CN110623975B - microRNA328 for regulating TERT gene expression and application thereof - Google Patents

Abstract

The invention discloses a microRNA328 for regulating TERT gene expression and application thereof. The invention provides application of microRNA328 or a substance for inhibiting the expression of the microRNA 328. The invention discovers that miR328 has a remarkable inhibiting effect on the expression level of TERT mRNA of Hela cells, and an oligonucleotide inhibitor of miR-328 has a remarkable up-regulating effect on the expression level of TERT gene mRNA of Hela cells. The inhibitor of miR-328 has the function of remarkably increasing the angiogenisis capability of EPC. The inhibitor transfected EPC of miR-328 significantly inhibits NSC differentiation to glial cells. Researches show that miRNA is used as a target or a tool to enhance the activity of telomerase, theoretical basis is provided for the treatment of nervous system diseases such as Vascular Dementia (VD), and the like, and the miRNA has potential clinical application value.

Description

microRNA328 for regulating TERT gene expression and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a microRNA328 for regulating TERT gene expression and application thereof.

Background

Vascular Dementia (VD) is a clinical syndrome in which brain dysfunction is caused by cerebrovascular diseases, resulting in brain intelligence and cognitive dysfunction, and mainly manifested as disorders such as learning, memory, thinking, etc., which is the second leading cause of dementia following Alzheimer's Disease (AD). With the accelerating aging process of the world population, the number of VD patients is remarkably increased, and epidemiological statistics shows that the prevalence rate of the old aged over 65 years reaches 1-4%, and the prevalence rate of the old aged over 85 years reaches 14-16%. Senile dementia diseases including VD become the fourth disease causing death of the elderly after tumors, heart diseases and cerebral apoplexy. Therefore, the search for anti-VD drugs and treatment methods becomes an irresistible task for medical workers.

The discovery of Neural Stem Cells (NSCs) brings a new hope for repairing nerve injury, and research shows that the co-culture of EPC and NSC can provide a good microenvironment for neurogenesis, improve the proliferation of NSC and promote the differentiation of NSC to neurons. The activity and amount of EPC are related to EPC senescence. Cell senescence is due to cell cycle arrest, and telomere shortening, which occurs during cell replication, is the most common cause of senescence. Telomeres are composed of DNA and proteins, located at the ends of chromosomes in eukaryotic cells, and their DNA is composed of specific repetitive sequences. The DNA repeats are expressed differently between species. With chromosome replication, telomere length will be shortened, but after shortening to a certain length, it will not be further shortened, and the cell can not divide again, showing aging and apoptosis changes. Telomerase is a ribonucleoprotein consisting of 3 parts: telomerase RNA (hTR or TRC) template, telomerase-related protein (TPI), and telomerase reverse transcriptase (TERT), having the activity of modulating telomere length, function, and reverse transcription. TERT is one of protein components in telomerase, is a catalytic subunit of the telomerase, and plays an important role in the activation of the telomerase and the specific amplification process of telomere DNA. TERT can inhibit apoptosis by affecting telomerase activity and further extending telomere length. When TERT is highly expressed, the telomerase activity can be activated, the shortening of telomeres is inhibited, the shortening speed of the telomeres is slowed down, even the lengthening of the telomeres is promoted, and the effects of resisting cell aging and apoptosis change are realized. EPCs have the characteristics of limited amplification capacity, reduced regeneration capacity along with the increase of differentiation times and easy aging under the in vitro culture condition. Therefore, the regulation of the activity of EPC telomerase can prevent the EPC from aging and enhance the functions of the EPC in vivo and in vitro proliferation and angiogenesis is a problem worth deep thought and discussion.

miRNA is a highly conserved single-stranded non-coding small RNA, consists of about 20-22 mononucleotides, is widely present in eukaryotes, and participates in post-transcriptional regulation.

Disclosure of Invention

In order to treat diseases caused by increased or decreased expression of TERT proteins or genes, the present invention provides the following technical solutions:

one object of the present invention is the use of a substance that inhibits the expression of microRNA328 or its encoding gene.

The invention provides an application of a substance for inhibiting microRNA328 or coding gene expression thereof in at least one of the following A1) -A6) or in preparation of a product with at least one function of the following A1) -A6):

A1) increasing the TERT protein activity or expression of a TERT protein coding gene;

A2) increasing the activity of a TERT protein or the expression of a TERT protein coding gene in a cell;

A3) treating a disease caused by a decrease in the activity of a TERT protein or a decrease in the expression of a TERT protein-encoding gene;

A4) increasing the angiogenic capacity of endothelial progenitor cells;

A5) inhibiting differentiation of neural stem cells into glial cells;

A6) treating neurological disorders;

the microRNA328 is B1) or B2) as follows:

B1) a nucleic acid as shown in sequence 1;

B2) and (b) a nucleic acid molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 1 and has the same function as the sequence 1.

The substitution and/or deletion and/or addition of one or more nucleotides is the substitution and/or deletion and/or addition of no more than 10 nucleotides.

In the application, the substance is a microRNA328 inhibitor or a microRNA328 inhibitory oligonucleotide;

in the embodiment of the invention, the microRNA328 inhibitory oligonucleotide is a nucleotide sequence (inhibitor of miRNA 328) shown in sequence 2, which is purchased from Ruibo corporation, Ruibo Biotechnology Inc., Guangzhou and is known to be an inhibitor of miRNA 328.

In the above application, in a2, the cell is a tumor cell or a neural stem cell;

the tumor cell is specifically a cervical cancer cell, and in the embodiment of the invention, the tumor cell is a hela cell;

the nervous system disease is vascular dementia.

The 2 nd object of the present invention is to provide a substance that inhibits the expression of microRNA328 or a gene encoding the same.

The substance for inhibiting the expression of the microRNA328 or the coding gene thereof is a microRNA328 inhibitor or a microRNA328 inhibitory oligonucleic acid.

In the embodiment of the invention, the microRNA328 inhibitory oligonucleotide is C1) or C2) as follows:

C1) is a nucleic acid shown as a sequence 2;

C2) a nucleic acid molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 2 and has the same function as the sequence 1;

C3) a recombinant vector, a recombinant microorganism or a transgenic cell containing a gene encoding a nucleic acid represented by C1) or C2).

It is a3 rd object of the invention to provide a method for increasing TERT protein activity or expression of a TERT protein-encoding gene in a cell.

The method provided by the invention comprises the following steps: and the expression of microRNA328 or the coding gene thereof in the cell is inhibited, so that the activity of the TERT protein in the cell or the expression of the TERT protein coding gene is improved.

The 4 th object of the invention is to provide a product, which comprises the substance for inhibiting the expression of the microRNA328 or the coding gene thereof;

the product has at least one of the following functions A1) -A6):

A1) increasing the TERT protein activity or expression of a TERT protein coding gene;

A2) increasing the activity of a TERT protein or the expression of a TERT protein coding gene in a cell;

A3) treating a disease caused by a decrease in the activity of a TERT protein or a decrease in the expression of a TERT protein-encoding gene;

A4) increasing the angiogenic capacity of endothelial progenitor cells;

A5) inhibiting differentiation of neural stem cells into glial cells;

A6) treating nervous system diseases.

In the above product, the neurological disease is vascular dementia.

The inhibition of differentiation of neural stem cells into glial cells inhibits differentiation of neural stem cells into glial cells when endothelial progenitor cells and neural stem cells are co-cultured.

The 5 th purpose of the invention is to provide the application of the microRNA328 or the coding gene thereof or the recombinant vector, the recombinant microorganism or the transgenic cell containing the coding gene thereof.

The invention provides an application of microRNA328 or a coding gene thereof or a recombinant vector, a recombinant microorganism or a transgenic cell containing the coding gene thereof in at least one of D1) -D5) or in preparation of a product with at least one function of D1) -D5) as follows:

D1) reducing the TERT protein activity or expression of a TERT protein encoding gene;

D2) reducing TERT protein activity or expression of a TERT protein encoding gene in a cell;

D3) treating a disease caused by an increase in the activity of a TERT protein or an increase in the expression level of a TERT protein-encoding gene;

D4) reducing the angiogenic capacity of endothelial progenitor cells;

D5) promoting the differentiation of the neural stem cells to the glial cells;

the microRNA328 is B1) or B2) as follows:

B1) a nucleic acid as shown in sequence 1;

B2) and (b) the nucleic acid molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 1 and has the same function as the sequence 1.

The method for promoting differentiation of the neural stem cells into the glial cells promotes differentiation of the neural stem cells into the glial cells when the endothelial progenitor cells and the neural stem cells are co-cultured.

It is a6 th object of the invention to provide a method for reducing TERT protein activity or expression of a gene encoding a TERT protein in a cell.

The method for the purpose of the invention comprises the following steps: improving the expression of microRNA328 or coding genes thereof in the cells, and realizing the reduction of the activity of TERT protein or the expression of TERT protein coding genes in the cells.

The application of miRNA328 as a target or tool in preparing or screening drugs for diseases caused by reduction or improvement of TERT protein or gene expression thereof is also within the protection scope of the invention.

Or, the application of miRNA328 as a target or a tool in preparing or screening drugs for neurological diseases is also within the scope of the present invention.

The above nervous system diseases are vascular dementia.

In order to find miRNA which is highly expressed in EPC and is specifically combined with action sites in TERT gene mRNA sequences, then inhibitor (inhibitor) is combined with miRNAs to prevent the miRNAs from being combined with TERT action sites, so that the expression of TERT is up-regulated, the activity of telomerase is enhanced, the regeneration of EPC is promoted, and the miRNA and NSC are co-transplanted into a vascular dementia rat model body to induce NSC to differentiate towards neurons, provide theoretical basis for the treatment of nervous system diseases such as vascular dementia and the like, and have potential clinical application value.

The invention discovers that miR328 has a remarkable inhibiting effect on the TERT mRNA expression level of Hela cells. The oligonucleotide inhibitor of miR-328 has a remarkable up-regulation effect on the expression level of TERT gene mRNA of Hela cells. In order to verify the influence of miR-328 on EPC hemangiogenic capability, the experimental result shows that the inhibitor effect of miR-328 is observed in the experiment, the result shows that the effect can obviously increase the hemangiogenic capability of EPC, and compared with a control group, the tubular structure is increased to (9.33 +/-2.08). The experiment further observes the influence of miR-328inhibitor on the differentiation of the NSC co-cultured with the EPC, and the inhibitor transfected EPC of miR-328 obviously inhibits the differentiation of the NSC to the glial cell. Researches show that miRNA is used as a target or a tool to enhance the activity of telomerase, theoretical basis is provided for the treatment of nervous system diseases such as Vascular Dementia (VD), and the like, and the miRNA has potential clinical application value.

Drawings

FIG. 1 shows the microRNA inhibitory activity of Hela cells transiently transfected with pEZX-MT01-TERT-3' UTR plasmid.

FIG. 2 is a graph of the effect of microRNAs on TERT mRNA levels.

FIG. 3 is a graph of the effect of microRNA oligonucleotide inhibitors on TERT mRNA levels.

FIG. 4 is a morphological observation of rat bone marrow derived endothelial cells; A. adherent growth cells formed after rat bone marrow mononuclear cells are cultured in an endothelial cell culture system for 7 days in a culture dish coated by Fn and are in an oval shape or a polygon shape; B. adherent cells Wright's Giemsa were stained (. times.200).

FIG. 5 shows the effect of micic and inhibitor of microRNA on the vascularization ability of EPC (. times.100). A. B is observation of ability of micic (Control, miR-328) of microRNA to transfect EPC into blood vessels. C. D is observation of the capability of transfecting EPC into blood vessels by inhibitor (Control, miR-328) of microRNA. E. And (5) counting the blood vessel data of each component. P <0.01, compared to the corresponding mimic group. # P <0.5, compared to control inhibitor.

FIG. 6 shows the effect of immunofluorescence assay microRNA on differentiation of EPC co-cultured NSCs (x 100); p <0.01, compared to EPC/miRNA + NSC. # P <0.5, compared to control and EPC + NSC.

Fig. 7 shows the effect of miRNA328 on TERT protein expression in EPC co-cultured NSCs (: P <0.01,: P <0.001, compared to control).

FIG. 8 is a comparison of escape latencies for each group; p <0.01 compared to Sham group.

FIG. 9 is a comparison of quadrant activity times for each set of destinations; p <0.01 compared to Sham group.

FIG. 10 is a comparison of the number of passes through the primary station; p <0.01 compared to Sham group.

FIG. 11 is a comparison of escape latencies for groups following treatment; p <0.01 compared to Sham group and p <0.05 compared to other treatment groups.

FIG. 12 is a comparison of quadrant activity times for the various groups of original stations after treatment; p <0.01 compared to Sham and p <0.05 compared to other treatment groups.

FIG. 13 is a comparison of the number of times each group passed through the original station after treatment; p <0.01 compared to Sham and p <0.05 compared to other treatment groups.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The mimic of the miRNA328 in the following examples is the nucleotide sequence of the miRNA328 shown in sequence 1;

the inhibitor of miRNA328 in the following examples is the nucleotide sequence shown in sequence 2 (available from leber biotechnology limited, guang, which is known to be an inhibitor of miRNA 328).

Example 1 Activity analysis of miRNA328 for luciferase reporter expression

The recombinant plasmid pEZX-MT01-3' UTR is a plasmid obtained by inserting the TERT gene (sequence 3) into pEZX-MT01 plasmid (purchased from Guangzhou multifunctional Gene Co., Ltd., product number: CmiT000001-MT01) between the multiple cloning sites XhoI and EcoRI at the upstream of the Renilla luciferase reporter gene hLuc.

Transfecting a recombinant plasmid pEZX-MT01-3'UTR with a transfection reagent Lipofecta-mine 2000 to obtain a Hela cell transfected with pEZX-MT01-3' UTR, transfecting the Hela cell transfected with pEZX-MT01-3'UTR with 50nM miR328 solution (water as a solvent and miR328 as a solute) with a transfection reagent Lipofecta RNAImax after 6 hours, and obtaining the Hela cell transfected with pEZX-MT01-3' UTR + miR328 after 48 hours.

The enzyme-labeling instrument detects and detects the expression of luciferase reporter genes in the pEZX-MT01-3' UTR + miR 328-transferred Hela cells, the renilla luciferase genes are used as the reporter genes, the firefly luciferase genes are used as normalization internal reference, and the action of miR328 on target genes is analyzed.

The result is shown in figure 1, and other miRNAs are used as controls, and the result shows that miR328 with the length of 50nM shows obvious inhibition effect on luciferase gene expression activity (p is less than 0.01) in pEZX-MT01-3' UTR reporter gene plasmid transient transfection, which indicates that miR328 can inhibit TERT gene mRNA expression in Hela cells.

Example 2 Effect of miRNA328 on the level of mRNA of TERT Gene of Hela cells

The influence on the level of TERT gene mRNA of Hela cells is detected by using the mimic and the inhibitor of miRNA328 respectively, and the mimic and the inhibitor without adding any miRNA328 are used as control groups.

Control group: hela cells were cultured normally to 80% confluence.

And (3) miRNA group: after the hela cells are cultured to 80% fusion, a micic solution of 50nM miRNA328 (solvent is water, and solute is the micic of miRNA 328) is transfected by Lipofectamine RNAiMAX and cultured for 48 h.

Inhibitor groups of mirnas: culturing until 80% of fusion, transfecting an inhibitor solution (solvent is water, solute is the inhibitor of miRNA 328) of 50nM miRNA328 by using Lipofectamine RNAiMAX, and culturing for 48 h.

The mRNA level of the TERT gene in Hela cells after 48 hours of transfection in each of the above groups was detected by PCR using the following primers:

TERT upstream primer: 5 'AGCATTTCACCCAGCGTCTA 3';

a downstream primer: 5 'CTTCAACCGCAAGACCGACA 3'.

The PCR amplification conditions were: after 5min of pre-denaturation at 94 ℃ 40 cycles (94 ℃ 30s, 57 ℃ 30s, 72 ℃ 60s) followed by 10min at 72 ℃ and 1h at 4 ℃.

The expression level of TERT gene in the control group was defined as 1, and the expression levels of TERT genes in the remaining groups were defined as the results relative to the control group.

The detection result of the TERT gene mRNA level of the Hela cells under the action of miR328 is shown in FIG. 2 (the change of the TERT gene mRNA expression on the ordinate is relative to the change of the TERT gene expression amount in the control group), and it can be seen that the TERT gene mRNA level of the Hela cells under the action of the mic of miR-328 is reduced by 0.42 compared with the control group.

The detection result of the TERT gene mRNA level of the Hela cells under the action of the inhibitor of miR328 is shown in figure 3; it can be seen that the inhibitor of miR328 has a significant up-regulation effect on the expression level of TERT gene mRNA of Hela cells compared with the control group, and the level of TERT gene mRNA of Hela cells can be increased to 1.24 under the effect of the inhibitor of miR 328.

The results show that miR-328 can inhibit the expression level of TERT gene mRNA in Hela cells, and an oligonucleotide inhibitor (inhibitor of miR-328) of miR-328 can significantly up-regulate the expression of TERT gene mRNA in Hela cells.

Example 3 Effect of miRNA328 on the angiogenic potential of rat bone marrow-derived Endothelial Progenitor Cells (EPCs)

1. Isolation and identification of rat bone marrow-derived Endothelial Progenitor Cells (EPC)

Taking an adult SD rat (purchased from Guangdong province medical laboratory animal center and using a license number: SYXK (Yue) 2010-0106) femur under a sterile condition, flushing out bone marrow, and separating mononuclear cells. Suspending the cells by using EGM-2 culture medium for culture, and discarding the non-adherent cells for 48 h. The fluids were changed every 3 days, after 10-14 days of cell confluency, the cells were stained with a slide glass of digested cells to carry out EPC immunofluorescence staining, and the cultured EPCs were identified (FIG. 4; A. adherent growth cells formed by culturing rat bone marrow mononuclear cells in an Fn-coated culture dish in an endothelial cell culture system for 7 days, which were oval or polygonal; B. adherent cells Wright's Giemsa staining (x 200)), thus confirming that EPCs were obtained.

2. Effect of miRNA328 on the vascularization ability of rat bone marrow-derived Endothelial Progenitor Cells (EPCs)

And (3) paving the EPC cells obtained in the step (1) on a 12-hole plate, after the cells grow to 80%, respectively transferring the mimic of the miRNA328 and the miRNA328 inhibitor into the cells, and transfecting for 6h for liquid change.

The above transfections were divided into the following groups:

the above transfections were divided into the following groups:

mimic (control) transfection of micrornas EPC: transfecting EPC with a mimic solution of 50nM Control (water as a solvent and Control as a solute) (mimic of Control, product catalog number miR1N0000001-1-5, sequence 5'-UUUGUACUACACAAAAGUACUG-3', product catalog number Mic 1N 0000001-5, product catalog number Mic (Penbo Biotech, Guangzhou)) to obtain the EPC transfected with mimic (Control);

mimic transfection of microRNA328 EPC: transfecting EPC with a micic solution (the solvent is water, and the solute is the micic of the microRNA 328) of 50nM microRNA328 to obtain the EPC transfected with the microRNA328 micic;

inhibition (control) of microRNA transfection of EPC: transfecting EPC with 50nM Control inhibitor solution (solvent is water, solute is Control inhibitor) (sequence of Control inhibitor: 5'-ACGGAAGGGCAGAGAGGGCCAG-3') to obtain EPC transfected with inhibitor (Control);

inhibitor transfection of microRNA328 EPC: transfecting the EPC with 50nM microRNA328 in an inhibitor solution (the solvent is water, and the solute is the inhibitor of the microRNA 328) to obtain the EPC transfected with the microRNA328 inhibitor.

The EPCs transfected with the various substances in each group were digested the next day (24 hours after transfection), stained with calcein 5uM for 15min, and the digested EPCs transfected with the various substances (1 ten thousand/well) were seeded in a 96-well plate plated with Matrigel gel (50ul) for 3 replicates; after 20 hours of incubation the formation of tubular structures was observed.

As shown in FIG. 5, A, B is an observation of the ability of micRNA mimic (Control, miR-328) to transfect EPC into blood vessels. C. D is observation of the capability of transfecting EPC into blood vessels by inhibitor (Control, miR-328) of microRNA. E. And (5) counting the blood vessel data of each component. P <0.01, mimic of miR-328 significantly reduced the angiogenic capacity of EPC compared to the mimic group of control. # P <0.5, inhibitor of miR-328 significantly increased the angiogenic ability of EPC compared to control inhibitor, and the tubular structure was increased to 9.33. + -. 2.08 compared to control.

Example 4 Effect of miRNA328 on differentiation of EPC Co-culture NSCs

1. Effect of miRNA328 on differentiation of EPC co-cultured NSCs

After incubating EPCs transfected with each substance in 2 of example 3 for 20 hours, they were each disrupted into a single cell suspension with NSC cells at a density of 1X 10⁶Per cm²Inoculated in the lower Transwell layer, incubated for 20 hours, EPCs transfected with various substances were inoculated in the upper Transwell layer at the same density) were cultured for 7 days, and then immunofluorescence was detected.

The above co-culture was divided into the following groups:

A. control group: 7 days after NSC cell culture, immunofluorescence was performed.

Epc + NSC group: EPC and NSC cells (the ratio of the number of the two cells is 1:1) were cultured for 7 days, and then immunofluorescence assay was performed.

EPC/miRNA328+ NSC group: after culturing micic EPC and NSC cells (the number ratio of the two cells is 1:1) transfected with microRNA328 for 7 days, immunofluorescence detection is carried out.

EPC/inhibitor + NSC group: after culturing the inhibitor-transfected EPC and NSC cells (the number ratio of the two cells is 1:1) of microRNA328 for 7 days, immunofluorescence detection is carried out.

The immunofluorescence detection method comprises the following steps: after the NSC cells were fixed with 4% paraformaldehyde, GFAP primary antibody (available from Cell Signaling Technology, cat # 3670S) was added and incubated overnight at 4 ℃, PBS was washed three times, secondary antibody (available from Abcam, cat # ab150079) was added and incubated for 1 hour in a cassette at room temperature, PBS was washed 3 times, and mounting was carried out, followed by observation and photographing under a fluorescent microscope.

Results are shown in figure 6, statistics for each component vessel, # P <0.01, compared to EPC/miRNA + NSC; # P <0.5, compared to control and EPC + NSC. The inhibitor EPC transfected with miR-328 significantly inhibited glial differentiation of NSCs, and the EPC/inhibitor + NSCs group were significantly different from the other groups (× P <0.01, compared to EPC/miRNA + NSCs. # P <0.5, compared to control and EPC + NSCs).

The inhibitor of miR-328 inhibits NSC differentiation to glial cells when EPC and NSC cells are co-cultured, and the mimic of miR-328 promotes NSC differentiation to glial cells when EPC and NSC cells are co-cultured.

2. Effect of miRNA328 on TERT protein expression in EPC cocultured NSCs

Enzyme-linked immunosorbent assay (ELISA) experiments were performed 7 days after incubation of EPCs transfected with each substance in example 3 for 20 hours and coculture with NSCs (number ratio of two cells: 1).

The above co-culture was divided into the following groups:

mimic group of micrornas 328: enzyme-linked immuno sorbent assay (ELISA) experiments were performed 7 days after culturing micic EPC and NSC cells transfected with microRNA 328.

Mice group of control: enzyme-linked immuno sorbent assay (ELISA) experiments were performed 7 days after micic EPC and NSC cells transfected with mcontrol were co-cultured.

Inhibitor group of microRNA 328: enzyme-linked immunosorbent (ELISA) experiments were performed 7 days after incubation of the inhibitor EPC and NSC cells transfected with microRNA 328.

Inhibit group of control: after culturing the control-transfected inhibitor EPC and NSC cells for 7 days, enzyme-linked immunosorbent assay (ELISA) was performed.

The method of enzyme-linked immunosorbent assay (ELISA) is as follows: proteins of NSC cells in the lower layer of the Transwell were extracted from protein lysates containing 1% PMSF, and the protein content of each group was determined according to the BCA protein assay. Diluting the histone samples by 4 times, and measuring the content of TERT in each group according to the operation of an ELISA kit product instruction. And adding 100 mu l of a sample to be detected into each hole of the sample hole to be detected, and arranging 3 multiple holes in parallel. The Optical Density (OD) of each well was measured at a wavelength of 450nm using a microplate reader. And obtaining a linear regression equation of a standard curve according to the concentration and the OD value of the standard substance, calculating the concentration of the sample, multiplying the concentration by the dilution times to obtain the concentration of the TERT in the sample, and calculating the content of the TERT protein in the sample.

Results as shown in fig. 7, compared to the control group, miR-328 imic transfected EPC significantly inhibited the expression level of TERT protein in NSC (P < 0.001); the miR-328inhibitor transfected EPC obviously up-regulates the expression level of TERT protein in NSC cells compared with the control group thereof (P < 0.01).

Example 5 Observation of therapeutic Effect of Co-transplantation of EPC and NSC on VD rat model

Firstly, establishing a rat VD model

The VD rat model is established by adopting an improved 2-VO method (Wuzhufu, Gaoyuanping, Liguanwu. modified bilateral common carotid artery ligation method is compared with a rat chronic cerebral ischemia model prepared by a traditional method, China J.Kangfu.J.2012, 27(3): 201-210). And performing behavioral examination 12 weeks after the operation to confirm that the molding is successful.

Sham group was control (n 15): anaesthetizing with 10% (mass ratio volume, g: ml) chloral hydrate by intraperitoneal injection at 400mg/kg, lying on the back, making incision in the middle of neck, separating bilateral common carotid artery under microscope, suturing incision, and feeding for later use;

the rest are model groups (n is 90): after anesthesia with 10% (mass/volume, g: ml) chloral hydrate by intraperitoneal injection at 400mg/kg, the bilateral common carotid arteries were separated under a microscope and permanently ligated with a thread in the supine position, a median incision in the neck. And (3) performing Morris maze detection, position navigation and space exploration behavior functions at 12 weeks after operation, judging the cognitive abilities of learning memory and space memory of the rat model, and proving that the VD model rat is successfully established. The model group animals were further randomized into: model group, NSC group, EPC + NSC group, EPC/miRNA328+ N, EPC/inhibitor + N group and M + E/i + N group, each group containing 15 individuals.

The behavioral examination was conducted in a Morris water maze test, and each group of rats was subjected to a Morris water maze directional navigation test. After 5 days of training, the mean escape latencies of the groups on day 6 are shown in fig. 8, and it can be seen that the mean escape latencies of the other model groups are significantly prolonged (P <0.01) compared to the control group (Sham group).

After removing the platform at 7d, a rat space exploration experiment was performed, and using the activity time in the quadrant of the original station (quadrant iii) and the number of times of crossing the position of the original station as indexes, the activity time in the quadrant iii was significantly shortened (P <0.01) and the number of times of crossing the original station was significantly reduced (P <0.01) in each model group compared to the Sham group (fig. 9, fig. 10).

Through a Morris water maze fixed detection rat directional navigation experiment and a space exploration experiment, the average escape latency of a model group rat is obviously prolonged (P is less than 0.01), the quadrant activity time of an original station is obviously shortened (P is less than 0.01), the frequency of passing through the original station is obviously reduced (P is less than 0.01), and the success of establishing a VD rat model is proved.

Second, the influence of the treatment of each group on the behavior of VD rat model

After the Model is established, treatment is carried out according to the requirements of the Sham group, the Model group, the EPC group, the NSC group, the EPC + NSC group, the EPC/miRNA + NSC group, the EPC/inhibitor + NSC group and the M + E/i + N group.

Sham group: positioning the hippocampus by using a brain stereotaxic apparatus for normal rats, and injecting 5uL of physiological saline into the brain;

model group: VD rat model;

NSC group: 7 days after NSC cell culture, using brain stereotaxic apparatus to locate hippocampal region, VD rat model intracerebrally injecting NSC (cell concentration 1X 10)⁶Per uL)5 uL;

EPC + NSC group: EPC cells and NSC cells (cell number ratio 1:1) were co-cultured for 7 days, then VD rat model hippocampal region was located using brain stereotaxic apparatus, and co-cultured NSC cells (concentration 1X 10) were injected intracerebrally⁶Per uL)5 uL;

EPC/miRNA328+ N group: example 3 micic EPC and NSC cells transfected with microRNA328 cocultured (cell number ratio 1:1)7 days later, VD rat model hippocampal was located using brain stereotaxic apparatus, and cocultured NSC cells (concentration 1X 10) were injected intracerebrally⁶Per uL)5 uL;

EPC/inhibitor + N group: example 3 transfection of microRNA328 inhibitor EPC and NSC cells after 7 days of coculture (cell number ratio 1:1), VD rat model hippocampal was located using brain stereotaxic apparatus, and cocultured NSC cells (concentration 1X 10)⁶Per uL)5 uL;

group M + E/i + N: injecting microvesicles via tail vein, and culturing 7 days NSC cells (the cells are inhibitor EPC transfected by microRNA328 and NSC cells, and the cell concentration is 5 × 10⁴one/uL) 100uL, MRI-guided low frequency focused ultrasound in combination with microbubbles was applied to the left hippocampus of rats to open the BBB for cell transplantation.

After 1 month after treatment, the rats were retested for underway experiments and space exploration experiments by Morris water maze. The rats underway showed a significant increase in mean escape latency (P <0.01) for each of the other model groups compared to the Sham group, whereas the EPC/inhibitor + NSC group showed a significant decrease in mean escape latency (P <0.05) compared to the other treatment groups (FIG. 11). In the space exploration experiment, the EPC/inhibitor + NSC group has obviously prolonged activity time (P <0.05) and obviously increased times (P <0.05) of crossing the original station compared with other treatment groups (FIG. 12 and FIG. 13).

The above behavioural observations utilized the inhibitor transfected EPC and NSC co-transplanted group of miR-328 to have a significantly reduced mean escape latency (P <0.05) compared to the other treatment groups. In the space exploration experiment, the activity time of the quadrant of the original station is obviously prolonged (P <0.05) compared with other treatment groups in the EPC/inhibitor + NSC group, and the times of crossing the original station are obviously increased (P < 0.05).

Research shows that EPC and NSC are co-transplanted into a VD rat model body, interaction among transplanted cells, neuron differentiation rate of NSC and neural network connection between NSC and peripheral cells are established, and the VD rat model body is evaluated through behavior to recover learning and memory functions, so that a theoretical basis is provided for treatment of VD and other nervous system diseases, and the VD model body has potential clinical application value.

The results show that the inhibitor of miR-328 can treat nervous system diseases such as VD.

SEQUENCE LISTING

<110> New countryside medical college

<120> microRNA328 for regulating TERT gene expression and application thereof

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> RNA

<213> Artificial sequence

<400> 1

cuggcccucu cugcccuucc gu 22

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

acggaagggc agagagggcc ag 22

<210> 3

<211> 3399

<212> DNA

<213> Artificial sequence

<400> 3

atgccgcgcg ctccccgctg ccgagccgtg cgctccctgc tgcgcagcca ctaccgcgag 60

gtgctgccgc tggccacgtt cgtgcggcgc ctggggcccc agggctggcg gctggtgcag 120

cgcggggacc cggcggcttt ccgcgcgctg gtggcccagt gcctggtgtg cgtgccctgg 180

gacgcacggc cgccccccgc cgccccctcc ttccgccagg tgtcctgcct gaaggagctg 240

gtggcccgag tgctgcagag gctgtgcgag cgcggcgcga agaacgtgct ggccttcggc 300

ttcgcgctgc tggacggggc ccgcgggggc ccccccgagg ccttcaccac cagcgtgcgc 360

agctacctgc ccaacacggt gaccgacgca ctgcggggga gcggggcgtg ggggctgctg 420

ctgcgccgcg tgggcgacga cgtgctggtt cacctgctgg cacgctgcgc gctctttgtg 480

ctggtggctc ccagctgcgc ctaccaggtg tgcgggccgc cgctgtacca gctcggcgct 540

gccactcagg cccggccccc gccacacgct agtggacccc gaaggcgtct gggatgcgaa 600

cgggcctgga accatagcgt cagggaggcc ggggtccccc tgggcctgcc agccccgggt 660

gcgaggaggc gcgggggcag tgccagccga agtctgccgt tgcccaagag gcccaggcgt 720

ggcgctgccc ctgagccgga gcggacgccc gttgggcagg ggtcctgggc ccacccgggc 780

aggacgcgtg gaccgagtga ccgtggtttc tgtgtggtgt cacctgccag acccgccgaa 840

gaagccacct ctttggaggg tgcgctctct ggcacgcgcc actcccaccc atccgtgggc 900

cgccagcacc acgcgggccc cccatccaca tcgcggccac cacgtccctg ggacacgcct 960

tgtcccccgg tgtacgccga gaccaagcac ttcctctact cctcaggcga caaggagcag 1020

ctgcggccct ccttcctact cagctctctg aggcccagcc tgactggcgc tcggaggctc 1080

gtggagacca tctttctggg ttccaggccc tggatgccag ggactccccg caggttgccc 1140

cgcctgcccc agcgctactg gcaaatgcgg cccctgtttc tggagctgct tgggaaccac 1200

gcgcagtgcc cctacggggt gctcctcaag acgcactgcc cgctgcgagc tgcggtcacc 1260

ccagcagccg gtgtctgtgc ccgggagaag ccccagggct ctgtggcggc ccccgaggag 1320

gaggacacag acccccgtcg cctggtgcag ctgctccgcc agcacagcag cccctggcag 3280

gtgtacggct tcgtgcgggc ctgcctgcgc cggctggtgc ccccaggcct ctggggctcc 1440

aggcacaacg aacgccgctt cctcaggaac accaagaagt tcatctccct ggggaagcat 1500

gccaagctct cgctgcagga gctgacgtgg aagatgagcg tgcgggactg cgcttggctg 1560

cgcaggagcc caggggttgg ctgtgttccg gccgcagagc accgtctgcg tgaggagatc 1620

ctggccaagt tcctgcactg gctgatgagt gtgtacgtcg tcgagctgct caggtctttc 1680

ttttatgtca cggagaccac gtttcaaaag aacaggctct ttttctaccg gaagagtgtc 1740

tggagcaagt tgcaaagcat tggaatcaga cagcacttga agagggtgca gctgcgggag 1800

ctgtcggaag cagaggtcag gcagcatcgg gaagccaggc ccgccctgct gacgtccaga 1860

ctccgcttca tccccaagcc tgacgggctg cggccgattg tgaacatgga ctacgtcgtg 1920

ggagccagaa cgttccgcag agaaaagagg gccgagcgtc tcacctcgag ggtgaaggca 1980

ctgttcagcg tgctcaacta cgagcgggcg cggcgccccg gcctcctggg cgcctctgtg 2040

ctgggcctgg acgatatcca cagggcctgg cgcaccttcg tgctgcgtgt gcgggcccag 2100

gacccgccgc ctgagctgta ctttgtcaag gtggatgtga cgggcgcgta cgacaccatc 2160

ccccaggaca ggctcacgga ggtcatcgcc agcatcatca aaccccagaa cacgtactgc 2220

gtgcgtcggt atgccgtggt ccagaaggcc gcccatgggc acgtccgcaa ggccttcaag 2280

agccacgtct ctaccttgac agacctccag ccgtacatgc gacagttcgt ggctcacctg 2340

caggagacca gcccgctgag ggatgccgtc gtcatcgagc agagctcctc cctgaatgag 2400

gccagcagtg gcctcttcga cgtcttccta cgcttcatgt gccaccacgc cgtgcgcatc 2460

aggggcaagt cctacgtcca gtgccagggg atcccgcagg gctccatcct ctccacgctg 2520

ctctgcagcc tgtgctacgg cgacatggag aacaagctgt ttgcggggat tcggcgggac 2580

gggctgctcc tgcgtttggt ggatgatttc ttgttggtga cacctcacct cacccacgcg 2640

aaaaccttcc tcaggaccct ggtccgaggt gtccctgagt atggctgcgt ggtgaacttg 2700

cggaagacag tggtgaactt ccctgtagaa gacgaggccc tgggtggcac ggcttttgtt 2760

cagatgccgg cccacggcct attcccctgg tgcggcctgc tgctggatac ccggaccctg 2820

gaggtgcaga gcgactactc cagctatgcc cggacctcca tcagagccag tctcaccttc 2880

aaccgcggct tcaaggctgg gaggaacatg cgtcgcaaac tctttggggt cttgcggctg 2940

aagtgtcaca gcctgtttct ggatttgcag gtgaacagcc tccagacggt gtgcaccaac 3000

atctacaaga tcctcctgct gcaggcgtac aggtttcacg catgtgtgct gcagctccca 3060

tttcatcagc aagtttggaa gaaccccaca tttttcctgc gcgtcatctc tgacacggcc 3120

tccctctgct actccatcct gaaagccaag aacgcaggga tgtcgctggg ggccaagggc 3180

gccgccggcc ctctgccctc cgaggccgtg cagtggctgt gccaccaagc attcctgctc 3240

aagctgactc gacaccgtgt cacctacgtg ccactcctgg ggtcactcag gacagcccag 3300

acgcagctga gtcggaagct cccggggacg acgctgactg ccctggaggc cgcagccaac 3360

ccggcactgc cctcagactt caagaccatc ctggactga 3399

Claims (2)

1. The application of the microRNA328 inhibitor in preparing the medicine for treating vascular dementia is disclosed, wherein the microRNA328 inhibitor is a nucleotide sequence shown in a sequence 2.
2. 2. Use according to claim 1, characterized in that: the application is realized by at least one of the following steps:

   A1) increasing the TERT protein activity or expression of a TERT protein coding gene;

   A2) increasing the activity of a TERT protein or the expression of a TERT protein coding gene in a cell.

Images