CN115927349A

CN115927349A - Termite formosana gram-negative bacteria recognition protein GNBP2 gene and application thereof

Info

Publication number: CN115927349A
Application number: CN202111106318.4A
Authority: CN
Inventors: 汤方; 丰凯
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2021-09-22
Filing date: 2021-09-22
Publication date: 2023-04-07
Anticipated expiration: 2041-09-22
Also published as: CN115927349B

Abstract

The invention discloses dsRNA (double-stranded ribonucleic acid) of a target silent odontotermes formosanus gram-negative bacteria recognition protein GNBP2 gene and application thereof in termite control. Specifically, the nucleotide sequence of the odontotermes formosanus GNBP2 gene is SEQ ID NO:1. the application synthesizes the GNBP 2dsRNA of the odontotermes formosanus for the first time by utilizing the technology of bacteria propagation of the dsRNA, establishes a GNBP2 RNA interference system for the odontotermes formosanus by utilizing a feeding method, and finds that the single use of the GNBP 2dsRNA of the odontotermes formosanus for the first time has very high fatality rate to the termites. In addition, the GNBP 2dsRNA of the odontotermes formosanus is used in combination with the biocontrol bacteria, so that the control effect of the biocontrol bacteria can be obviously improved. Therefore, dsRNA is designed based on the GNBP2 gene of the immune recognition protein, a GNBP2 RNA interference system of odontotermes formosanus performed by a feeding method is established, obvious gene silencing effect is obtained in odontotermes formosanus by feeding, and technical support is provided for the application of the GNBP2 RNAi technology.

Description

Termite formosana gram-negative bacteria recognition protein GNBP2 gene and application thereof

Technical Field

The invention relates to the technical field of biology, and in particular relates to a odontotermes formosanus gram-negative bacteria recognition protein GNBP2 gene and application thereof.

Background

Termites are one of the most well-known pests in the world, are social insects, and have strong fecundity and viability. The main hazards are house building, agriculture and forestry crops, reservoir earth dams, cable bridges, traffic facilities and the like, and the non-cellulose substances are often damaged. The black-wing white ants belong to higher termites and are one of the white termites. Most of the time the activity is underground. The bark, the shallow wood layer and the root are mainly damaged by the Gongying. Causing the formation of large ant paths outside the damaged trunk and declining growth vigor. When the tree trunk is invaded into xylem, the tree trunk withers; especially, the seedling is easy to die. When the food is damaged by ingestion, the mud quilt and the mud line are made, and when the food is serious, the mud quilt surrounds the whole body to form a mud sleeve, and the characteristics of the mud sleeve are obvious. Odontotermes formosanus is a major pest in reservoirs and rivers and dams, often causing water leakage, collapse and breach of the dam (li-a et al, 2001; cai banwa et al, 1965; xu shao sea, 2004; xus shide et al, 2007). Since the nests of termites are very hidden, the damage caused by termites is not easily detected, and when detected, the damage is already very great. In addition, odontotermes formosanus has a relatively miscellaneous feeding property and a relatively wide damage range, and can be harmful to more than 100 plants including camphor trees, fir trees, southern magnolia, chinese ash and the like (Huangqueshui et al; 2005).

At present, the prevention and control of the odontotermes formosanus still mainly rely on traditional chemical pesticides, but the problems of medicament residue and the like are increasingly serious, and the insecticide has potential threats to human and livestock health and ecological environment. Therefore, it is imperative to develop new biological control methods and explore new control strategies for odontotermes formosanus. RNA interference (RNAi) refers to a phenomenon in which homologous mRNA degradation is induced by double-stranded RNA (ds RNA) in eukaryotes to silence the expression of a target gene, and in studies of insect gene functions, gene interference is generally performed by introducing exogenous dsRNA or small interfering RNA (si RNA). RNAi can achieve sustainable control of pest populations by selectively interfering with expression of insect key genes, and is highly promising in the field of pest control. Gram-negative bacterial recognition proteins (GNBPs), also known as β -1,3-glucan recognition proteins (β -1,3-glucan recognition proteins, β GRPs), are members of the same family, and were first discovered and named in the family of silkworms, and were primarily responsible for fungal recognition (beauliton et al, 1979), and play an important role in the subsequent induction of antimicrobial peptide gene expression by immune signal transduction. Silencing of the gene can reduce the capability of the termite for resisting infection of pathogenic microorganisms, and finally leads the termite to die, so that dsRNA is expected to be designed for GNBP gene to be used for controlling odontotermes formosanus.

