CN115851946B - Application of CaMKI serving as therapeutic target in preparation of pancreatic cancer therapeutic drug - Google Patents
Application of CaMKI serving as therapeutic target in preparation of pancreatic cancer therapeutic drug Download PDFInfo
- Publication number
- CN115851946B CN115851946B CN202211482736.8A CN202211482736A CN115851946B CN 115851946 B CN115851946 B CN 115851946B CN 202211482736 A CN202211482736 A CN 202211482736A CN 115851946 B CN115851946 B CN 115851946B
- Authority
- CN
- China
- Prior art keywords
- camk
- pancreatic cancer
- cell
- expression
- camki
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses an application of CaMK I serving as a therapeutic target in preparing a pancreatic cancer therapeutic drug. The research of the invention shows that the up-regulation of the expression level of CaMK I can inhibit the proliferation, migration and invasion of pancreatic cancer cells, and the knock-down of CaMK I can promote the proliferation, migration and invasion of pancreatic cancer cells; the upregulation of CaMK I expression can obviously inhibit the occurrence and development of subcutaneous tumors of nude mice of pancreatic cancer cell lines, and shows that the CaMK I can be used as an action target of pancreatic cancer therapeutic drugs for preparing or screening pancreatic cancer therapeutic drugs.
Description
Technical Field
The invention relates to the technical field of biological medicines, in particular to an application of CaMK I serving as a therapeutic target in preparing a pancreatic cancer therapeutic drug.
Background
The incidence rate and the death rate of pancreatic cancer are high, and most patients lose the best radical operation time after diagnosis because of the characteristics of hidden onset, rapid progress, easy occurrence of early metastasis and the like of pancreatic cancer. The american cancer society has counted that the average 5-year survival rate of pancreatic cancer patients is less than 10% and that of locally advanced or metastatic pancreatic cancer patients is less than 3% in 2016. Pancreatic ductal adenocarcinoma (pancreatic ductal adenocarcinoma, PDAC) accounts for approximately more than 90% of the pathological types of pancreatic cancer according to the pathological types. Radical surgical resection remains the primary choice for the cure of PDAC patients, however, notably, the recurrence rate after surgical resection of PDAC patients is still as high as 85%. For this fraction of patients, the gemcitabine combined with either albumin paclitaxel or FOLFIRINOX combination chemotherapy regimen is a "gold standard" in addition to radical excision surgery. With the continuous research on the molecular biological characteristics and related mechanisms of pancreatic cancer, it is possible to discover key driving genes for the occurrence and development of pancreatic cancer and to carry out molecular targeted treatment on the driving genes, so as to bring new dawn to pancreatic cancer patients. Up to now, the U.S. food and drug administration (Food and Drug Administration, FDA) approved marketed molecular targeted drugs have achieved significant clinical effects in breast, leukemia, colorectal, lung and ovarian cancers, and these studies have also provided more reference value for molecular targeted therapies for pancreatic cancers.
Calcium/calmodulin-dependent protein kinase I (calcium/calmodulin-dependent protein kinase I, caMK I) is widely expressed in cells, in Ca 2+ Four subtypes of CaMK I are currently known to play a key role in signaling pathways, caMK I alpha, caMK I beta, caMK I gamma, and CaMK I delta, respectively. Similar to CaMKK, these four CaMK I subtypes have the same catalytic domain adjacent to the autoregulation domain, comprising a self-inhibitory region that overlaps with the calmodulin (CaM) binding region. CaMK I is often in an inactive state due to the presence of self-inhibiting regions. CaM and Ca 2+ The binding-forming complex is capable of binding to CaMK I to mitigate the self-inhibitory effect of the self-inhibitory region and thereby activate CaMK I. In vivo, caMK I is involved in a variety of biological processes. For example, autophagy processes induced in part by nutrient deficiency can promote autophagosome membrane formation by modulating CaMK I; chinese patent CN112972447A discloses application of CaMK II inhibitor in preparing medicine for preventing and/or treating acute pancreatitis, jiang Wen et al discloses effect of CaMK II in treating severe acute pancreatitis pancreatic injury of mice (Jiang Wen, wu Jun, are good, etc.. Effect of CaMK II in treating severe acute pancreatitis pancreatic injury of mice [ J)]University of south medical science, 2022,42 (2): 7.), but no known role for CaMK I in pancreatic cancer treatment exists.
