CN114591964B

CN114591964B - Equisetum arvense death gene HvSrp54k and application thereof

Info

Publication number: CN114591964B
Application number: CN202210095615.1A
Authority: CN
Inventors: 潘广; 陈诗敏; 潘慧鹏; 杨春晓; 胡玉伟; 黄萍; 黄绍华
Original assignee: Guangzhou National Modern Agricultural Industry Science And Technology Innovation Center; South China Agricultural University
Current assignee: Guangzhou National Modern Agricultural Industry Science And Technology Innovation Center; South China Agricultural University
Priority date: 2022-01-26
Filing date: 2022-01-26
Publication date: 2023-07-25
Anticipated expiration: 2042-01-26
Also published as: CN114591964A

Abstract

The application discloses a dioctadecyl eggplant ladybug lethal gene HvSrp54k and application thereof. The application shows that the gene HvSrp54k of the killing gene of the twenty-eight star ladybug is the sequence shown in the Seq ID No. 1. The gene HvSrp54k for killing the coccinella solani is a newly discovered gene affecting the development of the ladybug, and the ladybug can be killed efficiently by silencing the gene HvSrp54k, so that a new scheme and a new path are provided for green prevention and control of the ladybug.

Description

Equisetum arvense death gene HvSrp54k and application thereof

Technical Field

The application relates to the technical field of prevention and control of coccinella solani, in particular to a death gene HvSrp54k of the coccinella solani and application thereof.

Background

The coccinella solani Henosepilachna vigintioctopunctata belongs to the family of the ladybug of the order Coleoptera, is an important pest on vegetables of the family of the Solanaceae and the family of the cucurbitaceae, has extremely wide hazard range and has serious hazard in partial areas. At present, the prevention and control of the coccinella solani mainly depend on chemical pesticides, but excessive use of the chemical pesticides can cause the pests to generate drug resistance, and meanwhile, natural enemies, pollinating insects and other beneficial organisms can be killed, so that the development of an environment-friendly method for preventing and controlling the coccinella solani is urgently needed.

RNA interference (RNAi) refers to the phenomenon of highly conserved, highly efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA) during evolution. RNAi insect-resistant technology based on RNAi can prevent normal growth and reproduction of pests and even directly lead to death of the pests by interfering with key genes for controlling development or important behaviors of the pests, thereby achieving the aim of pest control. dsRNA is ubiquitous in organisms and is easy to degrade in the environment, so that the dsRNA is nontoxic and residue-free, is a novel environment-friendly pest prevention and control method, and has a wide application prospect. The obtained efficient and safe lethal target gene is the key for pest control by utilizing RNAi technology. In recent 2 years, the applicant establishes a technical system of a ladybug feeding method RNAi, and several target genes with higher lethal ability, such as HvvATPase B, hvRPS18 and HvRPL13, hvSnf7, hvATPase A and HvATPase E, hvlwr, hvalpha COPI and Hvgamma COPI, and the like, are identified in the ladybug. With the intensive research of the genome and transcriptome sequencing of the coccinella solani and the understanding of the determining factors and the resistance mechanism of RNAi, the research finds that more other RNAi lethal target genes can be helpful for the development of the prevention and control of the coccinella solani based on RNAi technology.

Disclosure of Invention

The purpose of the application is to provide a novel coccinella solani lethal gene HvSrp54k and application thereof.

The application adopts the following technical scheme:

the first aspect of the application discloses a gene HvSrp54k of a coccinella solani lethal gene HvSrp54k, which is a sequence shown in a Seq ID No. 1.

It should be noted that the gene HvSrp54k in the application is a gene which is newly discovered in the genome and transcriptome sequences of the coccinella solani and affects the development of the coccinella solani, and by silencing the gene HvSrp54k, the coccinella solani can be killed efficiently, and a new scheme and a new approach are provided for green prevention and control of the coccinella solani.

In a second aspect, the application discloses a dsRNA for controlling the coccinella solani, which targets and silences the death gene HvSrp54k of the coccinella solani.

In one embodiment of the present application, the dsRNA of the present application is the sequence shown in Seq ID No. 2.

Preferably, the dsRNA also has a promoter sequence at the 5 'and/or 3' end.

Preferably, the promoter sequence is a T7 promoter sequence.

Preferably, the T7 promoter sequence is the sequence shown in Seq ID No.3 or its reverse complement.

It should be noted that, the dsRNA with the sequence shown in Seq ID No.2 is only a dsRNA sequence capable of effectively silencing the gene HvSrp54k in one implementation of the present application; on the basis of the inventive concept of the present application, it is not excluded that other dsRNA sequences capable of silencing the gene HvSrp54k of the present application can also be designed, and are not specifically limited herein.

The third aspect of the application also discloses a recombinant plasmid which contains the isosceles solani ladybug lethal gene HvSrp54k or contains the dsRNA or the expression gene thereof.