Disclosure of Invention

The invention aims to provide application of dsRNA of a GNBP2 gene of odontotermes formosanus in termite control. The GNBP2 gene of the odontotermes formosanus is obtained by an applicant for the first time, dsRNA is designed based on the gene and is introduced into the termite body, and the odontotermes formosanus can be effectively prevented and treated.

Specifically, the invention provides a GNBP2 gene of a odontotermes formosanus gram-negative bacteria recognition protein, wherein the nucleotide sequence of the GNBP2 gene is shown as SEQ ID NO:1, and the corresponding amino acid sequence is shown as SEQ ID NO: 2, respectively.

The invention further provides application of the GNBP2 gene in termite control.

Meanwhile, the invention provides GNBP 2dsRNA for controlling termites, which is composed of SEQ ID NO:1 is transcribed.

The invention also provides a DNA encoding the dsRNA of claim.

Further, the present invention provides a recombinant expression vector comprising the above DNA encoding GNBP2 dsRNA.

The invention also provides a host bacterium for transforming the recombinant expression vector.

In another aspect, the present invention provides a method of controlling termites, comprising the steps of: feeding termites with a GNBP 2dsRNA consisting of the nucleotide sequence set forth in SEQ ID NO:1 is transcribed.

As another method for controlling termites, termites can be co-fed with GNBP 2dsRNA and serratia marcescens SM1, wherein the dsRNA consists of the amino acid sequence set forth in SEQ ID NO:1 by transcription of a nucleotide sequence shown in the specification.

Has the advantages that: the invention designs dsRNA based on the gene of the immune recognition protein GNBP2, researches and establishes a GNBP2 RNA interference system for odontotermes formosanus by using a feeding method, obtains obvious gene silencing effect when fed to the odontotermes formosanus, and provides theoretical basis for the application of the GNBP2 RNAi technology. Meanwhile, the interference cost is reduced by constructing a dsRNA expression system by using the HT115 strain. The invention utilizes the system to successfully interfere the expression of the immune recognition protein GNBP2 gene, and finds that the sensitivity of the GNBP2 gene-silenced odontotermes formosanus to the Serratia marcescens SM1 strain is obviously improved. Experiments show that the GNBP 2dsRNA and SM1 are used simultaneously, the mortality rate of the termites is obviously improved, and the prevention and treatment effect of biocontrol bacteria can be improved; meanwhile, the single use of GNBP 2dsRNA can also play a role in preventing and controlling odontotermes formosanus, and the effect is equivalent to that of the single use of SM 1. These provide theoretical basis for the application of GNBP 2dsRNA in termite control.

Drawings

FIG. 1 is an electrophoretogram of total RNA of odontotermes formosanus;

FIG. 2 is the cloned sequence and deduced amino acid sequence of GNBP2;

FIG. 3 shows the GNBP2 expression level of Serratia marcescens after treating odontotermes formosanus;

FIG. 4 is a diagram showing the results of electrophoresis of recombinant plasmids of L4440-dsGNBP2 and L4440-dsGFP, wherein 1 is L4440-dsGFP and 2 is L4440-dsGNBP2;

FIG. 5 shows the results of dsRNA digestion electrophoresis, wherein 1 is dsGFP and 2 is dsGNBP2;

FIG. 6 is a graph of relative expression levels of a target gene sampled at different times after dsRNA feeding, wherein, note: different lower case letters represent significant differences between treatments; ABCD is respectively 3, 6, 12 and 24h;

FIG. 7 is a survival analysis after 6h dsRNA treatment, wherein ABCDEF is 11, 16, 21, 26, 31, 36h respectively; g is a survival analysis chart and the dashed line is the time of treatment with SM 1.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

Experimental materials and methods referred to in the examples:

(1) Test insects: the odontotermes formosanus is collected from the sentence city of Jiangsu province, and the termites nest is collected and then put into an insect incubator under the dark condition of 27 ℃ for feeding.

