CN115976272A - TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus - Google Patents
TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus Download PDFInfo
- Publication number
- CN115976272A CN115976272A CN202211107995.2A CN202211107995A CN115976272A CN 115976272 A CN115976272 A CN 115976272A CN 202211107995 A CN202211107995 A CN 202211107995A CN 115976272 A CN115976272 A CN 115976272A
- Authority
- CN
- China
- Prior art keywords
- shiv
- pcr
- kit
- denaturation
- taqman
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus, belonging to the technical field of virus PCR detection. The PCR method provided by the invention firstly designs a synthetic primer and a probe, then obtains a DNA template of a sample to be detected, and finally prepares a TaqMan PCR reaction system for PCR reaction. The PCR method has the characteristics of high sensitivity and strong specificity, and the lowest detection limit can reach 1 copy/mu L.
Description
Technical Field
The invention belongs to the technical field of virus PCR detection, and particularly relates to a TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiosis iridovirus.
Background
At present, the breeding yield of Chinese prawns is the first place of the world, but with the popularization of high-density intensive breeding, viral diseases of prawns frequently occur, and the Chinese prawns become the most threatening diseases in the breeding process of the prawns due to the lack of comprehensive and effective preventive measures and targeted drugs, so that huge losses are caused to prawns and the development of the prawn breeding industry is seriously hindered.
The pathogen of the prawn iridovirus is prawn hemacyte iridescence virus (SHIV) which is discovered in recent years, the SHIV is an icosahedral symmetric virus taking linear double-stranded DNA as a genetic substance, the prawn can be infected in all growth stages, the infection of the SHIV can cause the prawn to move slowly and have sharply reduced activity, and an artificial infection experiment shows that the SHIV can lead healthy prawns to die in 15 days after the prawn is infected. The symptoms of the jejunal and jejunal stomach and the hepatopancreatic whitish of the prawns caused by SHIV infection also exist in other viral diseases, so that a rapid, accurate, sensitive and specific SHIV detection method is urgently needed to be established so as to realize the virus field detection and epidemic disease monitoring in the culture process and assist the healthy culture of the prawns.
In order to meet the prevention and control requirements of the prawn culture industry on SHIV, a plurality of detection methods related to SHIV are established at present, and the detection methods mainly comprise two major methods, namely a histopathology method and a molecular biology method. The most commonly used histopathological section technology in the histopathological method mainly comprises the steps of fixing, dehydrating, dipping wax, embedding, slicing, dyeing, mounting and observing section tissues and the like, the prepared histopathological section can be observed under an optical microscope, the existence of basophilic inclusion bodies and the phenomenon of nuclear fixation and shrinkage can be observed in a pathological sample section infected with SHIV, but the healthy prawn sample does not have the basophilic inclusion bodies. The molecular diagnosis technology represented by a loop-mediated isothermal amplification (LAMP) technology, a Nested PCR (Nested PCR) technology, an isothermal Recombinase Polymerase (RPA) technology and a real-time fluorescent quantitative PCR (RT-PCR) technology identifies pathogenic nucleic acids by specific primers, is less limited by sample types, has the characteristics of rapidness, sensitivity, small damage, qualitative property, quantifiability, simple and convenient operation and no toxicity of reagents, greatly improves the timeliness and the accuracy of SHIV diagnosis, and has good development potential in the future.
However, the methods have certain limitations in the industrial application process of the prawns. The operation steps required by the histopathological observation are complex, the time is long (the whole process needs about 2 to 3 days), the injury is large, the technical difficulty is high, the one-time diagnosis cannot be confirmed, and the reagent has certain toxicity to the human body. Compared with histopathology methods, the molecular biology technology has the advantages of convenience in operation, qualitative and quantitative performance and low toxicity, but the sensitivity of the molecular biology technology still has a certain improvement space, wherein the quantitative real-time loop-mediated isothermal amplification (qLAMP) technology can only detect 1.9 multiplied by 10 at least 1 copies/mL, nested PCR can detect 1.42X 10 at the lowest 1 The copy/mL, isothermal Recombinase Polymerase Amplification (RPA) technique with the lowest detection limit is only 7 copies/μ L.
Disclosure of Invention
The invention aims to provide a TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiosis iridovirus with high sensitivity.