Disclosure of Invention
The invention aims to overcome the defects and the shortcomings in the prior art and provide application of CaMK I serving as a therapeutic target in preparing pancreatic cancer therapeutic drugs.
The above object of the present invention is achieved by the following technical solutions:
according to the invention, through respectively constructing the CaMK I over-expression and CaMK I knockdown stable transgenic cell strain, and then through a cell proliferation and clone formation experiment, a cell migration experiment, a cell scratch experiment and a cell invasion experiment, the result shows that the up-regulation of the expression level of the CaMK I can inhibit the proliferation, migration and invasion of pancreatic cancer cells, and the knock-down of the CaMK I can promote the proliferation, migration and invasion of pancreatic cancer cells. Experiments on subcutaneous tumors of nude mice of pancreatic cancer cell strains show that the occurrence and development of the subcutaneous tumors of nude mice of pancreatic cancer cell strains can be obviously inhibited by the up-regulation of CaMK I expression. The CaMK I can be used as an action target point of pancreatic cancer therapeutic drugs. The invention thus provides the following uses for CaMK I in the treatment of pancreatic cancer:
the application of CaMK I serving as a therapeutic target in preparing or screening medicaments for treating pancreatic cancer.
Use of CaMK I as a therapeutic target in the preparation or screening of a medicament for inhibiting pancreatic cancer proliferation, invasion and/or migration.
Use of a formulation that promotes CaMK I expression in the manufacture of a medicament for treating pancreatic cancer.
Use of a formulation that promotes CaMK I expression in the manufacture of a medicament for inhibiting pancreatic cancer proliferation, invasion and/or migration.
Preferably, the agent that promotes expression of CaMK I is a CaMK I over-expression plasmid.
The invention also provides a medicament for treating pancreatic cancer, comprising CaMK I and/or a preparation for promoting CaMK I expression. The amount of CaMKI protein expressed in the body of a patient can be increased by direct administration of the CaMKI protein or by administration of a preparation that promotes expression of CaMKI, or both.
Preferably, the agent that promotes expression of CaMK I is a CaMK I over-expression plasmid.
Preferably, the composition further comprises pharmaceutically-addable auxiliary materials.
Further preferably, the auxiliary material comprises one or more of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, an adsorption carrier or a lubricant.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides an application of CaMK I serving as a therapeutic target in preparing a pancreatic cancer therapeutic drug. The research of the invention shows that the up-regulation of the expression level of CaMK I can inhibit the proliferation, migration and invasion of pancreatic cancer cells, and the knock-down of CaMK I can promote the proliferation, migration and invasion of pancreatic cancer cells; the upregulation of CaMK I expression can obviously inhibit the occurrence and development of subcutaneous tumors of nude mice of pancreatic cancer cell lines, and shows that the CaMK I can be used as an action target of pancreatic cancer therapeutic drugs for preparing or screening pancreatic cancer therapeutic drugs.
Drawings
FIG. 1 shows the expression of CaMKI in CaMKI overexpressing and CaMKI knockdown stable cell lines. (a) qRT-PCR results; (B) Western Blot results.
FIG. 2 shows the results of CCK-8 cell proliferation experiments.
FIG. 3 shows the results of a clone formation experiment
FIG. 4 shows the results of a Transwell cell migration experiment.
FIG. 5 shows the results of cell scratch experiments.
FIG. 6 shows the results of a Transwell cell invasion assay.
FIG. 7 shows the result of pancreatic cancer cell line nude mice subcutaneous tumor experiments.
Detailed Description
The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.
Reagents and materials used in the following examples are commercially available unless otherwise specified.
Male BALB/c nude mice (4-6 w) used in the following examples are purchased from Shanghai Laike laboratory animal Co., ltd, and are fed to SPF-class animal laboratory centers under the conditions of ordinary feed feeding, so that the laboratory mice are ensured to eat freely, the water source is sufficient, the illumination time provided by the mice is 12 hours, the laboratory mice are ensured to sleep sufficiently, the laboratory feeding temperature is 18-28 ℃, and the daily temperature difference is less than or equal to 3 ℃, and the relative humidity is proper. The experimental process strictly conforms to animal welfare ethics, and the experimental design scheme is approved by the animal experiment ethics committee.
