CN116019827A

CN116019827A - Application of miR-8072 expression promoter in preparation of antitumor drugs

Info

Publication number: CN116019827A
Application number: CN202310027207.7A
Authority: CN
Inventors: 高玉婧; 房玉杰; 李璞; 黄永丽; 郭宇琪
Original assignee: Ningxia Medical University
Current assignee: Ningxia Medical University
Priority date: 2023-01-09
Filing date: 2023-01-09
Publication date: 2023-04-28

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of an expression promoter of miR-8072 in preparation of an antitumor drug. The tumor comprises, but is not limited to, triple negative breast cancer, the sequence of miR-8072 is shown as SEQ ID NO.1, and the expression promoter of miR-8072 comprises a recombinant expression plasmid containing miR-8072. According to the invention, the expression level of miR-8072 of a patient with triple negative breast cancer has obvious correlation with the obvious prolongation of the total survival time of the patient, and the development of triple negative breast cancer can be effectively inhibited by over-expression of miR-8072, so that the result shows that miR-8072 is a potential diagnosis marker and a therapeutic molecular target for triple negative breast cancer.

Description

Application of miR-8072 expression promoter in preparation of antitumor drugs

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of an expression promoter of miR-8072 in preparation of an antitumor drug.

Background

Breast cancer is the most frequently diagnosed cancer of women, and is also the main cause of cancer death, and according to recent statistics in 2020, breast cancer of women has surpassed lung cancer and becomes the most common cancer. Triple Negative Breast Cancer (TNBC) is a subtype of breast cancer that has a higher recurrence and metastasis capacity than other types of breast cancer. Studies have shown that triple negative breast cancer patients are often worse than other types of breast cancer patients and are more susceptible to chemotherapy, so early and late stages are generally treated with chemotherapy, but currently there is a lack of effective targeted drug treatment for triple negative breast cancer, which has prompted people to treat triple negative breast cancer by looking for molecular targets.

microRNAs are single-stranded small molecule RNAs in eukaryotes, generally consisting of 18-20 nucleotides, which typically bind to and regulate expression of the mRNA in the 3' UTR region, and numerous studies have shown that miRNAs are closely related to the development and progression of tumors. In breast cancer cells, mirnas are often used as oncogenes or tumor suppressors to regulate cell cycle progression, proliferation, invasion, migration, epithelial-to-mesenchymal transition, and the like. Studies show that miR-8072 is related to prognosis of gastric cancer resected patients, but the action and mechanism of miR-8072 in tumorigenesis and development including breast cancer are not yet reported.

Disclosure of Invention

In view of the above technical problems, the invention provides application of an expression promoter of miR-8072 in preparation of anti-tumor drugs, wherein tumors include but are not limited to triple negative breast cancer.

Further, the sequence of miR-8072 is shown as SEQ ID NO. 1.

Still further, the expression promoter of miR-8072 comprises a recombinant expression plasmid containing miR-8072.

Based on the same inventive concept, the invention also provides application of the preparation for detecting miR-8072 in preparation of products for diagnosing and/or prognosis of triple negative breast cancer.

Further, the preparation for detecting miR-8072 comprises a preparation for detecting miR-8072 transcription based on a high-throughput sequencing method and/or based on a quantitative PCR method and/or based on a probe hybridization method.

Still further, an elevated level of miR-8072 in a triple negative breast cancer patient is indicative of an increased overall survival of the patient.

The invention has the following beneficial effects:

the invention discovers that the expression level of miR-8072 of a patient with triple negative breast cancer has obvious correlation with the obvious prolongation of the total survival time of the patient, and is an effective marker for diagnosis and prognosis of triple negative breast cancer. In addition, the effect of miR-8072 is explored by using animal and cell models, and the result shows that the over-expression of miR-8072 can effectively inhibit the development of triple negative breast cancer no matter in vivo or in vitro, thereby enhancing the prospect of the triple negative breast cancer serving as a treatment target for improving the clinical curative effect of the triple negative breast cancer.

Drawings

FIG. 1 is a comparison of total survival of TNBC patients with high and low expression of miR-8072.

FIG. 2 shows the effect of miR-8072 on TNBC cell proliferation, wherein A is the growth capacity of cells, B is the colony forming capacity of cells, and C is the cell proliferation ratio.

FIG. 3 shows the effect of miR-8072 on TNBC cell migration ability, wherein A is cell longitudinal migration ability, and B is cell horizontal migration ability.

FIG. 4 is the effect of miR-8072 on TNBC tumor development in mice. Wherein A is a mouse picture, B is a tumor picture, C is tumor weight, D is tumor volume, and E is the expression level of Ki67, a triple negative breast cancer cell proliferation related index.

Detailed Description

The present invention will now be described in detail with reference to the drawings and specific examples, which should not be construed as limiting the invention. Unless otherwise indicated, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples are commercially available unless otherwise indicated.

Example 1: differential expression of miR-8072

The relationship between miR-8072 expression level and total survival of 97 TNBC breast cancer patients is analyzed by using a TCGA database.

The results are shown in FIG. 1, where patients with higher miR-8072 expression levels have significantly longer overall survival relative to patients with lower miR-8072 expression levels.

Example 2: miR-8072 in-vitro cancer inhibition capability verification

1 method

1.1 Mimics and lentiviral packaging over-expressing miR-8072

The miR-8072 sequence (SEQ ID NO. 1) is: GCGUCAAGAUGGCGGCGGGGAG GUAGGCAGAGCAGGACGCCGCUGCUGCCGCCGCCACCGCCGCCUCCGC UCCAGUCGCC.

Over-expressed mimics delegated to Guangzhou Ruibo biotechnology Co., ltd, and over-expressed lentivirus packaging delegated to Shanghai Ji Kai biotechnology Co., ltd.

1.2 cell transfection

Taking MDA-MB-231 cells growing to a cell log phase (70% -80%), spreading the cells into a 6-well plate after digestion, enabling the cell growth density to be 70% -80% after 24 hours, preparing transfection reagent A liquid (Opti-mem+miR-8072 micrometers) and B liquid (Opti-mem+lip 2000), adding the A liquid into the B liquid after standing for 5 minutes, gently mixing, adding the mixture into the 6-well plate after standing for 30 minutes, supplementing 1.6ml of serum-free culture medium into each well, changing the culture medium into normal 1640 culture medium after 6 hours, and carrying out subsequent experiments after 24 hours.

1.3 cell infection

Taking MDA-MB-231 cells growing to a cell log phase (70% -80%), digesting, spreading the cells into a 6-well plate to enable the cell growth density to reach 30% -40% after 24 hours, and preparing an infectious agent: and adding a lentivirus+ infection reagent which overexpresses miR-8072 into a 6-hole plate, changing the liquid of cells after 12 hours, and carrying out subsequent experiments after pressurizing and screening for one week by puromycin after 72 hours.

1.4Edu experiment

Taking cells in a logarithmic growth phase, inoculating the cells into a 96-well plate, culturing for 24 hours, adding a Edu reagent, incubating for two hours, discarding a culture medium, washing with PBS, adding a fixing solution to fix the cells, adding Edu of a coloring agent for dyeing, observing and photographing under a microscope in a dark place, counting and counting.

1.5MTS assay

Tumor cells of control and experimental groups were formulated in 10% fetal bovine serum medium to 1X 10 ³ Cell suspensions of individual cells/100 ul/well, 96 well plates were incubated, at 0, 1, 2, 3, 4 and 5d, respectively, with 20ul of MTS solution added, after 2 hours of reaction, absorbance values of each well were measured at 490nm using a full wavelength microplate reader, and statistics were performed after all measurements were completed.

1.6 plate cloning experiments

Tumor cells of the control group and the experimental group were inoculated into a 6-well plate 1000 cells per well, and after 2 weeks of culture, the cells were washed twice with PBS, fixed with ice methanol for 20 minutes, stained with crystal violet for 20 minutes, photographed under a microscope, and clone formation was calculated from how many cells.

1.7 migration Capacity analysis

The transmembrane experimental analysis was performed using a 24-well transmembrane cell without matrigel. Control and experimental group cells (2X 10) treated with serum-free RPMI-1640 medium were added to the upper chamber ⁴ And/well), the lower chamber was added with 20% fetal bovine serum culture medium. Cells were incubated at 37℃with 5% CO ₂ Culturing under the condition for 24 hours (migration experiment), fixing the surface of the chamber with methanol for 20min, and dyeing with crystal violet for 20min. Three fields of view were randomly selected under the microscope to capture the migrated cells, counted and counted.

1.8 scratch healing experiments

Cells of the experimental group and the control group were inoculated in a 6-well plate, cultured until confluence after 12 hours, the cell layer was gently scratched by the tip of a gun head, and the medium was replaced after washing with PBS. The width of the lesion was photographed with a microscope and marks were made on the bottom of the plate indicating the initial image position of the lesion. Culturing in incubator was continued, and images of the same area were recorded with microscope at every interval of 12 or 24 hours.

2 results

As shown in figure 2, after miR-8072 is over-expressed, the growth capacity, the colony forming capacity and the proliferation proportion of cells are obviously reduced, and the results show that miR-8072 can inhibit the proliferation capacity of breast cancer cells in vitro.

As shown in FIG. 3, after miR-8072 is over-expressed, the number of cells passing through a Transwell chamber is reduced, and the healing speed of scratches is reduced, so that the miR-8072 can inhibit migration capacity of triple negative breast cancer cells.

Example 3: verification of cancer inhibition capability of miR-8072 in vivo

1 method

Female nude mice of 4 weeks old were subcutaneously injected with MDA-MB-231 cells (5X 10) stably overexpressing miR-8072 and controls ⁶ ). Tumor volume was monitored weekly, mice were euthanized 5 weeks after inoculation, tumor mass was weighed and photographed.

2 results

As shown in fig. 4, compared with the control group cells, the growth capacity of the MDA-MB-231 cells which over-express miR-8072 in the nude mice is obviously reduced, the tumor volume formed by the experimental end point is smaller, and the weight is lighter; the proliferation-related index Ki67 was expressed at a weaker level. Shows that the miR-8072 can inhibit proliferation capacity of TNBC cells in vivo.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention also include such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof.

Claims

Use of an expression enhancer of mir-8072 in the preparation of an anti-tumor medicament, wherein the tumor comprises, but is not limited to, triple negative breast cancer.
2. The use of claim 1, wherein the sequence of miR-8072 is set forth in SEQ id No. 1.
3. The use of claim 2, wherein the expression enhancer of miR-8072 comprises a recombinant expression plasmid comprising miR-8072.
4. Use of the formulation of miR-8072 in the detection of claim 1 for the preparation of a product for diagnosing and/or prognosing triple negative breast cancer.
5. The use of claim 4, wherein the preparation for detecting miR-8072 comprises a preparation for detecting miR-8072 transcription based on a high throughput sequencing method and/or based on a quantitative PCR method and/or based on a probe hybridization method.
6. The use of claim 4, wherein an elevated level of miR-8072 in a patient with triple negative breast cancer is indicative of an increased overall survival of the patient.