(2) Culturing serratia marcescens SM 1:

culture medium: bacterial basal medium (g/L): 10g of peptone, 20g of beef extract, 2g of NaCl, K ₂ HPO ₄ 2g of agar, and 18g of agar, wherein the pH value is 7.2-7.4.

Bacterial seed medium (g/L): 10g of peptone, 20g of yeast extract, 2g of NaCl, K ₂ HPO ₄ 2g。

Bacterial fermentation medium (g/L): 10g of peptone, 30g of soybean oil, 2g of NaCl, K ₂ HPO ₄ 2g。

Transferring the separated serratia marcescens strain SM1 into a bacterial basic culture medium, culturing for 24h under the dark condition of 27 ℃, and obtaining a single colony after streaking and separating. A single colony was taken out, and cultured in a sterilized 250mL conical flask containing 50mL of seed medium at 30 ℃ for 12 hours in a constant temperature shaker at 200r/min, followed by seed liquid culture. Adding 70mL of cultured seed solution into 250mL of fermentation medium, culturing for 36 hours at the temperature of 30 ℃ in a shaking incubator at the rotating speed of 200r/min, and taking out for use after culturing.

(3) And (3) measuring the concentration of the Serratia marcescens SM1 fermentation liquor:

within a certain range, as the number of the cells in the Serratia marcescens SM1 fermentation broth increases, the OD600 value also increases.

The present invention will be described in further detail with reference to specific examples, which will help understanding the present invention, but the scope of the present invention is not limited to the following examples.

EXAMPLE 1 cloning of the GNBP2 Gene

(1) Designing a primer: according to the sequence of GNBP2 obtained from transcriptome data, primer5 software is used for designing a primer:

GNBP2F：GTTCTCCAGCAACCGTCAC；

GNBP2R:AAGATTGCCACCTTGTCAGTAA。

(2) Amplification of cDNA and TA cloning:

the Trizol method extracts total RNA of termites.

Total RNA extraction results from Termite Black wing (FIG. 1). The ratio of OD260/OD280 of the RNA detected by the nucleic acid detector is 1.855, which is between 1.8 and 2.0, and the RNA quality is qualified, so that the next experiment can be carried out.

cDNA was synthesized by reverse transcription using total RNA as a template in accordance with the instruction of First Strand cDNA Synthesis Kit of TaKaRa. The reverse transcription system is shown in Table 1.

TABLE 1

/>

Taking cDNA as a template, and utilizing primers GNBP2F and GNBP2R to carry out amplification to obtain a 1248bp fragment, wherein the sequence is shown as SEQ ID NO.1, the full-length sequence comprises a 1035bp open reading frame, and 344 amino acid polypeptides are coded, and are shown as figure 2. The PCR amplification reaction system is shown in Table 2, and the PCR amplification reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min; denaturation at 94 ℃ for 30s, annealing at 64.5 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; final extension at 72 ℃ for 10min. The PCR amplification product was detected by electrophoresis on a 1% agarose gel and photographed under a gel imaging system. And (3) identifying the correct PCR product, and purifying and recovering the correct PCR product by using a gel recovery kit. TA cloning conditions are shown in Table 3. Connecting the gel recovery product with pClone007 at room temperature for 1-5min, transforming E.coli DH5 alpha competent cells with the ligation product, and transforming the ligation product:

(1) Taking out E.coli DH5 alpha competent cells from a refrigerator at the temperature of-80 ℃, and dissolving the E.coli DH5 alpha competent cells in ice water;

(2) Adding 10. Mu.L of the ligation product to 100ul E.coli DH5. Alpha. Competent cells by using a pipette, and standing on ice for 30min;

(3) Heating in 42 deg.C water bath for 45s, taking out, immediately placing in ice water, and standing for 2min;

(4) Adding SOC or LB liquid culture medium, and performing shaking culture at 37 deg.C and 200rpm for 1h;

(5) 200uL of the bacterial suspension was applied to LB solid medium containing Amp penicillin (final concentration: 50. Mu.g/ml), and the mixture was cultured overnight in an incubator at 37 ℃.

The transformed product is cultured in LB (Amp +) solid culture medium for 12-16 h. The positive clone is selected, and after the PCR identification of bacterial liquid, the recombinant plasmid containing the correct insert is named pClone007-GNBP2 and sent to the company for sequencing.