The biological role of CaMK I in pancreatic cancer was studied by the following examples, and the results indicate that upregulation of CaMK I expression levels inhibits proliferation, migration, and invasion of pancreatic cancer cells, and knocking down CaMK I promotes proliferation, migration, and invasion of pancreatic cancer cells. Upregulation of CaMK I expression significantly inhibited the development of pancreatic cancer cell lines nude mice subcutaneous tumor.
Example 1 construction of CaMKI overexpressing and knockout cell lines
1. Method of
(1) Construction of overexpression plasmid and knockout vector
To investigate the effect of cami on pancreatic cancer cells, cami expression was over-expressed and knocked down in PANC-1 and BXPC3 cell lines (provided by the complex university affiliated midge hospital pancreatic surgery) using targeted cami over-expression and interfering lentiviruses, respectively. STR identification was performed before the pancreatic cancer cell experiments, and no mycoplasma pollution was caused. The specific construction method is as follows: the CaMK I over-expression plasmid is constructed by adopting a GV492 vector, and the element sequence is as follows: ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin, bamHI/AgeI; shRNA (Short hairpin RNA) to CaMKI was constructed with GV493 vector, the element order was: hU 6-MCS-CBh-gcGFP-IRES-puromycin, ageI/EcoRI. All the above were synthesized by Shanghai Ji Kai Biotechnology Co., ltd, and a knock-out Vector (Control) expressing NC-shCaMKI and a knock-out Vector expressing shCaMKI-1 were obtained, respectively, as an over-expressed CaMKI plasmid (CaMKI) and a Control (Vector) plasmid. The shRNA sequence of the target CaMK I is as follows: ccAGTCGGTGAGTGAGCAGAT.
(2) Lentivirus package
Lentivirus packaging was done by Shanghai Ji Kai Biotechnology Co., ltd, and the specific packaging process was performed according to Shanghai Ji Kai Biotechnology Co., ltd, and the specific process was as follows: the method comprises the steps of co-transfecting 293T cells with a tool vector plasmid carrying a target gene or target sequence, a virus packaging auxiliary plasmid Helper 1.0 and a virus packaging auxiliary plasmid Helper 2.0, harvesting viruses (namely unpurified cell supernatant) 48-72h after transfection, determining to obtain a lentivirus preservation solution with high titer by adopting a corresponding concentration and purification mode according to different experimental requirements, and finally determining various indexes of lentivirus according to strict quality standards.
(3) Lentiviral infection
The well-grown PANC-1 and BXPC3 cell lines were centrifuged and inoculated into six well plates, and transfection experiments were started when the cell fusion reached 30% into the log phase of growth, and the viral volumes required for transfection were determined according to the cell multiplicity of infection (multiplicity of infection, MOI) according to the instructions attached to Ji Kai (added viral volume per well = MOI x cell number/viral titer).
(4) Transfection efficiency assessment
The transfection effect was assessed by observing the expression of GFP in the cells 72h after transfection, RT-qPCR and Western Blot results. The primer sequences used in the RT-qPCR experiments were: the beta-Actin internal reference primer is beta-Actin-F and beta-Actin-R, and the specific primers of CaMKI are CaMKI-F and CaMKI-R. The primer sequences are respectively as follows: beta-action-F: GAGACCTTCAACACCCC beta-action-R: GTGGTGGTGAAGCTGTAGCC, caMK I-F: GGAAGCAGGCGGAAGACATTA, caMK I-R: GTCCTCTGCCAGGATCACTT. In Western Blot experiments, the reference antibody was beta-Actin (Cell Signaling Rabbit mAb 4970), and the CaMK I antibody was Abcam (ab 68234).
The results are shown in FIG. 1, and qRT-PCR results show that compared with Vector control group, caMK I expression level is significantly up-regulated in PANC-1 and BXPC3 transfected over-expression stable transgenic strain; expression levels of CaMK I were significantly down-regulated in knock-down stable transformants transfected with PANC-1 and BXPC3 (shCaMK I) compared to Control group (Control plasmid NC-shRNA) (fig. 1A). Western Blot results show that compared with Vector control groups, the expression level of CaMK I protein is up-regulated in PANC-1 and BXPC3 transfected over-expression stable transgenic strains; caMKI protein expression levels were reduced in the knockdown stable transformants transfected with PANC-1 and BXPC3 (shCaMKI) compared to the Contro control group (FIG. 1B). The result shows that the CaMKI overexpression and CaMKI knockdown stable transgenic cell strain is successfully constructed.