In order to realize the purpose, the invention provides the following technical scheme:
the invention provides a group of primers and probes for TaqMan fluorescent quantitative PCR for rapidly detecting prawn hemangioblast iridovirus, wherein the sequences of the primers and the probes are as follows:
SHIV-F：ACGGGAAAACGGTAACTCAAA；
SHIV-R：CTGCCCATCTAACACCATCTC；
SHIV-P：FAM-CGAATTGGCCAGGGCG-MGB。
secondly, the invention provides a TaqMan fluorescent quantitative PCR kit for rapidly detecting the prawn hemangiocyte iridovirus, the kit contains a primer and a probe for detecting the SHIV, and the sequences of the primer and the probe are as follows:
SHIV-F：ACGGGAAAACGGTAACTCAAA；
SHIV-R：CTGCCCATCTAACACCATCTC；
SHIV-P：FAM-CGAATTGGCCAGGGCG-MGB。
preferably, the kit further contains 2 xqrt-PCR Mix, dnase-free water.
Preferably, the reaction system of the kit is:
2. xqRT-PCR Mix 12.5 μ L, SHIV-F0.5 μ L, SHIV-R0.5 μ L, SHIV-P0.5 μ L, DNase-free water 6 μ L, and DNA template of sample to be tested 5 μ L.
Preferably, the reaction conditions of the kit are: pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 10 s, annealing and extension at 60 ℃ for 30 s, and the processes of denaturation and annealing and extension are 40 cycles.
Secondly, the invention provides a TaqMan fluorescence quantitative PCR method for rapidly detecting the prawn hemangiocyte iridovirus, which comprises the following steps:
(1) Obtaining a DNA template of a sample to be detected;
(2) Preparing a TaqMan PCR reaction system for PCR reaction, wherein the sequences of related primers and probes are as follows:
SHIV-F：ACGGGAAAACGGTAACTCAAA；
SHIV-R：CTGCCCATCTAACACCATCTC；
SHIV-P：FAM-CGAATTGGCCAGGGCG-MGB；
(3) And judging according to the PCR reaction detection result.
Preferably, the TaqMan PCR reaction system comprises 12.5 muL of 2 xqRT-PCR Mix, 0.5 muL of SHIV-F, 0.5 muL of SHIV-R, 0.5 muL of SHIV-P, 6 muL of DNase-free water and 5 muL of a DNA template of a sample to be detected.
Preferably, the conditions of the PCR reaction are: pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 10 s, annealing and extension at 60 ℃ for 30 s, and the processes of denaturation and annealing and extension are 40 cycles.
The invention has the beneficial effects that:
1. is quick and convenient: five components of 2 xqRT-PCR Mix, SHIV-F, SHIV-R, SHIV-P and DNA enzyme-free water in a reaction system of the detection method can be mixed into premixed liquid in advance, so that two components of the premixed liquid and the sample DNA are only needed to be added into a reaction tube during detection, and the operation is simple and convenient; and the detection is rapid, and the reaction time is only 40 min.
2. The sensitivity is high: the detection limit of the invention to the SHIV ATPase gene can be as low as 1 copy/mu L, and the detection rate of positive samples is high.
3. The specificity is strong: the primer and the probe related by the invention are designed according to three different sequences of a conserved region of SHIV ATPase, and only if SHIV-F, SHIV-R and SHIV-P are simultaneously combined with sample DNA, the fluorescence intensity in the system can be enhanced, and an S-shaped amplification curve appears; meanwhile, the hot start Taq enzyme in the reaction system is modified, and the active center of the hot start Taq enzyme is exposed only after the modification process at 95 ℃, so that the polymerization effect is exerted, and by matching with a UNG enzyme system in the reaction system, the template mismatch and the non-specific amplification at low temperature can be effectively avoided, and the high specificity is realized.
4. Simple and easy to judge: the detection result is presented in two forms of an amplification curve and a Ct value at the same time, and is objective, direct and obvious.