TABLE 2

TABLE 3

Example 2 induced expression of GNBP1 of Serratia marcescens SM1 in Termite comeae

Contamination experiment: filter paper was first laid on the bottom of each 9cm dish and wetted with water. And then 20 black wing white ant workers which have better vitality and mature development are put into the culture dish. Each concentration (2.139X 10) was determined using fermentation medium of Serratia marcescens SM1 as a control ¹¹ cells/mL、2.139×10 ¹⁰ cells/mL、2.139×10 ⁹ cells/mL) were spotted on odontotermes formosanus using a 0.12 μ L micropipette, and each group was repeated three times. After dripping, the mixture is placed in a dark environment at 25 ℃ for observation and sample collection, the samples are collected at 3 hours, 6 hours, 12 hours and 24 hours respectively, and the mixture is placed at-80 ℃ for storage.

As shown in FIG. 3, it was found by the fluorescence quantitative test that the concentration was 2.139X 10 ⁹ After cells/mL SM1 treated the odontotermes formosanusGNBP2 is obviously adjusted upwards in 3h, 6h, 12h and 24h; with a concentration of 2.139X 10 ¹⁰ After cells/mL SM1 is used for treating odontotermes formosanus, GNBP2 is remarkably adjusted up when the odontotermes formosanus is treated for 3 hours, 6 hours, 12 hours and 24 hours; 2.139X 10 ¹¹ After the termites with Aleurites formosanus are treated by SM1 in cells/mL, the GNBP2 is up-regulated at 6h and 12h.

Example 3 synthesis and inducible expression of dsRNA from termite GNBP2 gene.

(1) Primer design for dsRNA of termite GNBP2 gene.

The potential RNAi target sites are predicted to exist at 150 bp-373 bp positions of GNBP2 through online software. Designing a primer by using primer5 software according to the sequence of the cloned GNBP 2:

dsGNBP2F：

dsGNBP2R：

and introducing enzyme cutting sites Not I and Hind III (bold letters are enzyme cutting sites, italic letters are protection bases) at the upstream and the downstream. Meanwhile, GFP primers are designed as follows:

dsGFP F：

dsGFP R：

and introducing a restriction enzyme cutting site (SacI) and Hind III at the upstream and downstream. All primers were synthesized by Tianjin Optimae Biotechnology, inc.

(2) Synthesis of dsRNA for the termite GNBP2 gene.

PCR amplification is carried out by using an upper primer dsGNBP2F and a lower primer dsGNBP2R which are designed for synthesizing dsRNA and used for taking a GNBP2 full-length plasmid pClone007-GNBP2 with correct sequencing as a template; the PCR amplification reaction condition is pre-denaturation at 94 ℃ for 3min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; final extension at 72 ℃ for 10min. The PCR amplification product was detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. And (3) identifying the correct PCR product, and purifying and recovering the correct PCR product by using a gel recovery kit.

(3) Construction of dsRNA expression vectors.

The 500bp fragment is cloned by taking the GFP nucleic acid sequence existing in a laboratory as a template. And the target fragment is linked with the L4440 vector after enzyme digestion, and L4440-dsGNBP2 and L4440-dsGFP recombinant plasmids are successfully constructed. The electrophoresis results of the L4440-dsGNBP2 and L4440-dsGFP recombinant plasmids are shown in FIG. 4.

Specifically, taking L4440-dsGNBP2 as an example, carrying out double enzyme digestion on the PCR product by Not I and Hind III, and recovering a target fragment; and simultaneously, carrying out double enzyme digestion on the expression vector L4440 by using the two enzymes, and recovering the target vector. The target fragment double enzyme digestion system and the vector double enzyme digestion system are respectively shown in tables 4 and 5. The target fragment and the target vector are connected for 16h at 16 ℃ under the action of T4 DNA ligase. Coli DH 5. Alpha. Competent cells were transformed with LB (ampicillin and tetracycline double antibody) solid medium for 12h. After the positive clones were selected and identified by digestion, the recombinant plasmid containing the correct insert was named L4440-dsGNBP2 and sent to the company for sequencing.

TABLE 4

TABLE 5

(4) And (3) induction expression and extraction of dsRNA.