Example 2CCK-8 cell proliferation and clonogenic assay
1. Method of
CCK-8 cell proliferation assay methods such asThe following steps: the stable cell line with good long state obtained in example 1 was resuspended by digestion with pancreatin, and the cell number was adjusted to (3-5). Times.10 4 Per ml, 100. Mu.L of the cell suspension was then added to each well of the 96-well plate, and after the addition was completed, the cells were cultured in a 37℃incubator. After 2h of incubation, 10ul of CCK-8 reagent (Dojindo ck-04) was added to each well and the mixture was placed in an incubator for 2h. To detect Optical Density (OD) values, the microplate reader parameters were adjusted to 450nm, followed by adjusting the time interval for CCK-8 addition as required by the experiment.
The cloning experiments were as follows: taking stable-rotation cell lines in the logarithmic phase, ensuring that adherent pancreatic cancer cells become single independent individuals after pancreatin digestion and counting, inoculating according to the number of about 500-1000 cells in each hole, shaking six hole plates after the inoculation is finished to ensure uniform cell distribution, and then placing the cells into a 37 ℃ incubator for 15 days. And closely observing the growth condition of cells in the culture process, discarding the culture medium when a single macroscopic clone is formed, cleaning with PBS, adding paraformaldehyde, fixing for 30min at room temperature, discarding the paraformaldehyde after the fixing is finished, adding 1% crystal violet dye solution, dyeing for 30min, washing with tap water after the dyeing is finished, inverting and airing.
2. Results
The results are shown in figures 2-3, and the CCK-8 cell proliferation experimental results show that the proliferation capacity of the CaMK I over-expression group in the PANC-1 and BXPC3 cell lines is obviously reduced compared with that of the Vector control group; meanwhile, the cell proliferation capacity of PANC-1 and BXPC3 CaMK I knockdown groups (shCaMK I) is obviously enhanced compared with that of Control groups (the P is less than 0.05 and the P is less than 0.001) (figure 2), which shows that the excessive expression of CaMK I can obviously inhibit the proliferation of pancreatic cancer cell lines PANC-1 and BXPC3, and the knockdown of CaMK I expression leads to the enhancement of the proliferation capacity of pancreatic cancer cell lines PANC-1 and BXPC 3. The results of the clonogenic experiments show that over-expression of CaMK I can inhibit clonogenic capacity of pancreatic cancer cell lines PANC-1 and BXPC3, and that knocking down CaMK I expression leads to enhancement of clonogenic capacity of pancreatic cancer cell line PANC-1 (FIG. 3), which shows that over-expression of CaMK I can inhibit clonogenic capacity of pancreatic cancer cell lines PANC-1 and BXPC3, and knocking down CaMK I expression leads to enhancement of clonogenic capacity of pancreatic cancer cell line PANC-1.
Example 3Transwell cell migration experiments and cell scratch experiments
1. Method of
The Transwell cell migration assay method is as follows: after stable transgenic cell lines with good growth state are digested by pancreatin, the density is adjusted to 2X 10 by blowing and resuspension 5 /ml. 800. Mu.L of complete medium was added to each Transwell lower well plate, and after the addition of medium, the Transwell cells were placed in the lower well plate and checked and confirmed that there was no air bubble between the membrane at the bottom of the cells and the medium in the lower well plate. 200. Mu.L of the cell suspension with the adjusted density was added into the chamber and put in a 37℃incubator to culture for 24 hours. The Transwell chamber was removed from the incubator, the culture medium in the well was discarded, and 800. Mu.L of paraformaldehyde was added thereto to fix the chamber at room temperature for 30 minutes. Washing with sterile PBS after fixation, discarding PBS after washing, adding 1% crystal violet aqueous solution, dyeing for 30min, and adding ddH after dyeing 2 And (3) washing, naturally airing, counting under a microscope and counting.
