing and controlling termites, interfering with the magnetic directional behavior of the termites, interfering with the foraging orientation and the homing capacity of the termites or increasing the movement turning angle of the termites, which comprises the following steps: introducing the dsRNA into the termite body.

The invention discloses the following technical effects:

the invention designs dsRNA based on the conserved sequences of cDNA of blue light receptor Cry2 genes of odontotermes formosanus and odontotermes formosanus, and can effectively inhibit the expression quantity of the Cry2 genes of the termites through RNAi technology. According to the termite control method, the key genes in a termite magnetic induction mechanism are blocked, so that the magnetic orientation behavior of the termites disappears, and the movement turning angle is also obviously increased, so that the magnetic orientation behavior and the movement capability of the termites are interfered, the foraging orientation and the homing capability of the termites are damaged, and the effect of controlling the termites is finally achieved. The invention can be applied to the prevention and treatment of termites by the RNAi technology, and the prevention and treatment technology has the characteristics of strong specificity, excellent effect, environmental friendliness and the like.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without inventive exercise.

FIG. 1 shows the effect of dsRNA injection on the expression level of Cry2 gene in odontotermes formosanus (A) and odontotermes formosanus (B) respectively; wherein, the termites injected with dsGFP are used as a control group, and the termites injected with dsCry2 are used as a treatment group; beta-actin and NADH are used as reference genes; bar graph data mean ± standard deviation, denotes P < 0.01;

FIG. 2 is a graph of the effect of dsRNA injection on the magnetic alignment behavior of odontotermes formosanus (A, B) and odontotermes formosanus (C, D), respectively; wherein, the termites injected with dsCry2 are treated group (A, C), and the termites injected with dsGFP are control group (B, D); dots represent the average orientation vector for each termite, arrows represent the average orientation vector for all tested termites, P <0.05 indicates orientation preference;

FIG. 3 is a graph of the effect of dsRNA injection on locomotor activity in odontotermes formosanus (A) and odontotermes formosanus (B); wherein, the termites injected with dsCry2 are treated groups, and the termites injected with dsGFP are control groups; data are mean ± standard deviation, P <0.05, P < 0.01.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in further detail below.

Example 1 cloning of Termite Black wing Cry2 Gene sequence

1.1 design of specific primers for Cry2 Gene amplification

Searching is carried out from a transcriptome database of the odontotermes formosanus, and then sequence alignment is carried out by using NCBI Nucleotide-BLAST, so as to determine that 1 termite Cry2 gene fragment is obtained. From the Cry2 gene fragment obtained by the search, the following specific primers were designed online using NCBI Primer-BLAST:

3' Gene-specific primers: TCGCCCTAAAATGACACCTC (SEQ ID NO: 2);

5' Gene-specific primers: CATTATGAACGCGGGAAGCAG (SEQ ID NO: 3);

the designed primer is sent to Wuhan engine biotechnology limited company for synthesis.

1.2 cloning of Termite Plumbaria Furcata Cry2 Gene sequence

Using the above-described SEQ ID NO: 2-3 specific primers are amplified to obtain a termite prototheca fuliginea Cry2 gene sequence.

And (3) PCR reaction system: mu.L of gold medal Mix, 2. mu.L of forward and reverse primers (10. mu.M) each, and 1. mu.L of RACE template. PCR reaction procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 15sec, renaturation extension at 72 ℃ for 20sec, 38 cycles; extension at 72 ℃ for 5 min. And detecting by 1% agarose gel electrophoresis.

Use kit

The Gel Extraction Kit recovered the PCR product. Introducing the recovered DNA fragment into a pMD18-T vector through T-A cloning to construct a recombinant vector; meanwhile, the recombinant vector is transferred into Trans-T1 competent cells and inoculated on an LB solid culture medium containing the benzyl resistance for culture, and then white single colonies are picked and inoculated into an LB liquid culture medium containing the benzyl resistance for continuous culture. And (3) sending the bacterial liquid containing the detected target band to Wuhan Pongzhike biotechnology limited company for sequencing, comparing the sequencing result with an NCBI database to obtain a complete sequence of the gene, wherein the nucleotide length is 2,160bp, and the nucleotide sequence is SEQ ID NO:1, or a fragment thereof.