Respectively carrying out induction expression on dsRNA of an HT115 strain containing recombinant plasmids of L4440-dsGNBP2 and L4440-dsGFP, digesting total RNA after induction expression by DNase I and RNase A, and displaying electrophoresis results that thallus DNA and RNA are degraded, wherein target bands are 224bp and 500bp which are consistent with the expected sizes of the dsGNBP2 and the dsGFP, and successfully constructing an interference vector (figure 5).

Using L4440-dsGNBP2 as an example, correctly sequenced recombinant L4440-dsGNBP2 plasmids were transformed into HT115 (DE 3) competent bacteria and plated in a medium containing ampicillin (50. Mu.g. ML.) ^-1 ) And tetracycline (12.5. Mu.g.mL) ^-1 ) The double antibody is cultured on LB solid medium in an inverted mode at 37 ℃ overnight. A single clone was picked and inoculated into a culture medium containing ampicillin (50. Mu.g.mL) ^-1 ) And tetracycline (12.5. Mu.g.mL) ^-1 ) Double-antibody LB liquid culture medium, 37 deg.C, 220 r.min ^-1 After shaking culture until the OD600 of the bacterial liquid is about 0.5-0.6, IPTG (final concentration 0.8 mM) is added to continue shaking culture at 37 ℃ and 220 r.min < -1 > for 3h, and then TaKaRa RNAioso Plus is used for extracting dsRNA. The dsRNA was digested using RNAse H and DNAse I. Quantitation was performed using an Eppendorf BioSpectrometry basic to achieve a final concentration of 1. Mu.g/. Mu.L. Storing in a super low-temperature refrigerator at-80 deg.C for use.

Example 4 detection of the amount of GNBP2 gene expression after RNAi.

Firstly, dsRNA of GNBP2 was mixed with Nile Blue, and then 800ul was dropped on filter paper at the bottom of a 7cm petri dish. The treatment group was 1. Mu.g/. Mu.L of dsGNBP2, and the control group was dsGFP and 20% Nile Blue aqueous solution. Each plate was dosed with 20 termites, each group was replicated 3 times. Observing and collecting in dark environment at 25 deg.C for 3, 6, 12, and 24 hr, collecting termite with bluish intestinal tract, and storing at-80 deg.C.

And (3) carrying out a fluorescent quantitative PCR (qRT-PCR) experiment on the gene, and checking the change of the expression quantity of the gene under different time and concentration treatments. The fluorescent quantitative primers were as follows (RPS 18 and GAPDH are reference genes):

q-GNBP2 F：TGGATGGCAGTGGTGTAAAT

q-GNBP2 R：CAGTGGGTCTTCCAGTAGTTATT

q-RPS18F：ATGGCAAACCCCCGTCAGTA

q-RPS18R：CATACCACGATGCGCACGAA

q-GAPDHF：TCGTATTGGCCGTCTTGTGC

q-GAPDHR：AGCGACCATGGGTGGAATCAT；

the fluorescent quantitative PCR reaction system is as follows:

reaction procedure:

95℃30s

{95℃5s，60℃34s}30cycles

{95℃15s，60℃1min，95℃15s}

the experiment was designed with 3 biological replicates, while 4 technical replicates were set up for each biological replicate. After Ct values of the target gene and the reference gene were obtained, 2 was used ^-ΔΔt The method calculates the relative expression amount of the target gene mRNA. And performing significance difference analysis on the obtained data by using InStat software.

In order to detect the change of the expression quantity of the target gene sampled at different intervals after the GNBP 2dsRNA is fed, real-time fluorescence quantitative PCR detection is carried out on the cDNA samples of the odontotermes formosanus of the control group and the treated group, and the results show that the interference efficiency is respectively 32.51%, 72.48%, 40.02% and 44.07% 3h, 6h, 12h and 24h after dsRNA injection, the sampling interference efficiency is maximum at 6h, and the relative expression quantity of the target gene is obviously lower than that of the other two groups (figure 6).

Since the interference efficiency of the black-wing termite GNBP2 was the highest at 6h, we chose 6 hours for RNAi treatment.

Example 5 change in sensitivity of odontotermes formosanus to serratia marcescens SM1 after RNAi.