The cell scratch test method is as follows: and (3) digesting stable-rotation cells with good growth state by pancreatin, inoculating the cells into a six-hole plate, slightly shaking to ensure that the cells are uniformly distributed, and then placing the cells into an incubator for culture. When the cell fusion degree reaches 90% under the observation of a mirror, a sterile 200 mu L pipette tip is used for scratching along the straight line direction. The scraped superfluous floating cells were removed by washing with sterile PBS and then cultured by adding serum-free medium. After the scratch (0 h) the initial interval of cell migration was observed under an inverted microscope, and the migration state of the cells was recorded after 24h of interval. Cell mobility was calculated as (0 h cell scratch interval-24 h cell migration interval)/0 h cell scratch interval.
2. Results
The results are shown in FIGS. 4-5: transwell cell migration experiment results show that over-expression of CaMK I can significantly inhibit migration of pancreatic cancer cell lines PANC-1 and BXPC3, and knocking down CaMK I expression leads to enhancement of migration capacity of pancreatic cancer cell lines PANC-1 and BXPC3 (figure 4). Cell scratch experiment results also show that over-expression of CaMK I can significantly inhibit migration of pancreatic cancer cell lines PANC-1 and BXPC3, and knocking down CaMK I expression leads to enhanced migration capacity of the pancreatic cancer cell lines PANC-1 and BXPC3 (FIG. 5). The above statistical test method is t test. * P <0.05; * P <0.01; * P <0.001.
Example 4Transwell cell invasion assay
1. Method of
The Transwell cell migration assay method is as follows: placing Matrigel into a refrigerator at 4 ℃ to melt 24 hours before the experiment starts, and mixing the melted Matrigel with serum-free culture solution according to the following ratio of 1:8, adding 50 mu L of prepared matrigel diluent into each Transwell cell, spreading uniformly, covering with a cover, placing back into an incubator for about 2h to solidify matrigel, taking cells with good growth state, digesting with pancreatin, re-suspending with serum-free culture solution, and adjusting cell density to 4×10 5 /ml of cell suspension. The Transwell cells with matrigel added are taken out, 800 mu L of culture solution with serum added is added into each pore plate, 200 mu L of cell suspension is added into each cell, and no bubble exists between the membrane at the bottom of the cell and the lower pore plate. Culturing in incubator for 24 hr, and fixing and crystal violet staining.
2. Results
As shown in FIG. 6, the results of Transwell cell invasion experiments show that the excessive expression of CaMK I can significantly inhibit invasion of pancreatic cancer cell lines PANC-1 and BXPC3, and the knocking down of CaMK I results in enhanced invasion capacity of the pancreatic cancer cell lines PANC-1 and BXPC 3. The statistical test method is t test. * P <0.05;
**P<0.01；***P<0.001。
example 5 pancreatic cancer cell line nude mice subcutaneous tumor experiment
Male BALB/c nude mice (4-6 w, weight: 16-20 g) were selected, and all nude mice were kept in SPF environment. After the fusion degree of the PANC-1 stable transgenic cell strain reaches 90%, the cells are digested by pancreatin, centrifuged and resuspended by sterile PBS, and the cell density is adjusted to 2X 10 6 The individual cells/100. Mu.L were then placed in an ice box for subsequent handling. BALB/c nude mice were divided into two groups of 8 cells each, which were vaccinated with CaMK I overexpressing cells (CaMK I) and vaccinated with Vector control cells (Vector). 100. Mu.L cell suspension was aspirated with a disposable microinjectorThe liquid is slowly injected into the underarm part of the nude mice, and the injection process should be slow and gentle to prevent the nude mice from struggling to cause liquid leakage and seepage. Pressing the puncture site for 1min after injection, observing the condition of nude mice daily, recording the longest and shortest diameters of tumor body with vernier caliper at twice a week frequency, and calculating tumor volume (subcutaneous tumor volume is calculated according to V= (a×b) 2 ) And (2) calculating, wherein a is the long diameter distance of the subcutaneous tumor, b is the short diameter distance of the subcutaneous tumor, and drawing a tumor volume growth curve according to the measured value. After about 6 weeks of inoculation, observing whether the maximum diameter of the tumor exceeds the ethical requirement, killing the nude mice by using a cervical dislocation method according to the ethical requirement of animals, taking out the subcutaneous tumor, weighing and photographing.