Example 2 cloning of Termite Black Sclerotium Cry2 Gene sequence

2.1 design of specific primers for Cry2 Gene amplification

Searching is carried out from a transcriptome database of the odontotermes formosanus, and then sequence alignment is carried out by using NCBI Nucleotide-BLAST, so as to determine that 1 termite Cry2 gene fragment is obtained. From the Cry2 gene fragment obtained by the search, the following specific primers were designed online using NCBI Primer-BLAST:

3' Gene-specific primers: CGTGCTCATCGTTTTCAGTATG (SEQ ID NO: 5);

5' Gene-specific primers: GCAGCTCAGAAGCAGATTTCC (SEQ ID NO: 6);

the designed primer is sent to Wuhan engine biotechnology limited company for synthesis.

2.2 cloning of the Termite Black Sclerotium Cry2 Gene sequence

Using the above-described SEQ ID NO: 5-6 specific primer amplification is carried out to obtain the Scopolia formosana Cry2 gene sequence.

And (3) PCR reaction system: mu.L of gold medal Mix, 2. mu.L of forward and reverse primers (10. mu.M) each, and 1. mu.L of RACE template. PCR reaction procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10sec, annealing at 58 ℃ for 15sec, renaturation extension at 72 ℃ for 20sec, 38 cycles; extension at 72 ℃ for 5 min. And detecting by 1% agarose gel electrophoresis.

Use kit

The Gel Extraction Kit recovered the PCR product. Introducing the recovered DNA fragment into a pMD18-T vector through T-A cloning to construct a recombinant vector; meanwhile, the recombinant vector is transferred into Trans-T1 competent cells and inoculated on an LB solid culture medium containing the benzyl resistance for culture, and then white single colonies are picked and inoculated into an LB liquid culture medium containing the benzyl resistance for continuous culture. And (3) sending the bacterial liquid containing the detected target band to Wuhan Pongzhike biotechnology limited company for sequencing, comparing the sequencing result with an NCBI database to obtain a complete sequence of the gene, wherein the nucleotide length is 1,913bp, and the nucleotide sequence is SEQ ID NO: 4, or a sequence shown in the figure.

Example 3 Synthesis of dsRNA-1 of Termite species of Black wing Cry2 Gene

3.1 primers required for synthesizing dsRNA-1 of Termite species of Black wing Cry2 Gene

Nucleotide sequence based on the termite Cry2 gene of black wing is SEQ ID NO:1, respectively designing an upstream primer 5 '-GGATCCTAATACGACTCACTATA-GGGTCGCCCTAAAA TGACACCTC-3' (SEQ ID NO:8) and a downstream primer 5 '-ATCCTAATACGACTCACTATAGGGCACCACGGGTAAGAAAG-CAT-3' (SEQ ID NO:9) both containing a T7 promoter (GGATCCTAATACGACTCACTATAGGG (SEQ ID NO: 7)), and sending the designed primers to Wuhan Pongzi biotechnology limited company for synthesis.

3.2 preparation of templates for dsRNA-1 Synthesis of Cry2 Gene

Primers required for dsRNA-1 synthesis, both containing the T7 promoter, were combined with a plasmid containing the Cry2 gene for PCR amplification.

And (3) PCR reaction system: mu.L of gold medal Mix, 2. mu.L of forward and reverse primers (10. mu.M) each, and 1. mu.L of cDNA template. PCR reaction procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10sec, annealing at 60 ℃ for 15sec, renaturation extension at 72 ℃ for 10sec, 38 cycles; extension at 72 ℃ for 5 min. Obtaining a DNA fragment with the length of 398bp, wherein the nucleotide sequence is SEQ ID NO: 10 (both ends contain the T7 promoter). The PCR product was purified using phenol/chloroform/isoamyl alcohol (25: 24: 1) as a template for the synthesis of dsRNA-1 of Cry2 gene.

3.3 Synthesis of dsRNA-1 of Cry2 Gene

Preparing a reaction system in an enzyme-free PCR tube by using the synthesized dsRNA-1 template to perform in vitro transcription synthesis on the dsRNA-1, wherein the transcription reaction program comprises the following steps: reacting at 37 ℃ for 4h, adding DNase I, and reacting at 37 ℃ for 30 min. The quality of dsRNA-1 is detected by using 1% agarose gel electrophoresis, the concentration and the purity of dsRNA-1 are measured by using an ultraviolet spectrophotometer, and the dsRNA-1 is stored in an ultra-low temperature refrigerator at minus 80 ℃ for standby.

Example 4 Synthesis of dsRNA-2 of Sclerodonta nigripes Cry2 Gene

4.1 primers required for synthesizing Scopolia melanothorax Schott Cry2 gene dsRNA-2

Nucleotide sequence based on the termite Cry2 gene of black wing is SEQ ID NO: 4, respectively designing an upstream primer 5 '-GGATCCTAATACGACTCACTATAG-GGGAGGTGTCATTTTAGGGC-G-A-3' (SEQ ID NO:11) and a downstream primer 5 '-GGATCCTAATACGACTCACTATAGGGTTCAAGGAATGGGGC-ACTAC-3' (SEQ ID NO:12) both containing a T7 promoter (GGATCCTAATACGACTCACTATAGGG (SEQ ID NO: 7)), and sending the designed primers to Wuhan Pongzi biotechnology limited company for synthesis.

4.2 preparation of templates for dsRNA-2 Synthesis of Cry2 Gene

Primers required for dsRNA-2 synthesis, both containing the T7 promoter, were combined with a plasmid containing the Cry2 gene for PCR amplification.

And (3) PCR reaction system: mu.L of gold medal Mix, 2. mu.L of forward and reverse primers (10. mu.M) each, and 1. mu.L of cDNA template. PCR reaction procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10sec, annealing at 60 ℃ for 15sec, renaturation extension at 72 ℃ for 10sec, 38 cycles; extension at 72 ℃ for 5 min. Obtaining a DNA fragment with the length of 463bp, wherein the nucleotide sequence is SEQ ID NO: 13 (both ends contain the T7 promoter). The PCR product was purified using phenol/chloroform/isoamyl alcohol (25: 24: 1) as a template for the synthesis of dsRNA-2 of Cry2 gene.

4.3 Synthesis of dsRNA-2 of Cry2 Gene

Preparing a reaction system in an enzyme-free PCR tube by using the synthesized dsRNA-2 template to perform in vitro transcription synthesis on the dsRNA-2, wherein the transcription reaction program comprises the following steps: reacting at 37 ℃ for 4h, adding DNase I, and reacting at 37 ℃ for 30 min. The quality of dsRNA-2 is detected by using 1% agarose gel electrophoresis, the concentration and purity of dsRNA-2 are measured by using an ultraviolet spectrophotometer, and the dsRNA-2 is stored in an ultra-low temperature refrigerator at minus 80 ℃ for standby.

Example 5 detection of interference Effect of dsRNA of Termite Cooperia punctata and Termite Black Sclerotium Cry2 genes

5.1 introduction of dsRNA of Termite Cry2 Gene

Respectively selecting the white ant and white ant with consistent size and good growth condition for dsRNA injection, wherein the white ant is injected with dsRNA-1, and the white ant is injected with dsRNA-2. After cryoanesthesia on ice, injection is carried out at the membrane between the 1 st and the 2 nd thoracic nodes on the side of the chest of the worker ant. Mu.g of dsRNA was introduced into termites by microinjection. The termites after injection were housed in a petri dish with a diameter of 9 cm. Termites injected with dsRNA-1 or dsRNA-2 were used as the treatment group, and termites injected with an equal amount of dsGFP were used as the control group.

5.2 detecting the mRNA expression quantity of termite Cry2 gene segment

After 3d of dsRNA injection, 3 good termites were randomly selected from the treated group and the control group respectively as a biological repeat to detect the expression level of Cry2 gene mRNA.

Total RNA was extracted by the RNAioso Plus (Trizol) method. The extracted RNA was reverse transcribed with reference to the PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) Kit instructions. Subsequently, the mRNA expression amounts of the target gene Cry2 and the reference genes beta-actin and NADH are detected by using a Real-time PCR method, so that the interference efficiency of the Cry2 gene is analyzed. Each treatment set 9 biological replicates.

The results show that the mRNA expression data do not fit a normal distribution. Thus, using Wilcoxon test to test dsRNA injected termites, a significant decrease in Cry2 gene expression was found in termites (as shown in fig. 1A-B).

Example 6 Effect of dsRNA of Cry2 Gene on the magnetic orientation behavior of Termite

6.1 magnetic orientation behavior testing device for termite design

Termite magnetic orientation behavior test in an open circular behavior test device (diameter 30cm, height 1cm) with a moist filter paper (diameter 30cm) laid on the bottom, in order to prevent termites from not moving in the test device, moist filter paper (diameter 2cm) containing 7.5% glucose was placed in the test device in four directions (0 °, 90 °, 180 ° and 270 ° clockwise with respect to the direction of the geomagnetic field). The termite trajectories were recorded with infrared cameras (acA1920-40gc, germany). The video was subjected to quantitative analysis using the motion trajectory tracking system EthoVision-XT (Noldus Information Technology, the netherlands).

6.2 testing of magnetic Directional behavior of Termite

At the beginning of the experiment, test termites were placed in the behavior testing apparatus. Test termites were allowed to acclimate to the test environment for 1h before shooting and then tested in the test apparatus for 4 min. The termite trajectories were recorded with an infrared camera (acA1920-40gc, germany) and captured at a rate of 25 frames/second. Termite mean orientation was quantified on video using the motion trajectory tracking system EthoVision-XT (Noldus Information Technology, the netherlands). Termites injected with dsCry2 were treated and termites injected with an equal amount of dsGFP were control. Each treatment was repeated more than 30 times.

The results showed that the directional preference of two termites injected with dsCry2 disappeared (black-wing odontotermes formosanus: r ═ 0.124, p ═ 0.563; black-thorny termites: r ═ 0.09, p ═ 0.706 as shown in fig. 2A and 2C), but two termites injected with dsGFP had significant directional preference (black-wing odontotermes formosanus: r ═ 0.294, p ═ 0.021; black-thorny termites: r ═ 0.31, p ═ 0.011;). In addition, the termite injected with dsCry2 had a significantly higher turning angle of motion than the termite injected with dsGFP (black wing odontotermes formosanus: Z-2.43, df-81, p < 0.05; black thorny termites: Z-3.15, df-88, p <0.05 as shown in fig. 3A-B).

As can be seen from the results of example 6, termites injected with dsCry2 not only disappeared the magnetic orientation behavior, but also the turning angle of motion was significantly increased. Thus, the interference of the foraging orientation and the homing capability of the termites after the Cry2 gene is silenced by the RNAi technology is shown.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> university of agriculture in Huazhong

<120> dsRNA for preventing and treating termites and application thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2160

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgttgcacgc ggtgtgtaat gtgaaggtgt cgtgtacaga acagatgtaa agaaatttgg 60

cgtagaagat ttccattcgt tcgtgaactt tgtatttctc aggtgttcat cattttcagg 120

atgaaatgtg tgtcaagggc agttaatcat cagtgtcctg gctaaatcat tatgaacgcg 180

ggaagcagtg aaaagcacac cgtacattgg tttagaaagg gtcttcgttt acatgacaat 240

ccaagtttac gtgaaggatt gaagtcttct acgacattcc gttgtgtgtt cattttggac 300

ccttggtttg ctggctcatc aaatgtagga attaacaaat ggcgattcct gctacagtgt 360

ctggaagatt tggatcaaaa tttacgtaaa cttaactctc gtttatttgt aattcgtgga 420

caaccagcag atgctcttcc aaaactgttt aaggaatggg gcactacaaa cctcacattc 480

gaagaggatc ccgaaccctt tggatgggtc cgtgaccaga atattacggc catgtgcaaa 540

gaacttggca tcactgttat atccagagtt tctcacacct tgtaccagct cgaaactatc 600

atcaagaaga atggtggaaa agcccctctg acttatcatc aattccagac aatagtggca 660

tccatggaaa ccccaccacc aacagaacca actatcaacc aacatttcct taatggtacc 720

tacactccca ttggagaaga tcatgatgag aaatatggtg ttccaacact agaagaacta 780

ggttttgata cagatggtct tcttccacca gtatggaaag gaggggaatc ggaggcattg 840

gcgagactgg agaggcatct tgagcgaaaa gcttgggttg catcatttgg tcgccctaaa 900

atgacacctc agtcattact tgctagccaa acaggtctga gtccatatct aaggtttggt 960

tgcctttcta caagattatt ctactatcaa ctgacggatt tatataagaa gatcaagaag 1020

gcatatcccc ccctctctct ccatggtcaa cttctctggc gtgagttctt ctattgtgca 1080

gcaacaaaga atccaaactt tgacaaaatg agtggaaatc ccatttgtgt tcagattcca 1140

tgggacagga atgctgaagc tcttgcaaag tgggcaaatg gccaaactgg gtttccatgg 1200

attgatgcca taatgacaca acttcgacag gagggatgga ttcatcacat agcacggcat 1260

gctgttgcat gctttcttac ccgtggtgat ctctggatct cttgggaaga aggaatgaag 1320

gtgtttgaag aacttctgct ggatgctgat tggtctgtga atgctggcat gtggatgtgg 1380

ctgtcatgtt catctttctt tcagcaattt tttcattgct attgtccagt gcgctttgga 1440

cgcaaggctg accccaatgg agattacatt cgaaagtatc taccagtcct caagaacttc 1500

ccaacacgtt acatccatga accttggaat gcacctgaag ctgttcagaa agcagcaaaa 1560

tgcatcattg gaaaggagta ttctcttcct atggtaaacc atgcagttgc cagcagaatc 1620

aacattgagc gcatgaagca ggtttatcag cagctcagca aatacagagg accaggtttg 1680

ttagctactg tccctacaag ccagtcacgg acatcaaaca ctttgaaccc tacattagga 1740

cagaaagatt tccagaaatc ttcagaaact aagtgggagg ccttgcctgg tgttgatatt 1800

aatggatatt ctctagtaat ctgtgatgaa gattttaaga ctggaattca gtcctactgt 1860

tacaaatcac aaaataagga agaatatgaa taatgagact gatcaaaaag tgactgttga 1920

agtgaacagt atgcacacag tctgttattc aaatgagcaa tgctgtatga agcacaggat 1980

agtgaaaaat ggaaatctgc ttctgagctg cacattatgc atgtaggtct cattttaaac 2040

tatttcgttt tgcacgattt cactttaatg tgactaaaat ttacacaact ttttgaattt 2100

atgggatagt ttctgatgta atacagtgtg gcatacacga tccatggccg cttttgcctt 2160

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcgccctaaa atgacacctc 20

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cattatgaac gcgggaagca g 21

<210> 4

<211> 1913

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgtgctcatc gttttcagta tgaaatgtgt gtcaagggca gttaatcatc agtttcctgg 60

ctaagtcatt atgaacgcgg aaaatagtga aaagcatacc gtacattggc ttaggaaggg 120

acttcgttta catgacaatc caagtttacg tgaaggactg aactctgcta cgacattccg 180

ttgtgtgttc attttggacc cctggtttgc tggctcatca aatgtaggaa ttaacaaatg 240

gcgattcctc ctacaatgtc tggaagatct ggatcaaaat ttacgcaaac taaactctcg 300

cttatttgtg attcgtggac aaccagcaga tgctcttcca aaactattca aggaatgggg 360

cactacaaac ctcacattcg aagaggatcc cgaacccttt ggatgggtcc gtgaccagaa 420

tattgcggcc atgtgcaaag aacttggcat cactgttata tccagagttt ctcacacctt 480

gtaccagctc gaaactatca tcaagaagaa tggtggaaaa gcccctctga cttatcatca 540

attccagaca atagtggcat ccatggaaac cccaccacca gcagaaccaa ctatcaacca 600

acatttcctt aatggtacct acactcccat tggagaagat catgatgaga aatatggtgt 660

tccaacacta gaagaactag gttttgatac agatggtctt cttccaccag tatggaaagg 720

aggggaatcg gaggcattgg cgagactgga gaggcatctt gagcgaaaag cttgggttgc 780

atcatttggt cgccctaaaa tgacacctca gtcattactt gctagccaaa caggtctgag 840

tccatatcta aggtttggtt gcctttctac aagattattc tactatcaac tgacggattt 900

atataagaag atcaagaagg catatccccc cctctctctc catggtcaac ttctctggcg 960

tgagttcttc tattgtgcag caacaaagaa tccaaacttt gacaaaatga gtggaaatcc 1020

catttgtgtt cagattccat gggacaggaa tgctgaagct cttgcaaagt gggcaaatgg 1080

ccaaactggg tttccatgga ttgatgccat aatgacacaa cttcgacagg agggatggat 1140

tcatcacata gcacggcatg ctgttgcatg ctttcttacc cgtggtgatc tctggatctc 1200

ttgggaagaa ggaatgaagg tgtttgaaga acttctgctg gatgctgatt ggtctgtgaa 1260

tgctggcatg tggatgtggc tgtcatgttc atctttcttt cagcagtttt ttcattgcta 1320

ttgtccagtg cgctctggac gcaaggctga ccccaacgga gattacattc gaaagtatct 1380

gccagtcctc aggaacttcc caacacgtta catccatgaa ccatggaatg cacctgaagc 1440

tgttcaaaaa gcagcaaaat gcatcattgg aaaggagtat tctcttccta tggtaaacca 1500

tgcagttgcc agcagaatca acattgagcg gatgaagcag gtttatcagc aactgagcaa 1560

atacagagga ccaggtttgt tagctactgt ccctacaagc cagttacaga catccaacac 1620

tttgaaccct acattagtac agaaagattt ccagaaatcc ccatcatcag aaactaagtg 1680

ggaaaccttg tgtggtgatg atattaatgg atattctcta ataatctgtg atgatttcaa 1740

gactggaatt caatcctatt gttacaaatc acaaaaaaag gaatatgagt aatggggctg 1800

atcaacaagt gactgctgaa gtgaacagta tgcacacaat ctgttctgca aatgagcagt 1860

gctgtatgtg gcacagggta atgaaaaatg gaaatctgct tctgagctgc aca 1913

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgtgctcatc gttttcagta tg 22

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcagctcaga agcagatttc c 21

<210> 7

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggatcctaat acgactcact ataggg 26