The recombinant plasmid contains the lethal gene HvSrp54k of the coccinella solani or the dsRNA or the expression gene thereof; can be used for preparing dsRNA of a silencing gene HvSrp54k or other products for inhibiting the expression of the gene HvSrp54k.

The fourth aspect of the present application also discloses a cell comprising the dioctada solani lethal gene HvSrp54k of the present application, or comprising the dsRNA or the expression gene thereof of the present application, or comprising the recombinant plasmid of the present application.

In the case of a recombinant plasmid of the present application, for example, the cells of the present application can be cultured and expressed to obtain dsRNA silencing gene HvSrp54k, or can be used to prepare other products that inhibit expression of gene HvSrp54k.

The fifth aspect of the application also discloses application of the dioctada solani ladybug lethal gene HvSrp54k or an expression inhibition agent thereof, or the dsRNA, the recombinant plasmid or the cell thereof in preparation of products for controlling the dioctada solani ladybug.

The sixth aspect of the present application also discloses the application of the lethal gene HvSrp54k of the coccinella solani or the inhibitor thereof, or the dsRNA of the present application, or the recombinant plasmid of the present application, or the cell of the present application in preparing the product for inhibiting the growth of the coccinella solani.

The seventh aspect of the application also discloses application of the twenty-eight star ladybug lethal gene HvSrp54k or an expression inhibitor thereof, or the dsRNA, or the recombinant plasmid, or the cell thereof, in preparing a product for promoting death of the twenty-eight star ladybug.

It is noted that, by silencing the gene HvSrp54k of the application, the coccinella solani can be killed efficiently; therefore, the dioctada solani lethal gene HvSrp54k or the inhibition expression agent thereof, or the dsRNA, or the recombinant plasmid, or the cell can be used for preparing products for preventing and controlling the dioctada solani, inhibiting the growth of the dioctada solani or promoting the death of the dioctada solani. The inhibitor of the gene HvSrp54k can be, for example, dsRNA of the application, or other disclosed inhibitor of homologous genes.

The eighth aspect of the application also discloses a kit for preventing and controlling the coccinella solani, which contains the lethal gene HvSrp54k of the coccinella solani or an inhibitor thereof, or the dsRNA, or the recombinant plasmid, or the cell.

It should be noted that the kit contains the gene HvSrp54k of the coccinella solani, which can be used for preparing dsRNA of the silencing gene HvSrp54k or other products for inhibiting the expression of the gene HvSrp54k, and plays a role in preventing and controlling the coccinella solani; or the inhibiting expression agent directly containing the coccinella solani lethal gene HvSrp54k can be directly used for preventing and controlling the coccinella solani; or the kit contains the dsRNA of the application and can also be directly used for preventing and controlling the coccinella solani; or the kit contains the recombinant plasmid, and can be used for preparing dsRNA of a silencing gene HvSrp54k or other products for inhibiting the expression of the gene HvSrp54 k; or the kit contains the cells, the dsRNA of the application is expressed by culturing the cells, and the culture solution is directly used for preventing and controlling the coccinella solani or is used for preventing and controlling the coccinella solani after extraction and purification.

The beneficial effects of this application lie in:

the gene HvSrp54k for killing the coccinella solani is a newly discovered gene affecting the development of the ladybug, and the ladybug can be killed efficiently by silencing the gene HvSrp54k, so that a new scheme and a new path are provided for green prevention and control of the ladybug.

Drawings

FIG. 1 is an electrophoretogram of dsGFP and dsHvSrp54k synthesized in vitro in the examples of the present application;

FIG. 2 is a statistical result of the silencing efficiency of dsHvSrp54k on the 1-year larva gene HvSrp54k of the Etsum solani in the example of the present application;

FIG. 3 is a statistical result of the effect of dsHvSrp54k expressed by the edible fungus liquid on the survival rate of the eight-star ladybug in different geographical populations.

Detailed Description

Signal recognition particles (signal recognition particle, SRP) can catalyze mammalian cell endoplasmic reticulum targeting proteins (Bernstein et al, 1989), where SRP54k encodes signal recognition granule protein 54k, is involved in protein formation targeting the endoplasmic reticulum, has 7S RNA binding activity, endoplasmic reticulum signal peptide binding activity, and GTPase activity, and is involved in SRP-dependent cotranslational protein targeting and membrane translocation. Previous studies have shown that the Srp54k gene plays an important role in the growth and metabolic processes of insects.

Based on the research and the knowledge, the application carries out library construction and sequencing on the genome and transcriptome of the coccinella solani, and carries out homologous comparison analysis by utilizing the sequencing result of the Srp54k gene of the existing insect and the coccinella solani to obtain the HvSrp54k gene of the coccinella solani; and evaluating whether the HvSrp54k gene can be used as a high-efficiency target gene for controlling the coccinella solani by using RNAi by a feeding method; finally, a novel gene capable of efficiently killing the coccinella solani and the eight-star ladybug is obtained, namely a gene HvSrp54k which is a gene of the coccinella solani and the eight-star ladybug and has a sequence shown as a Seq ID No. 1.