As shown in FIG. 7, the tumor growth curve of the CaMK I over-expression group is gentle and the tumor growth speed is slow compared with that of the Vector control group; tumor volume and tumor mass of CaMK I overexpressed mice were significantly reduced compared to Vector control (< P < 0.001); the change trend of the subcutaneous tumor growth curve of the nude mice and the tumor quality result show that the upregulation of the CaMK I expression can obviously inhibit the occurrence and development of the subcutaneous tumor of the nude mice of pancreatic cancer cell lines. * P <0.001.
The results show that the upregulation of the expression level of the CaMK I can inhibit proliferation, migration and invasion of pancreatic cancer cells, the knocking-down of the CaMK I can promote proliferation, migration and invasion of pancreatic cancer cells, and the upregulation of the expression level of the CaMK I can obviously inhibit the occurrence and development of subcutaneous tumors of nude mice of pancreatic cancer cell lines. The CaMK I can be used as a therapeutic target in preparing or screening medicaments for treating pancreatic cancer and preparing or screening medicaments for inhibiting proliferation, invasion and/or migration of pancreatic cancer.
Claims (1)
1. Use of a formulation that promotes CaMK I expression in the manufacture of a medicament for treating pancreatic cancer, wherein the formulation is a CaMK I overexpressing plasmid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211482736.8A CN115851946B (en) | 2022-11-24 | 2022-11-24 | Application of CaMKI serving as therapeutic target in preparation of pancreatic cancer therapeutic drug |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211482736.8A CN115851946B (en) | 2022-11-24 | 2022-11-24 | Application of CaMKI serving as therapeutic target in preparation of pancreatic cancer therapeutic drug |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115851946A CN115851946A (en) | 2023-03-28 |
| CN115851946B true CN115851946B (en) | 2023-09-01 |
Family
ID=85665898
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211482736.8A Active CN115851946B (en) | 2022-11-24 | 2022-11-24 | Application of CaMKI serving as therapeutic target in preparation of pancreatic cancer therapeutic drug |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115851946B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116555268B (en) * | 2023-06-25 | 2023-09-22 | 中国药科大学 | Oligonucleotide targeting RNA binding protein STAU2 and application thereof |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003072801A2 (en) * | 2002-02-21 | 2003-09-04 | The Rockefeller University | Compositions and method for regulation of calcium-dependent signalling in brain |
| CA2689296A1 (en) * | 2007-01-10 | 2008-07-17 | Purdue Research Foundation | Polypeptide inhibitors of hsp27 kinase and uses therefor |
| CA3065614A1 (en) * | 2009-11-03 | 2011-05-12 | Pharnext | New therapeutic approaches for treating alzheimer disease |
| WO2018035072A1 (en) * | 2016-08-15 | 2018-02-22 | Purdue Research Foundation | 4-substituted aminoisoquinoline derivatives |
| CN108251529A (en) * | 2018-02-01 | 2018-07-06 | 新乡医学院 | Applications of the ANO5 in the drug for preparing treatment cancer of pancreas |
| CN110194772A (en) * | 2018-07-02 | 2019-09-03 | 深圳市塔吉瑞生物医药有限公司 | For inhibiting (miscellaneous) the fragrant cyclics of the alkynyl of protein kinase activity |
| CN110272426A (en) * | 2018-07-17 | 2019-09-24 | 深圳市塔吉瑞生物医药有限公司 | For inhibiting (miscellaneous) the fragrant cyclics of the alkynyl of protein kinase activity |
| CN112119077A (en) * | 2018-05-15 | 2020-12-22 | 曼彻斯特大学 | Kinase inhibitors |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090269281A1 (en) * | 2007-09-15 | 2009-10-29 | University Of North Texas Health Science Center At Fort Worth | Calcium/Calmodulin-Dependent Protein Kinase Kinase as a Control Point for Cardiac Hypertrophy |
-
2022
- 2022-11-24 CN CN202211482736.8A patent/CN115851946B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003072801A2 (en) * | 2002-02-21 | 2003-09-04 | The Rockefeller University | Compositions and method for regulation of calcium-dependent signalling in brain |