<210> 8

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggatcctaat acgactcact atagggtcgc cctaaaatga cacctc 46

<210> 9

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggatcctaat acgactcact atagggcacc acgggtaaga aagcat 46

<210> 10

<211> 398

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcgccctaaa atgacacctc agtcattact tgctagccaa acaggtctga gtccatatct 60

aaggtttggt tgcctttcta caagattatt ctactatcaa ctgacggatt tatataagaa 120

gatcaagaag gcatatcccc ccctctctct ccatggtcaa cttctctggc gtgagttctt 180

ctattgtgca gcaacaaaga atccaaactt tgacaaaatg agtggaaatc ccatttgtgt 240

tcagattcca tgggacagga atgctgaagc tcttgcaaag tgggcaaatg gccaaactgg 300

gtttccatgg attgatgcca taatgacaca acttcgacag gagggatgga ttcatcacat 360

agcacggcat gctgttgcat gctttcttac ccgtggtg 398

<210> 11

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggatcctaat acgactcact ataggggagg tgtcatttta gggcga 46

<210> 12

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggatcctaat acgactcact atagggttca aggaatgggg cactac 46

<210> 13

<211> 463

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ttcaaggaat ggggcactac aaacctcaca ttcgaagagg atcccgaacc ctttggatgg 60

gtccgtgacc agaatattgc ggccatgtgc aaagaacttg gcatcactgt tatatccaga 120

gtttctcaca ccttgtacca gctcgaaact atcatcaaga agaatggtgg aaaagcccct 180

ctgacttatc atcaattcca gacaatagtg gcatccatgg aaaccccacc accagcagaa 240

ccaactatca accaacattt ccttaatggt acctacactc ccattggaga agatcatgat 300

gagaaatatg gtgttccaac actagaagaa ctaggttttg atacagatgg tcttcttcca 360

ccagtatgga aaggagggga atcggaggca ttggcgagac tggagaggca tcttgagcga 420

aaagcttggg ttgcatcatt tggtcgccct aaaatgacac ctc 463

Claims (4)

1. dsRNA for controlling termites, which is dsRNA-1 or dsRNA-2;

wherein the dsRNA-1 consists of a sequence as shown in SEQ ID NO: 10 is transcribed; the dsRNA-2 consists of a sequence shown as SEQ ID NO: 13 is transcribed.

2. A template DNA for synthesizing the dsRNA-1 or dsRNA-2 of claim 1, wherein the nucleotide sequence of the template DNA of dsRNA-1 is as shown in SEQ ID NO: 10 is shown in the figure; the nucleotide sequence of the template DNA of the dsRNA-2 is shown as SEQ ID NO: shown at 13.

3. Use of the dsRNA of claim 1 or the template DNA of claim 2, comprising any one of:

(1) use of the dsRNA of claim 1 or the template DNA of claim 2 for termite control;

(2) use of the dsRNA of claim 1 or the template DNA of claim 2 in the preparation of a termite control product;

(3) use of the dsRNA of claim 1 or the template DNA of claim 2 to interfere with termite magnetic orientation behavior;

(4) use of the dsRNA of claim 1 or the template DNA of claim 2 in the preparation of a product that interferes with the magnetic directional behavior of termites;

(5) use of the dsRNA of claim 1 or the template DNA of claim 2 to interfere with termite foraging orientation and homing ability;

(6) use of the dsRNA of claim 1 or the template DNA of claim 2 in the preparation of a product that interferes with termite foraging orientation and homing ability;

(7) use of the dsRNA of claim 1 or the template DNA of claim 2 for reducing termite motion turns;

(8) use of the dsRNA of claim 1 or the template DNA of claim 2 in the preparation of a termite motion corner reducing product.

4. A method of termite control, interfering with the magnetic directional behavior, interfering with the foraging orientation and homing capacity, or reducing the turning angle of termite movement, said method comprising: introducing the dsRNA of claim 1 into a termite body.

Images