The dsRNA was first mixed with Nile Blue and then 800ul was added dropwise onto filter paper at the bottom of a 7cm dish. The treatment group was 1. Mu.g/. Mu.L of dsGNBP2, and the control group was dsGFP and 20% Nile Blue aqueous solution. And selecting the time when the GNBP2 expression quantity is reduced to the maximum to start the bioassay. Each plate was dosed with 20 termites, each group was replicated 3 times. Setting the common fermentation medium treatment, SM1 treatment, dsGFP treatment, SM1 treatment after dsGFP interference, dsGNBP2 treatment and SM1 treatment after dsGNBP2 interference for biological test experiment. The observation was carried out in a dark environment at 25 ℃ and the data were recorded.

After feeding the black-wing odontotermes formosanus for 6 hours, performing SM1 infection experiments, and discovering through bioassay that the survival rate of the black-wing odontotermes formosanus is obviously reduced compared with that of the black-wing odontotermes without RNAi, 11, 16, 21, 26, 31 and 36 hours are selected for analyzing data, and when the survival rate is 11 hours, the death rate of the DSGNBP2 group treated by SM1 is obviously higher than that of other treatment groups, the death rate reaches 31.7 percent, and the difference among other groups is not obvious; at 16h, the mortality of the dsGNBP2 group treated by SM1 is the highest and has obvious difference with other treatment groups, and reaches 86.7%, the mortality of the dsGNBP2 group treated by SM1 and GFP group treated by dsGNBP2 respectively reaches 13.3% and 31.6%, and the difference is not obvious; at 21h, the mortality rate of the dsGNBP2 group treated by SM1 is the highest and the difference is obvious compared with that of other treatment groups, and reaches 91.3%, the mortality rate of the dsGNBP2 treatment group is 21.3%, and the difference is obvious compared with that of a control group (a fermentation liquid group and a GFP group); at 26h, the mortality of the dsGNBP2 group treated by SM1 reaches 100%, the mortality of the dsGNBP2 group treated by 40%, the mortality of the SM1 group treated by 51.6% and the mortality of the GFP group treated by SM1 reaches 53.3%, and the results show that the differences among the dsGNBP2 group, the SM1 group treated by SM1 group and the GFP group treated by SM1 are not obvious, but are obvious compared with the control group (the fermentation liquid group and the GFP group), which indicates that the dsGNBP2 also has obvious lethal effect and the effect is comparable to that of SM 1; at 31h and 36h, the mortality rates of the dsGNBP2 treated group, the SM1 treated group and the SM1 treated dsGNBP2 group are all more than 70.0%, the mortality rate of the SM1 treated GFP group is more than 60%, and the differences between the two groups are significant compared with the control group (fermentation liquor group and GFP group). We find that the effect of using dsGNBP2 and SM1 together is the best, and the death rate reaches 93% at 21 h; the effect of the dsGNBP2 alone is not obvious different from that of the SM1 alone, the death rate is close to 60% in about 25h, and the dsGNBP2 can also have an insecticidal effect when being used alone as a medicament.

It is also evident from the survival curves that the survival rate of SM1 treated dsGNBP2 group was significantly less than the control group (fermentation broth group and GFP group), and termites had all died at 26 h; the survival rates of the dsGNBP 2-treated group, SM 1-treated group, and SM 1-treated GFP group were also significantly lower than those of the control group (fermentation broth group and GFP group), and had decreased to about 50.0% at 30h (fig. 7).

In conclusion, the research establishes a GNBP2 RNA interference system of odontotermes formosanus by using a feeding method, obtains an obvious gene silencing effect when fed to the odontotermes formosanus, and provides technical support for the application of a GNBP2 RNAi technology. The expression of the immune recognition protein GNBP2 gene is successfully interfered by the system, and the sensitivity of the odontotermes formosanus with the GNBP2 gene silencing to serratia marcescens SM1 strain is obviously improved. Experiments show that the GNBP 2dsRNA and SM1 are used simultaneously, the mortality rate of the termites is obviously improved, and the prevention and treatment effect of biocontrol bacteria can be improved; meanwhile, the single application of GNBP 2dsRNA can also play a role in controlling odontotermes formosanus, and the effect is equivalent to that of the single application of SM 1. The invention provides a theoretical basis for the application of GNBP 2dsRNA in termite control, lays a theoretical foundation for the development of immunosuppressive agents safe for human and livestock, provides a new theory for the biological control of pests, and finally provides a new strategy and a new way for controlling the pests for green agricultural production and sustainable development in China.

The present invention provides a control thought and method for odontotermes formosanus, and the method and way for implementing the technical scheme are many, the above is only the preferred embodiment of the present invention, it should be noted that for those skilled in the art, without departing from the principle of the present invention, some improvements and decorations can be made, and these improvements and decorations should be regarded as the protection scope of the present invention. All the components not specified in the present embodiment can be realized by the prior art.

Sequence listing

<110> Nanjing university of forestry

<120> odontotermes formosanus gram-negative bacteria recognition protein GNBP2 gene and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1035

<212> DNA

<213> GNBP2 nucleotide Sequence (Artificial Sequence)

<400> 1

atgatcggat tattcgctca gatgttggcg actgctctgc tgttcctctg cttttgccac 60

gcaggatcgg cagagactct ggtctggcag gacgagttcg attatcttga tgagggtaaa 120

tggggtcatc tggtaacagc ttggggtgga ggcaatcagg aatttcagta ctaccggaat 180

gacagaagaa acagctacgt acgggacgga gttttatacc tcagaccgac ttggatttcc 240

gctgaatatg gtgatgactt cctttacagc ggcagcctga aacttccgga ttgtaacatg 300

gaaccatgca catcatctgc aggaaatgac attgtgcaac caatgttctc cgctagaatg 360

acgagcaatt tcgccttcaa atatggcagg atagaagtca gagctcaatt gccaagagga 420

gattggattt ggcccgccat ctggatgtta ccgagagact ggaagtatgg tgactggccc 480

cgatctggtg agatcgatat tatggagagt aagggaaatg actattatgt ggatggcagt 540

ggtgtaaatg tgggtaacac tttgatgggt tccactttac actggggccc agatacgtcc 600

cacaataact actggaagac ccactgggaa aagaaccttc aagctactgg taaaagtttc 660

gctgatgatt tccatttgtt tggaatgaca tggactgaca atcacttaat attcactgtt 720

gacaatgaac aaatcggaga tgtgtgggct ccccaaaatg ggttctggta ctatggaggt 780

ttccaagata accctggtgg taccaacata tggcaaaatg gaaactggat ggcaccattt 840

gaccaagagt tccagataat cttgaatgtg gccgttggtg gtactttctt ccccgacaac 900

gttggtaacc gaccatggag ttgggacggt catcctatga gagacttctg ggatcgtcgc 960

agcgaatggc taccgacgtg gcacgaagaa caagcagcca tgaaaattga ttatgtcaga 1020

gtttatcagg gctaa 1035

<210> 2

<211> 344

<212> PRT

<213> GNBP2 amino acid Sequence (Artificial Sequence)