The present application is described in further detail below by way of specific examples. The following examples are merely illustrative of the present application and should not be construed as limiting the present application.

Examples

1. Materials and methods

1.1 insect source to be tested

The plant population of the coccinella solani laboratory is collected from the black nightshade leaves in the garden greenhouse of the agricultural university in south China in 2018, and is subjected to secondary feeding in a key laboratory for creating and applying biological pesticides in Guangdong province, wherein the feeding material is eggplant leaves; the 5 field populations of the twenty-eight star ladybug were collected from the black nightshade in 5 areas of Guangdong province in 7 months 2021. Placing the coccinella twenty-eight stars and the leaves in a culture dish with filter paper and moisturizing cotton balls, placing in a climatic chamber at 25+/-1 ℃ and with humidity of 70% -80% and photoperiod of 14L:10D.

1.2. Total RNA extraction and first strand cDNA Synthesis

RNA extraction (Invitrogen, united States) was performed on samples from different stages of development of the coccinella solani using the TRIzol method. RNA quality was detected using 1% agarose gel electrophoresis and instrument NanoDrop One was used ^C Spectrophotometry (Thermo Fisher Scientific, waltham, MA United States) for determining RNA concentration, OD of all sample RNAs ₂₆₀ /OD ₂₃₀ Between 1.8 and 2.2. PrimeScript using the kit ^TM RT reagent Kit with gDNA Eraser (Perfect Real Time, takara, RR 047A), total RNA was reverse transcribed into cDNA according to the instructions, all cDNA was diluted 10-fold for the subsequent experiments.

1.3 RNAi Effect of dsRNA Synthesis by feeding kit

1.3.1 In vitro synthesis of dsRNA

The genome and transcriptome of the coccinella solani are subjected to library construction and sequencing, and the Srp54k gene of the existing insect and the sequencing result of the coccinella solani are utilized to carry out homologous comparison analysis, so that the HvSrp54k gene of the coccinella solani, namely the sequence shown as the Seq ID No.1, is obtained.

Seq ID No.1：

5’-ATGGTGTTAGCTGATTTAGGTCGTAAAATTACGACTGCCTTGCAGTCATTAAGCAAAGCAACTATCATAAATGAAGATGTCCTCAATGGAATGCTCAAAGAGATATGTGCTGCTTTGCTCGAAGCTGATGTTAACATTCGTTTAGTCAAAAAACTTAGAGAAAATGTGAGAGCTGTAATAGATTTTGAGGAAATGGCTGGGGGGCTCAACAAGAGAAGAATGATACAAAGTGCAGTTTTCAAAGAACTTGTGAAGCTTGTAGATCCTGCTGTTAAGCCTTACCAGCCTACAAAAGGGAAGCACAATGTTATTATGTTTGTAGGATTACAAGGATCTGGTAAAACAACCACATGTACAAAACTTGCTTACCATTATCAGAAGAAAAACTGGAAATCTTGTTTAGTGTGTGCAGATACATTCAGAGCAGGTGCTTATGATCAAGTAAAACAGAATTGTACAAAAGCGAGAATACCATTTTACGGAAGTTACACTGAAGTAGATCCAGTTGTTATAGCACAAGATGGAGTGGAAATGTTCAAAAAAGAAGGTTTCGAGATAATAATTGTTGATACCAGCGGTAGGCATAAGCAAGAAGAAGCGTTGTTCGAGGAGATGTTGGCGGTATCTAATGCTGTGAGACCTGACAATATCATTTTTGTAATGGACGCCACAATAGGTCAGGCTTGCGAAGCGCAAGCTAGGGCTTTCAAGGAAAAAGTAGATGTAGGATCAGTCATAATCACAAAATTAGACGGCCACGCTAAGGGTGGTGGTGCCCTTAGTGCGGTTGCCGCTACAAGCAGTCCAATTATCTATATAGGTACGGGAGAGCACATAGACGATTTAGAACCATTCAAAACTAAACCCTTTATCAGTAAACTTTTGGGTATGGGAGATATTGAAGGTCTCATTGATAAAGTTAATGAATTGAAATTAGAAGATAATGAAGAGTTATTAGAAAAAATTAAACACGGACAATTTACATTGCGAGACATGTACGAGCAGTTTCAGAACATTATGAAAATGGGACCATTCTCACAAATTATGGGTATGATTCCGGGATTCAGTCAAGACTTCATGACAAAAGGTAGTGAACAAGAATCAATGGCTAGATTAAAAAAACTGATGACAATCATGGACAGTATGAATGATGGCGAATTGGACAACAGGGATGGTGCCAAGCTCTTCTCAAAACAACCAGGAAGGACAGTCAGGGTCGCTCAAGGAGCTGGTGTAACAGAGCGCGAAGTTAAAGAATTAATTTCACAGTACACGAAATTTGCTGCTGTCGTTAAGAAAATGGGCGGTATCAAAGGTCTCTTCAAAGGCGGAGACATGGCGAAAAACGTGAATCCAGCTCAAATGGCAAAACTCAATCAGCAAATGGCAAAGATGATGGATCCCAGAGTGCTGCAACAGATGGGTGGAATGAACGGTTTACAGAACATGTTGAGGCAACTACAATCTGGCGCCGCCGGAGGACTGGGTGGTTTAGGCAATCTTATGAACAATTTTGGGGGCAAATAG-3’

According to the HvSrp54k gene of the sequence shown in the Seq ID No.1, a specific primer of dsRNA for targeted silencing of the HvSrp54k gene is designed by utilizing an E-RNAi website (https:// www.dkfz.de/signaling/E-RNAi3 /), and a T7 promoter sequence of the sequence shown in the Seq ID No.3 is added to the 5' -end of each specific upstream and downstream primer. The same protocol was used to design specific primers for GFP plasmid as controls; similarly, a T7 promoter sequence of the sequence shown in Seq ID No.3 was added to each of the 5' -ends of the upstream and downstream primers. Specific primers of dsRNA targeting the silencing HvSrp54k gene were labeled as dsHvSrp54k primers, specific primers designed for GFP plasmid were labeled as dsGFP primers, and the primer sequences are shown in Table 1. All primers were synthesized by Shanghai.

Seq ID No.3：5’-taatacgactcactataggg-3’。

TABLE 1 specific primers

The cDNA or GFP plasmid synthesized by reverse transcription is amplified by PCR using dsHvSrp54k primer and dsGFP primer, and the amplified product is used for synthesizing dsRNA. The method comprises the following steps:

PCR reaction System of dsHvSrp54k and dsGFP: ddH ₂ O35. Mu.L, 2X PCR Taq MasterMix 50. Mu. L, cDNA or GFP plasmid 5. Mu.L, upstream primer (10. Mu.M) 5. Mu.L, downstream primer (10. Mu.M) 5. Mu.L.

PCR reaction conditions: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 55℃for 30s, elongation at 72℃for 1min,35 cycles; extending at 72℃for 10min.

After completion of the reaction, the 2 PCR products were detected by 1% agarose gel electrophoresis, and then recovered by using DNA purification recovery kit (Universal DNA Purification Kit, TIANGEN, china) as templates for synthesizing dsRNA.

In this example, MEGAscript is specifically used ^TM T7 kit (Thermo Fisher Scientific, waltham, mass., USA) dsRNA was synthesized according to the procedures described.

Synthesis system of dsRNA: 10 Xreaction Buffer 5. Mu.L, ATP Solution 5. Mu.L, GTP Solution 5. Mu.L, CTP Solution 5. Mu.L, UTP Solution 5. Mu. L, PCR. Mu.g of the product and Enzyme mix 5. Mu.L were recovered, and 50. Mu.L was supplemented with RNase-Free Water.

After the above system is mixed evenly, the mixture is placed at 37 ℃ for 4 hours.

After the reaction was completed, 2.5. Mu.L TURBO DNase was added to remove the remaining template DNA and single stranded RNA, and then dsRNA was purified as follows: the dsRNA was first transferred to a 1.5mL centrifuge tube and 280. Mu.L of Nuclease free water to 300. Mu.L was added. Then, the same volume of phenol and chloroform, i.e., 150. Mu.L of phenol+150. Mu.L of chloroform, was added, and mixed well at 4℃at 13000rpm for 15min. The supernatant was then transferred to a new centrifuge tube, 300. Mu.L of chloroform was added, and mixed well at 4℃at 13000rpm for 10min. The supernatant was transferred to a new tube, 30. Mu.L of sodium acetate (pH 5.8, 3M) and 750. Mu.L of absolute ethanol were added, and the mixture was left at-80℃for 1.5 hours or overnight. After standing, the mixture is centrifuged again at 13000rpm at 4℃for 15min, the supernatant is removed and sucked as clean as possible. The precipitate was then suspended by rinsing with 1mL of 75% ethanol, then at 7500rpm,4℃for 10min. Finally, the supernatant was discarded, and the mixture was left at room temperature for 8 to 10 minutes, and 50. Mu.L of ddH was used ₂ O dissolves dsRNA, and the dsRNA is preserved in a refrigerator at-80 ℃ to respectively obtain dsRNA of a target silencing gene HvSrp54k, dsHvSrp54k and dsRNA of GFP plasmid, and dsGFP.

dsRNA mass was detected using 1.5% agarose gel electrophoresis and dsRNA concentration was determined using an instrument NanoDrop OneC spectrophotometer (Thermo Fisher Scientific, waltham, MAUnited States). The agarose gel electrophoresis test results are shown in FIG. 1, in which the first lane is marker, the second lane is electrophoresis result of dsGFP, and the third lane is electrophoresis result of dsHvABCH1, and the results are consistent with expectations. The spectrophotometric measurement showed that dsHvSrp54k concentration was 5450 ng/. Mu.L and dsGFP concentration was 2803 ng/. Mu.L.

The dsRNA of the target silencing gene HvSrp54k designed in the example is a sequence shown as a Seq ID No. 2; however, since a T7 promoter sequence is added to each of the 5' -ends of the specific upstream and downstream primers; thus, the final dsHvSrp54k of this example was added by the upstream primer and the reverse complement of the sequence shown by Seq ID No.3 by the downstream primer, with a T7 promoter sequence at both the 5' and 3' ends, i.e., the sequence shown by Seq ID No.3 at the 5' end, based on the sequence shown by Seq ID No. 2.

Seq ID No.2：

5’-CGGGAGAGCACATAGACGATTTAGAACCATTCAAAACTAAACCCTTTATCAGTAAACTTTTGGGTATGGGAGATATTGAAGGTCTCATTGATAAAGTTAATGAATTGAAATTAGAAGATAATGAAGAGTTATTAGAAAAAATTAAACACGGACAATTTACATTGCGAGACATGTACGAGCAGTTTCAGAACATTATGAAAATGGGACCATTCTCACAAATTATGGGTATGATTCCGGGATTCAGTCAAGACTTCATGACAAAAGGTAGTGAACAAGAATCAATGGCTAGATTAAAAAAACTGATGACAATCATGGACAGTATGAATGATGGCGAATTGGACAACAGGGATGGTGCCAAGCTCTTCTCAAAACAACCAGGAAGGACAGTCAGGGTC-3’

1.3.2 Effect of in vitro synthesized dsRNA on survival of laboratory Equisetum arvense populations

The twenty-eight star ladybug 1-year larva treatment group (dsHvSrp 54 k): 10 larvae of 1 year of the coccinella solani, 10 replicates of which were 1, were placed in a petri dish containing filter paper and humidified cotton balls, 3 replicates were set, round eggplant leaves with a diameter of 12mm were soaked with dsHvSrp54k solutions with a concentration of 200 ng/. Mu.L, 100 ng/. Mu.L, 50 ng/. Mu.L, 25 ng/. Mu.L, 12.5 ng/. Mu.L, 6.25 ng/. Mu.L, respectively, for 1min, were fed with larvae after air-drying, the leaves were replaced every 24h, and the larvae were fed with untreated eggplant leaves every day after feeding with the leaves soaked with dsHvSrp54k for 2d. The control group, i.e. the leaves after being soaked with the dsGFP solution, was set at the same concentration and method. Placing the culture dish in a climatic chamber, wherein the temperature is 25+/-1 ℃, the humidity is 70% -80%, and the light is peripheralStage 14L 10D. The death number of the coccinella solani in each culture dish is counted every 24 hours, and the survival rate and LC are calculated ₅₀ 。

1.3.3 Effect of dsHvSrp54k on silencing efficiency of Equisetum arvense

To investigate the effect of feeding dsHvSrp54k on gene expression of Equisetum arvense, 1-instar larvae of Equisetum arvense were treated with LC respectively ₅₀ dsHvSrp54k and dsGFP at values (11.449 ng/. Mu.l) were fed with RNAi treatment, a "1.3.2 in vitro synthesized dsRNA effect on survival of laboratory coccinella twenty-eight star ladybug population", and samples were collected 24h and 48h later, with 1 biological replicate for 5 larvae. All samples were set up with 4 biological replicates. After quick freezing with liquid nitrogen, storing at-80 ℃. Total RNA from the collected sample was extracted and reverse transcribed into cDNA in the same manner as "1.2. Total RNA extraction and first strand cDNA Synthesis". The silencing efficiency of dsHvSrp54k against Etsum solani was analyzed by RT-qPCR. And selecting the gene RPS18 as an internal reference gene. The RT-qPCR primer for detecting the HvSrp54k gene is labeled as RT-qPCR-HvSrp54k, and the specific sequence is shown in Table 1. The primer of the reference gene is labeled as RT-qPCR-HvRPS18, and the sequence is shown in Table 1. All primers were synthesized by Shanghai.

RT-qPCR reaction system: cDNA template 2.5. Mu.L, primers F and R (10. Mu.M) each 2.5. Mu.L, TB Green 25. Mu.L, ddH ₂ O 17.5μL。

The qPCR reaction procedure is three stages, namely a denaturation stage at 95 ℃ for 30s; the quantitative analysis phase was 40 cycles: 95 ℃ for 5s and 60 ℃ for 30s; melting curve 95℃for 5s (4.4 ℃/s), 60 ℃ (2.2 ℃/s), 95 ℃ (0.11 ℃/s) and 5 photographs per 1℃rise.

The reaction was performed in 96-well plates Microseal PCR plates (BIO-RAD Inc., USA) and the reaction instrument for RT-qPCR was Bio-Rad C1000 Real-Time PCR system (Bio-Rad C1000 Real-Time PCR system, BIO-RAD, USA). The final result calculation uses 2 ^-△△Ct Process (Livak and Schmittgen, 2001), wherein C _t The number of cycles is represented.

1.3.4 vector construction of bacterial liquid expression dsRNA

The carrier of bacterial liquid expression dsRNA selects an L4440 carrier with double T7 promoters, and primers used for constructing the expression carrier are shown in table 1, wherein 'L4440-dsHvSrp 54 k' is a primer for constructing dsRNA of a targeted silencing gene HvSrp54k, namely enzyme cutting sites are respectively added at the 5 'end and the 3' end of a specific primer; "L4440-dsGFP" is a primer for constructing dsRNA of GFP, and similarly, the cleavage sites are added to the 5 'end and the 3' end of the specific primer, respectively.

BamHI and SacI were selected as cleavage sites on the L4440 vector, and the L4440 vector was digested with restriction enzymes QuickCut SacI and QuickCut BamHI (TaKaRa), and the recovered product was digested with restriction enzymes QuickCut SacI and QuickCut BamHI (TaKaRa), as well. The digested PCR product and linearized L4440 vector were purified using a universal DNA purification kit (beijing antenna root). Then, the purified L4440 vector was recombined with the target fragment using recombinase TreliefTM SoSoo Cloning Kit (Optimago ), and the recombinant vector containing the target fragment was transformed into RNase III-deficient E.coli HT115 (DE 3) cells having IPTG-induced T7 polymerase activity. After culturing on LB agar plates, single colonies containing the desired fragment were inoculated into 4mL of LB liquid medium containing Tet (10. Mu.g/mL) and Amp (100. Mu.g/mL), and cultured at 210rpm at 37℃for 12-14 hours. Transferring 500 mu L of bacterial liquid into 50mL of LB liquid medium containing Amp (100 mu g/mL) and Tet (10 mu g/mL), diluting the bacterial liquid by 100 times, and performing amplification culture until the OD value of the bacterial liquid is between 0.5 and 0.8. IPTG was then added to the bacterial solution to a final concentration of 1mM and cultured with shaking at 37 ℃ at 120rpm for 5h to induce dsRNA.

1.3.5 Effect of bacterial liquid expression dsRNA on survival rates of indoor and field populations of Aleurites solani

The bioassays were performed on 1-instar larvae of the dioctada solani of the indoor and field populations using dsHvSrp54k and dsGFP expressed from bacterial liquids, all bioassays of the dioctada solani included 3 replicates: each repetition included 10 first 1-year larvae, respectively, and the bioassay was performed in a petri dish, and the test insects were starved for 3 hours before starting the bioassay. The eggplant leaves (diameter 12 mm) with equal size are soaked in dsRNA solution expressed by bacterial liquid for 1min, placed on filter paper and air-dried for 1h at room temperature. Air-dried and fed to 1-year larvae. Each replicate was fed dsRNA treated leaf 2d serially. Starting from 3d, the test insects were fed with an equal amount of leaves without dsRNA, the number of deaths of the coccinella solani in each petri dish was counted every 24h, and the survival rate within 10d was calculated.

1.4 data analysis

Calculation of the lethal Medium concentration LC of dsHvSrp54k on Equisetum arvense Using Software PoloPlus (LeOra Software 2002, berkeley, calif.) ₅₀ The assumption of equality and parallelism of mortality data was also checked by poloprolus. One-way analysis of variance (Breslow two-by-two comparison, P<0.05 For testing the difference in silencing efficiency between control and treatment after dsRNA feeding, and to create a survival curve based on larval mortality using Cox regression program.

2. Results and analysis

2.1 Effect of in vitro synthesized dsRNA on survival of laboratory Litsea Equisetum populations

Measurement of different concentrations of dsHvSrp54k on laboratory population of Equisetum arvense larvae shows that mortality is close to 100% within 6d of starting mortality statistics, so that 5d is selected for LC ₅₀ The values were analyzed as shown in table 2. The results show that the laboratory population of the 1-instar larva of the Equisetum arvense versus dsHvSrp54k LC ₅₀ 11.449 ng/. Mu.L.

TABLE 2 toxicity determination of dsHvSrp54k on the laboratory population of Equisetum arvense

Age of age	Measurement of time after feeding (d)	LC ₅₀ (ng/μL)(95％CL)	Slope ± standard error	χ2(DF)
					Age 1	5d	11.449(3.288-20.725)	1.692±0.283	5.8296(4)

2.2 Effect of 2dsHvSrp54k on silencing efficacy of Equisetum arvense

The RT-qPCR analysis result shows that after dsHvSrp54k is fed to 1-year larvae of the Etsum solani for 2d and 4d, compared with a control group, the expression level of the HvSrp54k gene is obviously inhibited and respectively and obviously reduced by 3.82 times (F _1,6 ＝80.453,P<0.001 1.55 times (F) _1,6 ＝27.427,P<0.05 The results are shown in fig. 1). In FIG. 1, the values are mean.+ -. Standard error, and the different letters in the figure indicate significant differences between groups (Tukey, P<0.05)。

2.3 Effect of dsRNA expressed by bacterial liquid on indoor and field population survival of coccinella solani

The 5 field populations of the twenty-eight star ladybug are collected from the black nightshade in 5 areas of Guangdong province in 7 months of 2021, and are specifically collected from five areas of Chaozhou (CZ), shanyu (ST), jiangmen (JM), yangjiang (YJ) and Zhanjiang (ZJ) respectively; the laboratory population is collected from black nightshade leaves in a garden greenhouse of the agricultural university of south China in 2018, and subcultured; a total of 6 populations were used for the trial.

The results show that after continuously feeding dsHvSrp54k 2d expressed by the 1-year larva liquid of the coccinella solani, the survival rate of the treated group of the twenty-eight star ladybug in different geographic populations is significantly different from that of the control group (P < 0.001), the survival rate of the treated group shows a sharp decline trend along with the increase of time, the survival rate difference of the populations in different areas shows a sharp decline trend, the mortality rate of the treated group in 10d is 100%, and the survival rate of the control group is not significantly changed, as shown in fig. 2. In fig. 2, survival curves were established using Cox regression program using mortality data for larvae of different geographical populations, respectively, with different letters indicating significant differences between groups (Tukey, P < 0.05); wherein, the curve a is a control group curve, and the curve b is a curve of 6 populations respectively. The test results show that dsHvSrp54k expressed by the edible fungus liquid can induce a strong RNAi effect in bodies of the coccinella twenty-eight star ladybug in different geographical populations, and the death of the ladybug is caused.

As can be seen from the above experiments, the gene HvSrp54k of the sequence shown in the Seq ID No.1 of the example can influence the growth and development of the coccinella solani, and the coccinella solani can be killed efficiently by silencing the gene HvSrp54k.

The foregoing is a further detailed description of the present application in connection with the specific embodiments, and it is not intended that the practice of the present application be limited to such descriptions. It will be apparent to those skilled in the art to which the present application pertains that several simple deductions or substitutions may be made without departing from the spirit of the present application.

SEQUENCE LISTING

<110> Guangzhou national center for innovation in modern agriculture industry technology

South China Agricultural University

<120> Equisetum arvense lethal gene HvSrp54k and application thereof

<130> 22I33292

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 1527

<212> DNA

<213> HvSrp54k Gene

<400> 1

atggtgttag ctgatttagg tcgtaaaatt acgactgcct tgcagtcatt aagcaaagca 60

actatcataa atgaagatgt cctcaatgga atgctcaaag agatatgtgc tgctttgctc 120

gaagctgatg ttaacattcg tttagtcaaa aaacttagag aaaatgtgag agctgtaata 180

gattttgagg aaatggctgg ggggctcaac aagagaagaa tgatacaaag tgcagttttc 240

aaagaacttg tgaagcttgt agatcctgct gttaagcctt accagcctac aaaagggaag 300

cacaatgtta ttatgtttgt aggattacaa ggatctggta aaacaaccac atgtacaaaa 360

cttgcttacc attatcagaa gaaaaactgg aaatcttgtt tagtgtgtgc agatacattc 420

agagcaggtg cttatgatca agtaaaacag aattgtacaa aagcgagaat accattttac 480

ggaagttaca ctgaagtaga tccagttgtt atagcacaag atggagtgga aatgttcaaa 540

aaagaaggtt tcgagataat aattgttgat accagcggta ggcataagca agaagaagcg 600

ttgttcgagg agatgttggc ggtatctaat gctgtgagac ctgacaatat catttttgta 660

atggacgcca caataggtca ggcttgcgaa gcgcaagcta gggctttcaa ggaaaaagta 720

gatgtaggat cagtcataat cacaaaatta gacggccacg ctaagggtgg tggtgccctt 780

agtgcggttg ccgctacaag cagtccaatt atctatatag gtacgggaga gcacatagac 840

gatttagaac cattcaaaac taaacccttt atcagtaaac ttttgggtat gggagatatt 900

gaaggtctca ttgataaagt taatgaattg aaattagaag ataatgaaga gttattagaa 960

aaaattaaac acggacaatt tacattgcga gacatgtacg agcagtttca gaacattatg 1020

aaaatgggac cattctcaca aattatgggt atgattccgg gattcagtca agacttcatg 1080

acaaaaggta gtgaacaaga atcaatggct agattaaaaa aactgatgac aatcatggac 1140

agtatgaatg atggcgaatt ggacaacagg gatggtgcca agctcttctc aaaacaacca 1200

ggaaggacag tcagggtcgc tcaaggagct ggtgtaacag agcgcgaagt taaagaatta 1260

atttcacagt acacgaaatt tgctgctgtc gttaagaaaa tgggcggtat caaaggtctc 1320

ttcaaaggcg gagacatggc gaaaaacgtg aatccagctc aaatggcaaa actcaatcag 1380

caaatggcaa agatgatgga tcccagagtg ctgcaacaga tgggtggaat gaacggttta 1440

cagaacatgt tgaggcaact acaatctggc gccgccggag gactgggtgg tttaggcaat 1500

cttatgaaca attttggggg caaatag 1527

<210> 2

<211> 395

<212> DNA

<213> dsHvSrp54k target sequence

<400> 2

cgggagagca catagacgat ttagaaccat tcaaaactaa accctttatc agtaaacttt 60

tgggtatggg agatattgaa ggtctcattg ataaagttaa tgaattgaaa ttagaagata 120

atgaagagtt attagaaaaa attaaacacg gacaatttac attgcgagac atgtacgagc 180

agtttcagaa cattatgaaa atgggaccat tctcacaaat tatgggtatg attccgggat 240

tcagtcaaga cttcatgaca aaaggtagtg aacaagaatc aatggctaga ttaaaaaaac 300

tgatgacaat catggacagt atgaatgatg gcgaattgga caacagggat ggtgccaagc 360

tcttctcaaa acaaccagga aggacagtca gggtc 395

<210> 3

<211> 20

<212> DNA

<213> promoter sequence

<400> 3

taatacgact cactataggg 20

<210> 4

<211> 20

<212> DNA

<213> artificial sequence

<400> 4

cggtaggcat aagcaagaag 20

<210> 5

<211> 20

<212> DNA

<213> artificial sequence

<400> 5

cctattgtgg cgtccattac 20

<210> 6

<211> 21

<212> DNA

<213> artificial sequence

<400> 6

cgcaatcaaa ggtgttggaa g 21

<210> 7

<211> 21

<212> DNA

<213> artificial sequence

<400> 7

gcctagggtt ggccataata g 21

<210> 8

<211> 40

<212> DNA

<213> artificial sequence

<400> 8

taatacgact cactataggg cgggagagca catagacgat 40

<210> 9

<211> 40

<212> DNA

<213> artificial sequence

<400> 9

taatacgact cactataggg gaccctgact gtccttcctg 40

<210> 10

<211> 41

<212> DNA

<213> artificial sequence

<400> 10

taatacgact cactataggg aagttcagcg tgtccggcga g 41

<210> 11

<211> 41

<212> DNA

<213> artificial sequence

<400> 11

taatacgact cactataggg ttcacgttga tgccgttctt c 41

<210> 12

<211> 40

<212> DNA

<213> artificial sequence

<400> 12

ctgatatcat cgatgaattc cgggagagca catagacgat 40

<210> 13

<211> 39

<212> DNA

<213> artificial sequence

<400> 13

cgaattcctg cagcccgggg accctgactg tccttcctg 39

<210> 14

<211> 36

<212> DNA

<213> artificial sequence

<400> 14

atcatcgatg aattcaagtt cagcgtgtcc ggcgag 36

<210> 15

<211> 36

<212> DNA

<213> artificial sequence

<400> 15

ttcctgcagc ccgggttcac gttgatgccg ttcttc 36

Claims

1. Equisetum arvense death geneHvSrp54kThe method is characterized in that: the geneHvSrp54kIs the sequence shown in Seq ID No. 1.

2. A dsRNA for controlling a coccinella twenty-eight star ladybug, characterized in that: the dsRNA targeting silencing the lethal gene of the Equisetum solani according to claim 1HvSrp54kThe dsRNA is a sequence shown in the Seq ID No. 2.

3. The dsRNA of claim 2, characterized in that: the 5 'and/or 3' ends of the dsRNA also have promoter sequences.

4. The dsRNA of claim 3, characterized in that: the promoter sequence is a T7 promoter sequence, and the T7 promoter sequence is a sequence shown in the Seq ID No. 3.

5. A recombinant plasmid, characterized in that: the recombinant plasmid contains the death gene of the Equisetum arvense of claim 1HvSrp54kOr comprising the dsRNA of any one of claims 2-4.

6. A cell, characterized in that: the cells contain the lethal gene of the Equisetum arvense of claim 1HvSrp54kEither comprising the dsRNA of any one of claims 2-4 or comprising the recombinant plasmid of claim 5.

7. The lethal gene of Equisetum arvense as claimed in claim 1HvSrp54kUse of the dsRNA of any one of claims 2-4, or the recombinant plasmid of claim 5, or the cell of claim 6, for the preparation of a product for controlling the plant of the species ladybug.

8. The lethal gene of Equisetum arvense as claimed in claim 1HvSrp54kThe dsRNA of any one of claims 2 to 4, or the recombinant plasmid of claim 5, or the cell of claim 6, in the preparation of a product for inhibiting the growth of Equisetum arvense.

9. The lethal gene of Equisetum arvense as claimed in claim 1HvSrp54kUse of the dsRNA of any one of claims 2-4, or the recombinant plasmid of claim 5, or the cell of claim 6, for the preparation of a product that promotes death of the coccinella solani.

10. A kit for preventing and controlling the twenty-eight star ladybug of eggplant is characterized in that: the kit contains the death gene of the Equisetum arvense of claim 1HvSrp54kThe dsRNA of any one of claims 2-4, or the recombinant plasmid of claim 5, or the cell of claim 6.