| CA2689296A1 (en) * | 2007-01-10 | 2008-07-17 | Purdue Research Foundation | Polypeptide inhibitors of hsp27 kinase and uses therefor |
| CA3065614A1 (en) * | 2009-11-03 | 2011-05-12 | Pharnext | New therapeutic approaches for treating alzheimer disease |
| WO2018035072A1 (en) * | 2016-08-15 | 2018-02-22 | Purdue Research Foundation | 4-substituted aminoisoquinoline derivatives |
| CN108251529A (en) * | 2018-02-01 | 2018-07-06 | 新乡医学院 | Applications of the ANO5 in the drug for preparing treatment cancer of pancreas |
| CN112119077A (en) * | 2018-05-15 | 2020-12-22 | 曼彻斯特大学 | Kinase inhibitors |
| CN110194772A (en) * | 2018-07-02 | 2019-09-03 | 深圳市塔吉瑞生物医药有限公司 | For inhibiting (miscellaneous) the fragrant cyclics of the alkynyl of protein kinase activity |
| CN110272426A (en) * | 2018-07-17 | 2019-09-24 | 深圳市塔吉瑞生物医药有限公司 | For inhibiting (miscellaneous) the fragrant cyclics of the alkynyl of protein kinase activity |
Non-Patent Citations (1)
| Title |
|---|
| 蛋白组学分析胰腺癌干细胞相关差异蛋白的表达;江建新等;世界华人消化杂志;第21卷(第02期);摘要、第145-152页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115851946A (en) | 2023-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105274110B (en) | Non-small cell lung metastasis of cancer and prejudge its miRNA marker to shift risk | |
| CN115851946B (en) | Application of CaMKI serving as therapeutic target in preparation of pancreatic cancer therapeutic drug | |
| CN103421886A (en) | Applications of CIZI gene and relevant medicines | |
| Peng et al. | Nerve growth factor (NGF) encourages the neuroinvasive potential of pancreatic cancer cells by activating the warburg effect and promoting tumor derived exosomal miRNA-21 expression | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
| CN109055561A (en) | LncRNA-AP003774.1 is diagnosing and/or treating the application in breast cancers | |
| CN110101704A (en) | Application of the c-Abl kinase inhibitor in FoxM1 high expression oncotherapy | |
| CN105031611B (en) | Purposes of the albumen of netrin 1 in the medicine for oncotherapy is prepared | |
| CN110791566A (en) | Application of human SHCBP1 gene and related product | |
| Hu et al. | The mutual inhibition of FoxO1 and SREBP-1c regulated the progression of hepatoblastoma by regulating fatty acid metabolism | |
| CN114540502A (en) | Detection method and kit for gastric cancer chemotherapy drug sensitivity and application of NSUN2 detection | |
| CN110951880B (en) | Application of reagent for detecting lncRNA marker of hypopharynx cancer in preparation of product for diagnosing hypopharynx cancer | |
| CN114177297A (en) | Application of METTL3 inhibitor in preparation of drugs for inhibiting PI3K/Akt and ERK1/2 signaling pathways | |
| CN110305962A (en) | DKC1 and application of the HIF-1 α in synergistic treatment colorectal cancer | |
| CN110742899A (en) | Application of miR-140 in preparation of medicine for inhibiting breast cancer proliferation and migration | |
| CN117607442B (en) | Marker for predicting breast cancer immunotherapy effect, kit and application | |
| CN114164210B (en) | Long-chain non-coding RNA for regulating and controlling protooncogene MYB and application thereof | |
| CN107217054A (en) | The application of G6PD genes and its expression product in treatment colorectal cancer | |
| CN107715103A (en) | Applications of the Clusterin in the cancer treatment drugs for preparing killing tumor stem cell | |
| CN117138048B (en) | Application of DOCK6 in preparation of medicine for preventing and treating ocular neovascular diseases | |
| CN109295015B (en) | Application of E3 ubiquitin ligase TRIM7 in liver cancer | |
| CN117887851A (en) | Application of CCDC86 as liver cancer diagnosis and prognosis biomarker and treatment target | |
| CN103468786A (en) | Uses and relevant drugs of human CDKL3 (cyclin-dependent kinase-like 3) gene | |
| CN116539884A (en) | Application of oxysterol binding protein OSBPL2 as colorectal cancer molecular marker and therapeutic target thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |