CN110917206B

CN110917206B - Application of miR-674-5p in preparation of glioma treatment drug

Info

Publication number: CN110917206B
Application number: CN201911249650.9A
Authority: CN
Inventors: 何辉; 金国华; 李雯; 秦建兵
Original assignee: Nantong University
Current assignee: Nantong University
Priority date: 2019-11-04
Filing date: 2019-12-09
Publication date: 2020-12-22
Anticipated expiration: 2039-12-09
Also published as: CN110917206A

Abstract

The invention discloses a new medical application of miR-674-5p, and particularly relates to an application of miR-674-5p in preparation of a medicine for treating glioma. In-vitro proliferation and migration experiments prove that miR-674-5P can inhibit proliferation (P is less than 0.05) and migration (P is less than 0.05) of glioma cells in vitro; furthermore, in vivo tumor formation experiments show that miR-674-5p can inhibit the growth of glioma in vivo, and the weight of glioma over-expressing miR-674-5p is obviously lighter than that of glioma normally expressing miR-674-5 p. Therefore, the miR-674-5p and the analogues thereof can be used for preparing the medicine for treating glioma and have good application prospect.

Description

Application of miR-674-5p in preparation of glioma treatment drug

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of miR-674-5p in preparation of a medicine for treating glioma.

Background

Gliomas are a common primary brain tumor, and there are many types, including astrocytomas, oligodendrogliomas, ependymomas, etc., among which glioblastoma multiforme (GBM) is the most common malignant tumor of the central nervous system, accounting for more than 80% of malignant brain tumors. High mortality, high relapse rate, and short overall survival time are typical features of GBM. The diffuse invasiveness and high metastasis of GBM make the GBM unable to be completely removed by surgery, and although a method combining surgery, radiotherapy and chemotherapy can be adopted, the median survival time of GBM patients is still short and is only 12-15 months. Therefore, other therapeutic strategies including immunotherapy and gene therapy are becoming important research directions.

microRNA (miRNA) is short-chain non-coding RNA with the length of about 20-24 nucleotides, and can regulate the post-transcriptional expression of a target gene by blocking the translation of mRNA of the target gene or accelerating the degradation of the mRNA. The microRNAs play an important role in the processes of cell proliferation, differentiation, migration, apoptosis and the like by regulating the expression of target genes of the microRNAs. A large body of data suggests that microRNAs are involved in many human diseases, including cancer, and that they are involved in the processes of tumor development, progression, invasion, migration, metastasis, and the like.

Based on the background, if the key microRNAs influencing the generation and development of glioma can be found, the microRNAs can become a new target point for treating glioma, and a breakthrough is brought to the treatment of glioma.

Disclosure of Invention

The invention aims to provide a novel medical application of miR-674-5p, and particularly relates to an application of miR-674-5p in preparation of a drug for treating glioma.

In order to achieve the purpose, the invention adopts the following technical scheme:

the application of miR-674-5p in preparing a medicine for treating glioma, wherein the RNA sequence of miR-674-5p is as follows: GCACUGAGAUGGGAGUGGUGUA (SEQ ID NO. 1).

Further, miR-674-5p inhibits growth of glioma.

Further, miR-674-5p inhibits proliferation and migration of glioma cells.

Application of a reagent capable of expressing miR-674-5p in preparation of a medicine for treating glioma.

Further, the reagent capable of expressing miR-674-5p comprises a small molecule RNA analogue.

Further, the reagent capable of expressing miR-674-5p comprises one or more of a double-stranded RNA, a plasmid and a viral vector which are directly chemically synthesized.

In-vitro proliferation and migration experiments prove that miR-674-5P can inhibit proliferation (P is less than 0.05) and migration (P is less than 0.05) of glioma cells in vitro; furthermore, in vivo tumor formation experiments show that miR-674-5p can inhibit the growth of glioma in vivo, and the weight of glioma over-expressing miR-674-5p is obviously lighter than that of glioma normally expressing miR-674-5 p. Therefore, the miR-674-5p and the analogues thereof can be used for preparing the medicine for treating glioma and have good application prospect.

Drawings

FIG. 1 shows the results of the proliferation assay of example 1. Wherein: a is the EdU incorporation experiment result 48 hours after C6 cells are transfected with miR-NC or miR-674-5p analogue, Hoechst stains nuclei, and a ruler =200 microns; b is the statistics of the proportion of EdU-positive cells (mean. + -. standard error;. X.)P<0.001); c is a flow cell cycle result 24 hours after C6 cells are transfected with miR-NC or miR-674-5p analogues; d is the statistics of the proportion of cells in S phase (mean. + -. standard error;. X)P<0.001); e is the growth curve of C6 cells at 0, 1, 2, 3, 4 days after transfection of miR-NC or miR-674-5p analogue.

FIG. 2 shows the results of the migration assay in example 2. Wherein: a is the result of a Transwell experiment 24 hours after C6 cells are transfected with miR-NC or miR-674-5p analogue, and the scale =200 microns; b is the cell number statistics (mean. + -. standard error;. X.) across the chamberP<0.001); c is scratch test results 0, 24 and 48 hours after C6 cells were transfected with miR-NC or miR-674-5p analogs, scale =400 microns; d is the statistic of the score healing area ratio (mean. + -. standard error;)P<0.01，*P<0.05）。

FIG. 3 shows the results of in vivo tumor formation experiments in example 3. Wherein: a is the normal expression of transplantation

Or over-expression

Photographs of nude mice 3 weeks after C6 cells of miR-674-5p and photographs of tumors taken out; b is the statistics of tumor weight (mean. + -. standard error;)P<0.05); c is expression verification of miR-674-5p in tumor tissue (mean. + -. standard error;)P<0.001）。

Detailed Description

The following examples are provided to illustrate specific embodiments of the present invention. It should be emphasized that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. These techniques are fully described in the following documents: for example, Sambrook molecular cloning, A laboratory Manual, 2 nd edition (1989); DNA cloning, volumes I and II (D.N. Glover editor 1985); oligonucleotide Synthesis (M.J. Gait eds., 1984); nucleic acid hybridization (B.D. Hames and S.J. Higgins eds. 1984); protein purification: principles and practice, 2 nd edition (Springer-Verlag, N. Y.), and A handbook of Experimental immunology, volumes I-IV (D. C. Weir and C. C. Blackwell, eds. 1986). Alternatively, the procedure may be followed according to the instructions provided by the reagent manufacturer.

The miR-674-5p provided by the invention is found to promote the differentiation of neural stem cells in previous researches of the inventor, while glioblastoma multiforme has partial stem cell characteristics, and the differentiation and proliferation of the stem cells are generally considered to be reverse processes, so the inventor believes that the miR-674-5p possibly can influence the growth of glioma.

The rat glioma cell line C6 was used for in vitro proliferation and migration experiments, and immunodeficient BALB/C nude mice were used for in vivo tumorigenesis experiments.

According to the invention, miRNA analogues are adopted to up-regulate the expression of miR-674-5p, miR-NC is used as a control, and whether the proliferation and migration of C6 cells are changed or not is observed.

According to the invention, C6 cells are respectively infected by lentiviruses carrying miR-674-5p analogues and control miR-NC, then screening is carried out, a C6 cell line which stably over-expresses and normally expresses miR-674-5p is obtained, the cell line is injected to the subcutaneous of a nude mouse to carry out a tumor formation experiment, and the growth conditions of tumors under two conditions are observed.

The invention may be practiced in a variety of ways to administer to a subject: injecting miR-674-5p analogue, injecting lentivirus carrying miR-674-5p analogue, injecting liposome-coated miR-674-5p analogue and the like.

The rat glioma cell line C6 used in the following examples was from American model thinCell preservation center (ATCC) cultured in 5% CO₂In a 37-degree incubator, the culture medium was DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin.

Examples the miRNA analogs were from leber, guangzhou, and cell transfection was performed using Invitrogen Lipofectamine RNAiMAX transfection reagent, the transfection procedure was as described, and the miRNA analog concentration was 50 nanomolar. Lentiviruses carrying miRNA analogs are from jecky, shanghai.

Sequence of miR-674-5p analogue:

a sense strand (5'- >3'): GCACUGAGAUGGGAGUGGUGUA (SEQ ID NO. 2);

the antisense strand (5'- >3') UACACCACUCCCAUCUCAGUGC (SEQ ID NO. 3).

miR-674-5p overexpresses lentivirus information:

carrier name: GV 369;

the element sequence is as follows: Ubi-MCS-SV 40-EGFP-IRES-puromycin;

cloning site: AgeI/NheI.

Example 1

Proliferation detection: 5-ethynyl-2' -deoxyuridine (EdU) incorporation experiments, flow-testing of cell cycle, profiling of cell growth curves

1. EdU incorporation experiments: EdU is a thymidine analog that can be incorporated into replicating DNA molecules and thus can be used to detect cellular DNA replication activity. C6 cells were plated onto 24-well plates (2 × 104 cells/well) and EdU was added to the cell culture medium 48 hours after transfection (final concentration 50 μm), incubated at 37 degrees for 2 hours, and the EdU-positive cell ratio was obtained by counting the number of positive signal cells and the total number of cells for at least 3 fields, as per the EdU assay kit instructions.