<400> 2

Met Ile Gly Leu Phe Ala Gln Met Leu Ala Thr Ala Leu Leu Phe Leu

1 5 10 15

Cys Phe Cys His Ala Gly Ser Ala Glu Thr Leu Val Trp Gln Asp Glu

20 25 30

Phe Asp Tyr Leu Asp Glu Gly Lys Trp Gly His Leu Val Thr Ala Trp

35 40 45

Gly Gly Gly Asn Gln Glu Phe Gln Tyr Tyr Arg Asn Asp Arg Arg Asn

50 55 60

Ser Tyr Val Arg Asp Gly Val Leu Tyr Leu Arg Pro Thr Trp Ile Ser

65 70 75 80

Ala Glu Tyr Gly Asp Asp Phe Leu Tyr Ser Gly Ser Leu Lys Leu Pro

85 90 95

Asp Cys Asn Met Glu Pro Cys Thr Ser Ser Ala Gly Asn Asp Ile Val

100 105 110

Gln Pro Met Phe Ser Ala Arg Met Thr Ser Asn Phe Ala Phe Lys Tyr

115 120 125

Gly Arg Ile Glu Val Arg Ala Gln Leu Pro Arg Gly Asp Trp Ile Trp

130 135 140

Pro Ala Ile Trp Met Leu Pro Arg Asp Trp Lys Tyr Gly Asp Trp Pro

145 150 155 160

Arg Ser Gly Glu Ile Asp Ile Met Glu Ser Lys Gly Asn Asp Tyr Tyr

165 170 175

Val Asp Gly Ser Gly Val Asn Val Gly Asn Thr Leu Met Gly Ser Thr

180 185 190

Leu His Trp Gly Pro Asp Thr Ser His Asn Asn Tyr Trp Lys Thr His

195 200 205

Trp Glu Lys Asn Leu Gln Ala Thr Gly Lys Ser Phe Ala Asp Asp Phe

210 215 220

His Leu Phe Gly Met Thr Trp Thr Asp Asn His Leu Ile Phe Thr Val

225 230 235 240

Asp Asn Glu Gln Ile Gly Asp Val Trp Ala Pro Gln Asn Gly Phe Trp

245 250 255

Tyr Tyr Gly Gly Phe Gln Asp Asn Pro Gly Gly Thr Asn Ile Trp Gln

260 265 270

Asn Gly Asn Trp Met Ala Pro Phe Asp Gln Glu Phe Gln Ile Ile Leu

275 280 285

Asn Val Ala Val Gly Gly Thr Phe Phe Pro Asp Asn Val Gly Asn Arg

290 295 300

Pro Trp Ser Trp Asp Gly His Pro Met Arg Asp Phe Trp Asp Arg Arg

305 310 315 320

Ser Glu Trp Leu Pro Thr Trp His Glu Glu Gln Ala Ala Met Lys Ile

325 330 335

Asp Tyr Val Arg Val Tyr Gln Gly

340

<210> 3

<211> 19

<212> DNA

<213> GNBP2F(Artificial Sequence)

<400> 3

gttctccagc aaccgtcac 19

<210> 4

<211> 22

<212> DNA

<213> GNBP2R(Artificial Sequence)

<400> 4

aagattgcca ccttgtcagt aa 22

<210> 5

<211> 34

<212> DNA

<213> dsGNBP2F(Artificial Sequence)

<400> 5

atttgcggcc gcaggcaatc aggaatttca gtac 34

<210> 6

<211> 30

<212> DNA

<213> dsGNBP2R(Artificial Sequence)

<400> 6

cccaagcttc gaaattgctc gtcattctag 30

<210> 7

<211> 31

<212> DNA

<213> dsGFP F(Artificial Sequence)

<400> 7

atcggagctc agttgaacgg atccatcttc a 31

<210> 8

<211> 25

<212> DNA

<213> dsGFP R(Artificial Sequence)

<400> 8

cccaagctta gaacttttca ctgga 25

<210> 9

<211> 20

<212> DNA

<213> q-GNBP2 F(Artificial Sequence)

<400> 9

tggatggcag tggtgtaaat 20

<210> 10

<211> 23

<212> DNA

<213> q-GNBP2 R(Artificial Sequence)

<400> 10

cagtgggtct tccagtagtt att 23

<210> 11

<211> 20

<212> DNA

<213> q-RPS18F(Artificial Sequence)

<400> 11

atggcaaacc cccgtcagta 20

<210> 12

<211> 20

<212> DNA

<213> q-RPS18R(Artificial Sequence)

<400> 12

cataccacga tgcgcacgaa 20

<210> 13

<211> 20

<212> DNA

<213> q-GAPDHF(Artificial Sequence)

<400> 13

tcgtattggc cgtcttgtgc 20

<210> 14

<211> 21

<212> DNA

<213> q-GAPDHR(Artificial Sequence)

<400> 14

agcgaccatg ggtggaatca t 21

Claims

1. A GNBP2 gene of a gram-negative bacteria recognition protein of odontotermes formosanus, wherein the nucleotide sequence of the GNBP2 gene is shown as SEQ ID NO:1 is shown.

2. Use of the GNBP2 gene of claim 1 for termite control.

3. A dsRNA for controlling termites, consisting of SEQ ID NO:1 is transcribed.

4. A DNA encoding the dsRNA of claim 2.

5. A recombinant expression vector comprising the DNA encoding dsRNA of claim 4.

6. A host bacterium transformed with the recombinant expression vector of claim 4.

7. A method of controlling termites, comprising the steps of: feeding termites with a GNBP 2dsRNA consisting of the nucleotide sequence set forth in SEQ ID NO:1 is transcribed.

8. A method for controlling termites, wherein termites are co-fed with a GNBP 2dsRNA and Serratia marcescens SM1, wherein the dsRNA consists of the amino acid sequence set forth in SEQ ID NO:1 is transcribed.