Drawings
FIG. 1 is the amplification curve of SHIV TaqMan fluorescent quantitative PCR provided in example 3;
FIG. 2 is a standard curve diagram of SHIV TaqMan fluorescence quantitative PCR provided in example 3;
FIG. 3 is a graph showing the results of the sensitivity experiment of SHIV TaqMan fluorescent quantitative PCR provided in example 4 of the present invention;
FIG. 4 is a diagram showing the result of a specific experiment of SHIV TaqMan fluorescent quantitative PCR provided in example 5 of the present invention;
FIG. 5 is a diagram showing the results of an inter-batch repetitive experiment of SHIV TaqMan fluorescent quantitative PCR provided in example 6 of the present invention; FIGS. A-E are graphs showing the results of five replicate experiments, respectively;
FIG. 6 is a diagram showing the results of an in-batch repetitive experiment of SHIV TaqMan fluorescent quantitative PCR provided in example 6 of the present invention.
Detailed Description
The examples are given for the purpose of better illustration of the invention, but the invention is not limited to the examples. Therefore, those skilled in the art should make insubstantial modifications and adaptations to the embodiments of the present invention in light of the above teachings and remain within the scope of the invention.
Example 1
Primer and probe design
According to the sequence comparison result of DNA Star software of ATPase gene of prawn hemangiocyte iridovirus (SHIV), a Primer-probe design program Primer-BLAST (NCBI) is used to design a pair of specific primers and probes, which are synthesized by Shanghai Biotechnology Limited company and detailed in Table 1
| Primers (Probe) | Sequence of |
| SHIV-F | ACGGGAAAACGGTAACTCAAA, SEQ ID NO.1 |
| SHIV-R | CTGCCCATCTAACACCATCTC, SEQ ID NO.2 |
| SHIV-P | FAM-CGAATTGGCCAGGGCG-MGB, SEQ ID NO.3 |
Example 2
Detection of SHIV Using TaqMan fluorescent quantitative PCR method
(1) The invention adopts Bori science and technology (BIOER) MagaBio plus virus DNA/RNA purification kit III to extract and purify sample DNA, and the detailed operation steps for preparing the TaqMan fluorescence quantitative PCR reaction DNA template refer to the use instruction of the kit;
(2) TaqMan PCR reaction System:
in order to realize the optimal amplification efficiency and detection specificity of TaqMan fluorescent quantitative PCR, a finally determined reaction system is as follows after optimization: 2. XqRT-PCR Mix 12.5. Mu.L, SHIV-F (10. Mu. Mol/L) 0.5. Mu.L, SHIV-R (10. Mu. Mol/L) 0.5. Mu.L, SHIV-P (10. Mu. Mol/L) 0.5. Mu.L, DNase-free water 6. Mu.L, total 20. Mu.L. The 2 XqRT-PCR Mix in this PCR system was supplied by Vazyme, nanjing Novozam Biotechnology Ltd. And preparing fluorescent quantitative reaction liquid according to the system requirements, uniformly mixing, subpackaging into sterile enzyme-free Eppendorf tubes (0.1 mL), and then respectively adding 5 mu L of sample DNA template to be detected into different Eppendorf tubes to enable the total volume of the reaction system in each Eppendorf tube to reach 25 mu L.
(3) TaqMan PCR reaction program:
in order to exert the maximum efficiency of the hot start Taq enzyme in a TaqMan PCR reaction system, obtain the optimal reaction effect and facilitate the next step of result judgment, the PCR reaction conditions of the detection method are as follows: pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 10 s, annealing and extension at 60 ℃ for 30 s (fluorescence is collected at this stage), and the processes of denaturation and annealing and extension are 40 cycles. The total reaction time was about 40 min.
(4) And (3) judging a detection result:
after the PCR reaction is finished, the detection result can be judged according to the CT value and the amplification curve map on the real-time fluorescent quantitative PCR instrument:
positive: the Ct value of a detection sample is less than or equal to 35, and an amplification curve has an obvious exponential increase period and is S-shaped;
and (3) suspicious: the Ct value of the detection sample is more than 35, a typical S-shaped amplification curve appears, and repeated experiments are carried out;
negative: the Ct value of the sample cannot be detected, and no obvious amplification curve exists.
Example 3: establishment of a Standard Curve
(1) Preparing a fluorescent quantitative standard:
connecting a 500 bp nucleotide fragment (SEQ ID NO. 4) in an SHIV ATPase gene to a pUC57-T vector to construct an SHIV positive plasmid, converting the SHIV positive plasmid into a DH5 alpha competent cell, screening a positive monoclonal by using a blue-white spot, performing sequencing confirmation to obtain a positive strain, and performing plasmid extraction on the positive strain by using a plasmid extraction kit to obtain an extraction product, wherein the extraction product is a standard product.
(2) Establishment of a standard curve:
1) The standards were quantified and the copy number calculated by uv spectrophotometer.
2) Molecular copy number (copies/. Mu.L) = DNA mass concentration/DNA molecular weight, where DNA mass concentration =260 nm absorbance × dilution factor × 6.02 × 10 23 DNA molecular weight = number of DNA bases × 324.5. The standard was diluted 10-fold in gradient (10) 10 -10 2 copies/. Mu.L) as template for construction of standard curve.
3) mu.L of standard substance with different dilution gradients are taken and added with 12.5. Mu.L of 2 xqRT-PCR Mix, 0.5. Mu.L of SHIV-F (10. Mu. Mol/L), 0.5. Mu.L of SHIV-R (10. Mu. Mol/L), 0.5. Mu.L of SHIV-P (10. Mu. Mol/L) and 10. Mu.L of DNase-free water in sequence for 25. Mu.L.
4) And (3) uniformly mixing the fluorescent quantitative reaction solution, and carrying out PCR amplification, wherein the reaction procedure is as follows: pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 10 s, annealing extension at 60 ℃ for 30 s (fluorescence is collected at this stage), and 40 cycles of denaturation and annealing extension processes are included. The resulting SHIV amplification kinetics curves are shown in FIG. 1, and the corresponding standard curves are shown in FIG. 2.
The result shows that the standard curve has good linear relation, the regression equation is Y = -3.2316X +39.241, and the correlation coefficient R 2 At 0.9972, amplification efficiency E =103.9%.
Example 4
SHIV standard was diluted 10-fold in a gradient (10) 10 1 copies/. Mu.L) which are detected using the method provided by the invention, and the sensitivity of the method is determined. The results in FIG. 3 show that the lowest concentration detectable by this method is 1 copy/. Mu.L. Therefore, compared with qLAMP, nested PCR and RPA technologies, the sensitivity of the method provided by the invention is unexpectedly improved.
Example 5
Experiment of specificity
(1) Collecting iridovirus (SHIV) infected prawn blood cell, white Spot Syndrome Virus (WSSV), and Vibrio parahaemolyticus: (V)Vibrio Parahemolyticus,Vp) Liver Enterocytozoon (EHP) and healthy Penaeus vannamei: (A), (B) and (C)Litopenaeus Vannamei) The liver and pancreas tissue grinding fluid (HC) used for treating the Bori diseaseAnd (3) carrying out DNA extraction by using the toxic nucleic acid extraction kit, wherein an extracted product is the specific template.
(2) mu.L of different specific templates were taken and added with 2 XqRT-PCR Mix 12.5. Mu.L, SHIV-F (10. Mu. Mol/L) 0.5. Mu.L, SHIV-R (10. Mu. Mol/L) 0.5. Mu.L, SHIV-P (10. Mu. Mol/L) 0.5. Mu.L, DNase-free water 6. Mu.L, and total 25. Mu.L.
(3) While a blank control (NC) was set. And (3) uniformly mixing the fluorescent quantitative reaction solution, and carrying out PCR amplification, wherein the reaction procedure is as follows: pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 10 s, annealing and extension at 60 ℃ for 30 s (fluorescence is collected at this stage), and the processes of denaturation and annealing and extension are 40 cycles.
As shown in FIG. 4, it can be seen that only SHIV showed a clear S-type amplification curve with a Ct value of 15.35, and that neither the other shrimp-derived pathogens nor the blank control showed an amplification curve nor a Ct value. Therefore, the TaqMan fluorescence quantitative RT-PCR detection method established by the invention has good specificity.
Example 6
Repeatability test
(1) Batch-to-batch repeatability experiments: taking 6 samples with different Ct values (evenly distributed between 12 and 30), and carrying out 5 times of repeated experiments under the same condition; the results of the experiment are shown in table 2:
TABLE 2 SHIV TaqMan fluorescent quantitation PCR batch-to-batch repeats
As can be seen from Table 2, the variation coefficients of the batch-to-batch repetition are all less than 1%, which indicates that the TaqMan fluorescence quantitative PCR detection method established by the invention has good repeatability among batches.
(2) In-batch repeatability experiments: taking 6 samples with different Ct values (evenly distributed between 12 and 30), and carrying out 5 times of repeated experiments in one experiment; the results of the experiment are shown in table 3:
TABLE 3 SHIV TaqMan fluorescent quantitative PCR in-batch repeats
As can be seen from Table 3, the variation coefficients of the batch repeats are all less than 0.5%, which indicates that the TaqMan fluorescence quantitative PCR detection method established by the invention has good repeatability in batches.
Example 7
Kit for rapidly detecting prawn hemangiocyte iridovirus
(1) The kit comprises the following components:
2 XqRT-PCR Mix, SHIV-F (10. Mu. Mol/L), SHIV-R (10. Mu. Mol/L), SHIV-P (10. Mu. Mol/L), DNase-free water.
Wherein, SHIV-F: ACGGGAAAACGGTAACTCAAA;
SHIV-R：CTGCCCATCTAACACCATCTC；
SHIV-P：FAM-CGAATTGGCCAGGGCG-MGB；
(2) The reaction system of the kit is as follows:
2. xqRT-PCR Mix 12.5 μ L, SHIV-F (10 μmol/L) 0.5 μ L, SHIV-R (10 μmol/L) 0.5 μ L, SHIV-P (10 μmol/L) 0.5 μ L, DNase-free water 6 μ L, and sample DNA template to be tested 5 μ L.
(3) The reaction conditions of the kit are as follows:
pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 10 s, annealing and extension at 60 ℃ for 30 s, and the processes of denaturation and annealing and extension are 40 cycles.
(4) The result judgment standard of the kit is as follows:
positive: the Ct value of a detected sample is less than or equal to 35, and an amplification curve has an obvious exponential amplification period and is S-shaped;
and (3) suspicious: detecting a Ct value of a sample which is more than 35, generating a typical S-shaped amplification curve, and carrying out repeated experiments;
negative: the Ct value of the sample can not be detected, and no obvious amplification curve exists.
Finally, although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.
Claims (8)
1. A group of primers and probes for TaqMan fluorescent quantitative PCR for rapidly detecting prawn hemangiosis iridovirus, which is characterized in that the sequences of the primers and the probes are as follows:
SHIV-F：ACGGGAAAACGGTAACTCAAA；
SHIV-R：CTGCCCATCTAACACCATCTC；
SHIV-P：FAM-CGAATTGGCCAGGGCG-MGB。
2. a TaqMan fluorescent quantitative PCR kit for rapidly detecting prawn hemangiocyte iridovirus is characterized in that the kit contains a primer and a probe for detecting SHIV virus, and the sequences of the primer and the probe are as follows:
SHIV-F：ACGGGAAAACGGTAACTCAAA；
SHIV-R：CTGCCCATCTAACACCATCTC；
SHIV-P：FAM-CGAATTGGCCAGGGCG-MGB。
3. the kit of claim 2, wherein the kit further comprises 2 xqrt-PCR Mix, dnase-free water.
4. The kit according to claim 2, wherein the reaction system of the kit is:
2. xqRT-PCR Mix 12.5 μ L, SHIV-F0.5 μ L, SHIV-R0.5 μ L, SHIV-P0.5 μ L, DNase-free water 6 μ L, and DNA template of sample to be tested 5 μ L.
5. The kit according to claim 2, wherein the reaction conditions of the kit are: pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 10 s, annealing and extension at 60 ℃ for 30 s, and the processes of denaturation and annealing and extension are 40 cycles.
6. A TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangioblast iridovirus is characterized by comprising the following steps:
(1) Obtaining a DNA template of a sample to be detected;
(2) Preparing a TaqMan PCR reaction system for carrying out PCR reaction, wherein the TaqMan PCR reaction system is 2 xqRT-PCR Mix 12.5 mu L, SHIV-F0.5 mu L, SHIV-R0.5 mu L, SHIV-P0.5 mu L, DNA enzyme-free water 6 mu L and a sample DNA template to be detected 5 mu L;
(3) And judging according to the PCR reaction detection result.