As shown in FIGS. 1A-B, miR-674-5p analogs can significantly reduce the proportion of EdU positive cells, indicating that cellular DNA replication, i.e., proliferation, can be inhibited.

2. Flow detection of cell cycle: at 48 hours after miRNA analogue transfection, C6 cells were collected by 0.25% pancreatin digestion, washed with precooled PBS, fixed with precooled 75% ethanol for 24 hours, stained with Pharmingen ™ PI/RNase stain from BD company for 30 minutes, and finally cell cycle distribution was examined by a flow cytometer.

As shown in FIGS. 1C-D, miR-674-5p analogs can significantly reduce the proportion of cells in the S phase (DNA replication phase), i.e., can inhibit cell proliferation.

3. Cell growth curves: MTS (Promega corporation) is a novel tetrazolium compound that can be biologically reduced by cells to a colored product, which is done in metabolically active cells and thus can be used for cell viability assays. The growth curve was constructed by seeding C6 cells in 96-well plates (2 × 103 cells/well), adding 20 μ l of MTS solution per well on

days

0, 1, 2, 3, 4 after transfection, incubating at 37 degrees for 3 hours, and then measuring the absorbance at 490 nm to calculate the corresponding number of cells as a standard curve.

As shown in FIG. 1E, miR-674-5p analogs can significantly inhibit cell growth.

Example 2

Migration detection: trans-well experiment and scratch experiment

1. Trans-well experiments: mix 3x10⁴C6 cells transfected with miRNA analogs were seeded on the upper layer of a tran-well chamber (Corning Co.) and cultured in serum-free DMEM, 600. mu.l of DMEM containing 10% fetal bovine serum was added to the lower layer of the chamber, after 24 hours, the cells on the upper layer were removed, the cells migrated to the lower layer were fixed with 4% paraformaldehyde, stained with 0.2% crystal violet, and the number of migrated cells was counted.

As shown in FIGS. 2A-B, the number of C6 cells migrated by the miR-674-5p analogue transfection group is obviously less than that of the control group, and the miR-674-5p analogue can inhibit the migration of the cells.

2. Scratch test: c6 cells are planted into a 6-well plate, DMEM containing 5% fetal calf serum is used for culturing for 24 hours, a 1 ml sterile gun head is used for marking a mark in the cells, PBS is used for washing for three times to remove floating cells, DMEM containing 1% fetal calf serum is added for culturing, pictures are respectively taken at 0 hour, 24 hours and 48 hours after the mark is scratched, the area of the scratch is measured by Image J software, the proportion of the healing area of the scratch to the original scratch is calculated, and the healing condition of the scratch is revealed.

As shown in FIGS. 2C-D, the speed of healing of the scratches of the miR-674-5p analogue transfection group is slower than that of the control group, and the miR-674-5p analogue can inhibit the migration of cells.

Example 3

C6 cell infected by slow virus carrying miRNA analogue, screening and injecting into tumor

1. C6 cells were plated onto 24-well plates (2X 10)⁴Cells/hole) until the cell is 80% full, performing lentivirus infection, replacing fresh culture solution 12 hours after infection, replacing fresh culture solution containing 2 microgram/ml puromycin 72 hours after infection, performing miR-674-5p expression detection on the screened cells, and proving that the establishment of a C6 cell line with stable and high expression of miR-674-5p is successful.

2. The tumor formation experiment is carried out on immunodeficient BABL/C nude mice (the week age is 4-6 weeks), the nude mice are randomly divided into 2 groups, 200 microliters of C6 cells which normally express or over express miR-674-5p are respectively injected subcutaneously on the right back after anesthesia, the images are taken after 2 weeks, the tumors of the injection part of the nude mice are taken out, and the images are taken and weighed.

As shown in FIG. 3, the tumors produced by injecting C6 cells over-expressing miR-674-5p are smaller and lighter than the control group, and the fact that miR-674-5p can inhibit the growth of glioma is proved.

Sequence listing

<110> university of southeast Tong

Application of <120> miR-674-5p in preparation of drug for treating glioma

<130> 20191104

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcacugagau gggaguggug ua 22

<210> 2

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gcacugagau gggaguggug ua 22

<210> 3

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

uacaccacuc ccaucucagu gc 22

Claims

The application of miR-674-5p in preparing a medicament for treating glioma, wherein the RNA sequence of miR-674-5p is as follows: GCACUGAGAUGGGAGUGGUGUA are provided.
2. Use according to claim 1, characterized in that: the miR-674-5p inhibits the proliferation and migration of glioma cells.
3. Use according to claim 1, characterized in that: the miR-674-5p inhibits growth of glioma.
4. Application of a reagent capable of expressing miR-674-5p in preparation of a medicine for treating glioma.