7. The method of claim 6, wherein the primers and probes have the following sequences:
SHIV-F：ACGGGAAAACGGTAACTCAAA；
SHIV-R：CTGCCCATCTAACACCATCTC；
SHIV-P：FAM-CGAATTGGCCAGGGCG-MGB。
8. the method of claim 6, wherein the PCR reaction conditions are: pre-denaturation at 95 ℃ for 30 s, denaturation at 95 ℃ for 10 s, annealing and extension at 60 ℃ for 30 s, and the processes of denaturation and annealing and extension are 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211107995.2A CN115976272A (en) | 2022-09-13 | 2022-09-13 | TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211107995.2A CN115976272A (en) | 2022-09-13 | 2022-09-13 | TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115976272A true CN115976272A (en) | 2023-04-18 |
Family
ID=85965323
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211107995.2A Pending CN115976272A (en) | 2022-09-13 | 2022-09-13 | TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115976272A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111218530A (en) * | 2020-03-19 | 2020-06-02 | 广西壮族自治区水产科学研究院 | Primer group and kit for detecting decapod iridovirus 1 by fluorescent quantitative PCR (polymerase chain reaction) |
-
2022
- 2022-09-13 CN CN202211107995.2A patent/CN115976272A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111218530A (en) * | 2020-03-19 | 2020-06-02 | 广西壮族自治区水产科学研究院 | Primer group and kit for detecting decapod iridovirus 1 by fluorescent quantitative PCR (polymerase chain reaction) |
| CN111218530B (en) * | 2020-03-19 | 2023-10-31 | 广西壮族自治区水产科学研究院 | Primer group and kit for detecting octopoda iridovirus 1 by fluorescence quantitative PCR |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102344961B (en) | A kind of polygenic method of application extensive parallel sequencing technology inspection multiple goal of economy | |
| CN108060269B (en) | DPO primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus and application thereof | |
| CN111304371B (en) | Locked nucleic acid probe fluorescent quantitative PCR detection composition, detection method and detection kit for African swine fever virus wild strain | |
| CN112176105B (en) | Special primer for virus BVDV, BRV and BCV one-tube multiplex fluorescence PCR detection and application thereof | |
| CN112522447A (en) | Absolute fluorescence quantitative PCR detection method for chicken infectious anemia virus | |
| CN109837345B (en) | Primer and method for detecting residual DNA of mouse cells | |
| CN113564280A (en) | RAA primer for detecting 12 serotypes of avian adenovirus group I and detection method thereof | |
| CN115976272A (en) | TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus | |
| CN114058738B (en) | Fluorescent quantitative PCR detection kit for detecting Eriocheir sinensis reovirus | |
| CN111304365A (en) | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN114085929B (en) | Kit for detecting African swine fever virus wild strain and vaccine strain | |
| CN113930418B (en) | Nucleic acid releasing agent and nucleic acid releasing method thereof | |
| CN101643793A (en) | Reagent kit for testing infectious hypodermic and hematopoietic necrosis viruses of prawns, and testing method thereof | |
| AU2020102421A4 (en) | A primer combination for detecting 2019ncov by loop-mediated isothermal amplification | |
| CN112063757A (en) | Primer and kit for detecting African swine fever virus and application of primer and kit | |
| CN109182597B (en) | Multiplex fluorescence quantitative PCR kit for simultaneously detecting avian adenovirus group I, II and III and detection method thereof | |
| CN115961051A (en) | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification | |
| CN111534634A (en) | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof | |
| CN111254226A (en) | Primer group, fluorescence visualization RT-LAMP kit and method for rapidly detecting canine distemper virus | |
| CN113981145B (en) | Detection method and detection kit for group I avian adenovirus A, B, C, D and E | |
| LU500205B1 (en) | A primer combination for detecting 2019nCoV by loop-mediated isothermal amplification | |
| CN113293235B (en) | Primer for frog virus detection and application thereof | |
| CN112626263B (en) | Kit for detecting respiratory tract infection fungal pathogens at constant temperature by using enzyme digestion probe | |
| CN116064941A (en) | Primer, probe and method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |