CN116064941A - Primer, probe and method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR - Google Patents
Primer, probe and method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR Download PDFInfo
- Publication number
- CN116064941A CN116064941A CN202211043373.8A CN202211043373A CN116064941A CN 116064941 A CN116064941 A CN 116064941A CN 202211043373 A CN202211043373 A CN 202211043373A CN 116064941 A CN116064941 A CN 116064941A
- Authority
- CN
- China
- Prior art keywords
- probe
- primer
- reverse transcription
- lake virus
- ddpcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000523 sample Substances 0.000 title claims abstract description 83
- 241001601305 Tilapia lake virus Species 0.000 title claims abstract description 62
- 238000000034 method Methods 0.000 title claims abstract description 46
- 238000010839 reverse transcription Methods 0.000 title claims abstract description 31
- 238000007847 digital PCR Methods 0.000 title claims abstract description 26
- 239000002773 nucleotide Substances 0.000 claims abstract description 10
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 10
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 5
- 238000003908 quality control method Methods 0.000 claims abstract description 4
- 238000006243 chemical reaction Methods 0.000 claims description 32
- 239000002299 complementary DNA Substances 0.000 claims description 28
- 230000003321 amplification Effects 0.000 claims description 21
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 21
- 238000002360 preparation method Methods 0.000 claims description 2
- 239000013615 primer Substances 0.000 claims description 2
- 239000002987 primer (paints) Substances 0.000 claims description 2
- 238000001514 detection method Methods 0.000 abstract description 42
- 230000035945 sensitivity Effects 0.000 abstract description 9
- 241000276707 Tilapia Species 0.000 abstract description 8
- 108020004707 nucleic acids Proteins 0.000 abstract description 8
- 102000039446 nucleic acids Human genes 0.000 abstract description 8
- 150000007523 nucleic acids Chemical class 0.000 abstract description 8
- 238000005516 engineering process Methods 0.000 abstract description 5
- 241000251468 Actinopterygii Species 0.000 abstract description 3
- 208000015181 infectious disease Diseases 0.000 abstract description 3
- 238000011160 research Methods 0.000 abstract description 3
- 238000003759 clinical diagnosis Methods 0.000 abstract 1
- 230000008676 import Effects 0.000 abstract 1
- 238000012360 testing method Methods 0.000 description 21
- 238000003757 reverse transcription PCR Methods 0.000 description 11
- 238000000137 annealing Methods 0.000 description 10
- 241000700605 Viruses Species 0.000 description 9
- 108090000623 proteins and genes Proteins 0.000 description 9
- 241001465754 Metazoa Species 0.000 description 8
- 238000012795 verification Methods 0.000 description 6
- 238000009826 distribution Methods 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 4
- 201000010099 disease Diseases 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 238000002474 experimental method Methods 0.000 description 4
- 238000005457 optimization Methods 0.000 description 4
- 241001603164 Carp edema virus Species 0.000 description 3
- 230000009286 beneficial effect Effects 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 238000005192 partition Methods 0.000 description 3
- 239000000126 substance Substances 0.000 description 3
- 241001609213 Carassius carassius Species 0.000 description 2
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- 241001051708 Cyprinid herpesvirus 3 Species 0.000 description 2
- 241000252233 Cyprinus carpio Species 0.000 description 2
- 241000196324 Embryophyta Species 0.000 description 2
- 241000609060 Grass carp reovirus Species 0.000 description 2
- 241000701372 Iridovirus Species 0.000 description 2
- 238000002123 RNA extraction Methods 0.000 description 2
- 238000010802 RNA extraction kit Methods 0.000 description 2
- 241000920592 Red seabream iridovirus Species 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 239000012472 biological sample Substances 0.000 description 2
- 230000015572 biosynthetic process Effects 0.000 description 2
- 230000006806 disease prevention Effects 0.000 description 2
- 230000003394 haemopoietic effect Effects 0.000 description 2
- 230000005571 horizontal transmission Effects 0.000 description 2
- 210000004185 liver Anatomy 0.000 description 2
- 230000017074 necrotic cell death Effects 0.000 description 2
- 238000012803 optimization experiment Methods 0.000 description 2
- 238000011002 quantification Methods 0.000 description 2
- 238000013207 serial dilution Methods 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 210000000952 spleen Anatomy 0.000 description 2
- 238000003786 synthesis reaction Methods 0.000 description 2
- 230000003612 virological effect Effects 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 208000007407 African swine fever Diseases 0.000 description 1
- 241000711443 Bovine coronavirus Species 0.000 description 1
- 241000589562 Brucella Species 0.000 description 1
- 241000252230 Ctenopharyngodon idella Species 0.000 description 1
- 241001487666 Cyprinid herpesvirus Species 0.000 description 1
- 108020004414 DNA Proteins 0.000 description 1
- 208000001490 Dengue Diseases 0.000 description 1
- 206010012310 Dengue fever Diseases 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 206010017472 Fumbling Diseases 0.000 description 1
- 241000609061 Grass carp hemorrhagic virus Species 0.000 description 1
- 241000282414 Homo sapiens Species 0.000 description 1
- 208000002979 Influenza in Birds Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 241000276701 Oreochromis mossambicus Species 0.000 description 1
- 241000712464 Orthomyxoviridae Species 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 244000061456 Solanum tuberosum Species 0.000 description 1
- 235000002595 Solanum tuberosum Nutrition 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 206010064097 avian influenza Diseases 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 208000025729 dengue disease Diseases 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 241001493065 dsRNA viruses Species 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000009313 farming Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 238000000227 grinding Methods 0.000 description 1
- 208000031169 hemorrhagic disease Diseases 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 230000002906 microbiologic effect Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 238000007826 nucleic acid assay Methods 0.000 description 1
- 238000001921 nucleic acid quantification Methods 0.000 description 1
- 238000001543 one-way ANOVA Methods 0.000 description 1
- 244000000003 plant pathogen Species 0.000 description 1
- 238000007789 sealing Methods 0.000 description 1
- 238000005728 strengthening Methods 0.000 description 1
- 229960005486 vaccine Drugs 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
- 230000005570 vertical transmission Effects 0.000 description 1
- 108700026220 vif Genes Proteins 0.000 description 1
- 210000001835 viscera Anatomy 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer, a probe and a method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR, wherein the primer comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO.2, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3. The method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR has the advantages of high sensitivity, strong specificity and good repeatability, can carry out clinical diagnosis in the early stage of TiLV infection of fish, accurately and quantitatively detect tilapia lake virus, provides guarantee for import and export trade safety of tilapia, provides technical support for tilapia lake virus related research, and can provide absolute quantitative detection technology for the calibration of tilapia lake virus standard samples and the calibration of tilapia lake virus nucleic acid detection kit quality control.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a primer, a probe and a method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR.
Background
TiLV, tilapia Lake Virus, is an RNA virus of the Orthomyxoviridae family, and can infect various growth stages of tilapia with mortality as high as 90%. The transmission mode of TiLV is mainly horizontal transmission, including direct contact with infected fish, polluted water, equipment and the like, and besides horizontal transmission, a vertical transmission mode can also exist. Currently, tiLV has exploded worldwide, including israel, columbia, ecuador, egypt, thailand, india, malaysia, etc., and brings serious economic losses to the global tilapia farming industry. Although China has no precise report of TiLV infection so far, tilapia seedlings need to be introduced from abroad to ensure the cultivation quality, and therefore, the risk of overseas introduction exists. In 2020, the national agricultural rural area and customs agency jointly issue 256 notices, wherein tilapia lake virus diseases (Tilapia Lake Virus disease, tiLVD) are listed as a second type of animal epidemic disease in the entry animal quarantine epidemic disease directory of the people's republic of China.
At present, no vaccine aiming at TiLV exists, and the virus content in fish bodies is low and is easy to ignore in the early stage of infection, so that a detection method with strong specificity and high sensitivity is more needed.
At present, molecular biological detection methods of various nucleic acids such as electron microscope observation, virus isolation and culture, RT-PCR, nested RT-PCR, semi-nested RT-PCR, real-time fluorescence quantitative RT-PCR and the like of TiLV have been reported in succession abroad; nest/semi nest RT-PCR can only be used for qualitative detection and has long operation time, and the use of EB (or EB replaces dye) can bring pollution risks to operators and environment; real-time fluorescent RT-PCR relies on standard curves and Ct values and also cannot visually represent the virus content of the test object. The research on the TiLV detection method in China is relatively late, and the real-time fluorescence quantitative RT-PCR method is focused.
Reverse transcription microdroplet digital PCR (RT-ddPCR) is used as a third generation PCR technology, a standard curve is not needed, direct estimation of target copy in the reaction is basically always generated, the nucleic acid quantification capability is realized, the linear digital signal can provide more accurate data than the exponential amplification signal of real-time fluorescence PCR, the detection precision is improved, and absolute quantification can be realized. Since ddPCR provides a high level of accuracy and a small difference in the molecular weight of the detected nucleic acid, the application of ddPCR technology has been widely and variously progressed in recent years, and has been used in microbiological studies, food safety and monitoring of water quality, detection of dengue fever, brucella, african swine fever, subtype H5 avian influenza, bovine coronavirus, potato virus, etc., in relation to human, animal, plant pathogens, etc. However, the reverse transcription microdroplet digital PCR detection method of TiLV has not been reported yet.
Disclosure of Invention
Based on the above, one of the purposes of the invention is to provide a primer probe set for detecting tilapia lake virus by reverse transcription microdroplet digital PCR, wherein the primer probe set can be used for detecting tilapia lake virus by reverse transcription microdroplet digital PCR.
The specific technical scheme for realizing the aim of the invention comprises the following steps:
a reverse transcription microdroplet digital PCR primer for detecting tilapia lake virus comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO.1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 2.
The invention also provides a probe for detecting tilapia lake virus by reverse transcription microdroplet digital PCR, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3.
In some of these embodiments, the probe is modified at the 5 'end with FAM and at the 3' end with BHQ1.
The invention also provides application of the primer or the probe in preparing a reverse transcription microdroplet digital PCR detection tilapia lake virus kit.
The invention also provides application of the primer or the probe in tilapia lake virus standard substance calibration or quality control substance concentration calibration.
The invention also provides a kit for detecting tilapia lake virus by reverse transcription microdroplet digital PCR, which comprises the primer and the probe.
In some of these embodiments, the primer has a working concentration of 450 nmol.L -1 ～550nmol·L -1 The method comprises the steps of carrying out a first treatment on the surface of the And/or the working concentration of the probe is 250 nmol.L -1 ～350nmol·L -1 。
The invention also provides a method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR, which comprises the following steps: and using cDNA of the sample to be detected as a template, performing ddPCR amplification by using the kit, and reading the PCR amplification result by microdroplets.
In some of these embodiments, the ddPCR amplified reaction system comprises: ddPCR SupermixforProbes, primer, probe, cDNA template and ddH 2 O。
In some of these embodiments, the ddPCR amplification reaction procedure is: 95 ℃ for 10min;94 ℃ for 30s,54.2 ℃ for 60s and 40 cycles; 98 ℃ for 10min;4 ℃ is infinity.
Compared with the prior art, the invention has the following beneficial effects:
according to the invention, hypothetical protein gene genes are selected from the 3 rd segment of whole gene sequence of the tilapia lake virus as target genes, a set of primer probe sets is designed and synthesized, and a method for detecting the tilapia lake virus by reverse transcription droplet-type digital PCR is explored and established by using the primer probe sets.
Drawings
FIG. 1 is a standard curve of RT-ddPCR in example 2 of the present invention.
FIG. 2 shows the results of detection of a portion of clinical samples by RT-ddPCR in example 3 of the present invention; wherein green represents the total droplet count; purple indicates positive droplet count.
FIG. 3 shows the results of the test of 5 samples for verification of the ability by using the real-time fluorescent RT-PCR method in example 3 of the present invention.
FIG. 4 is a diagram showing amplification by RT-ddPCR of primer probe sets 1 to 4 in test example 1 according to the present invention.
FIG. 5 is a diagram showing amplification by RT-ddPCR of primer probe sets 5 to 9 in test example 1 according to the present invention.
FIG. 6 is a graph of RT-ddPCR amplification at various probe concentrations in test example 2 of the present invention, wherein A01-C01:150 nmol.L -1 ；D01-F01：200nmol·L -1 ；G01-A2：250nmol·L -1 ；B02-D02：300nmol·L -1 。
FIG. 7 is a graph of RT-ddPCR amplification at various primer concentrations in test example 2 of the present invention, wherein: A01-C01:200 nmol.L -1 ；E01：300nmol·L -1 ；G01-A02：400nmol·L -1 ；C02：500nmol·L -1 ；E02-G02：600nmol·L -1 ；A03：700nmol·L -1 ；C03-E03：800nmol·L -1 ；G03：900nmol·L -1 ；A04-C04：1000nmol·L -1 ；E04：1100nmol·L -1 ；G04-A05：1200nmol·L -1 。
FIG. 8 is a diagram showing amplification of RT-ddPCR at different annealing temperatures in test example 2 according to the present invention.
FIG. 9 shows a specific test of the RT-ddPCR detection method in test example 3 according to the present invention.
FIG. 10 is a graph showing the reproducibility of the RT-ddPCR detection method of test example 4 according to the present invention, wherein green represents the total droplet count; purple indicates positive droplet count.
Detailed Description
The present invention will be described more fully hereinafter in order to facilitate an understanding of the present invention. This invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.
The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. The various chemicals commonly used in the examples are commercially available, unless specified otherwise.
According to the invention, firstly, 9 primer probe sets are designed by referring to the 3 rd segment of total gene sequence of TiLV logged in GenBank in NCBI, hypothetical protein gene genes (SEQ ID NO. 8) are selected as target genes, then the optimal primer probe sets are obtained through fumbling and optimized reaction, a method for detecting tilapia lake virus by RT-ddPCR is established, a linear relation with a real-time fluorescent RT-PCR detection method is established, sensitivity, specificity and repeatability of the method are analyzed, and finally, detection of clinical samples is carried out. The following results were obtained:
1. when the concentration of the primer and the probe is 500 nmol.L respectively -1 、300nmol·L -1 And when the annealing temperature is 54.2 ℃, the established TiLVRT-ddPCR amplification reaction has the highest efficiency, the most obvious distribution limit of yin-yang microdroplet and higher average copy number.
2. The detection method has strong sensitivity, and the detection is as low as 2copies mu L -1 And 1 to 90000 copies/. Mu.L -1 In the range, the linear relation with real-time fluorescence RT-PCR detection is better, y= -3.7072x+39.894, R 2 = 0.9958. The sensitivity is higher than that of other molecular biological detection methods established at home and abroad at present.
3. The detection variation coefficient is low and is 4.86%, the stability is strong, and the repeatability is high.
4. The kit has no cross reaction with other 5 common aquatic animal epidemic virus (carp edema virus, koi herpesvirus, grass carp hemorrhagic disease virus, crucian carp hematopoietic necrosis virus and cytomegaly iridovirus) positive samples, and has strong specificity.
5. In the detection of clinical samples, the results of 48 tilapia samples are negative, and 3 of 5 capacity verification samples are positive and are consistent with satisfactory results of capacity verification.
The TiLV RT-ddPCR established by the invention can realize absolute quantification, is beneficial to strengthening detection of tilapia lake viruses in various links such as fingerling, cultivation, sales and the like, and can provide a beneficial reference for tilapia lake virus related research. The method has important significance in the calibration of standard samples and quality control products, and provides absolute quantitative detection technology for the development and calibration of the TiLV standard samples in the future.
In the following examples, total RNA extraction kit, fastKing one-step method for removal of genomic cDNA first strand synthesis premix reagents were purchased from day roots; ddPCR Supermix for Probes (nodUTP), microdroplet generating oil were all purchased from Bio-Rad; primers and probes were synthesized by the biological engineering (Shanghai) Co., ltd; the PBS solution is prepared by a laboratory of Dongguan animal epidemic disease prevention control center; the other reagents (absolute ethanol, chloroform) were analytically pure. Biosafety cabinet (Class ii BSC), purchased from ESCO technologies limited, singapore; a biological sample homogenizer (precelly Evolution) from BERTIN, france; the common PCR instrument, the digital PCR system QX200 and the 96-hole plate sealing machine PX1 are all purchased from Bio-Rad company; fluorescent PCR apparatus (AFD 4800), available from Anjesi medical science, inc. of Hangzhou.
The invention is described in detail below with reference to the drawings and the specific embodiments.
Example 1 RT-ddPCR primer and probe for detecting Tilapia lake virus
And (3) selecting hypothetical protein gene genes as target genes (with nucleotide sequences of SEQ ID NO. 8) by referring to the 3 rd segment of total gene sequences of TiLV logged in GenBank in NCBI, and designing a primer probe group for detecting tilapia lake virus (TiLV) by RT-ddPCR.
Target gene (nucleotide sequence is SEQ ID NO. 8):
ACAGCTGAGCTAAAGAGGCAATATGGATTCTTCGAGTGCTCAAAGTTCCTCGCCTGCGGTGAGGAGTGTGGTCTTGACCAAGAGGCAAGAGAACTTATACTGAACGAGTACGCACG
primer probe group:
F1：5'-TTCGAGTGCTCAAAGTTCCT-3'(SEQ ID NO.1)
F2：5'-CGTGCGTACTCGTTCAGTATA-3'(SEQ ID NO.2)
P：5'-TCAAGACCACACTCCTCACCRCAG-3'(SEQ ID NO.3)
the 5 'end of the probe P is modified with FAM, and the 3' end is modified with BHQ1.
Example 2 RT-ddPCR method for detecting Tilapia lake virus
The method for detecting tilapia lake virus by RT-ddPCR of the embodiment comprises the following steps:
1. pretreatment of a sample to be tested
Placing liver and spleen viscera of tilapia mossambica in a 2mL grinding tube, adding 1mLPBS solution, homogenizing in a biological sample homogenizer (speed 7200rpm; homogenizing for 4 times each for 15s each for 30 s), and centrifuging.
2. Extraction of RNA and preparation of cDNA template
And extracting RNA of a sample to be detected according to the operation instruction of the total RNA extraction kit, and performing reverse transcription by using a FastKing one-step method to remove a first strand synthesis premix reagent of the genome cDNA to obtain the cDNA template. The reverse transcription reaction system and the reaction procedure are shown in Table 1.
Reverse transcription of RNA into cDNA is performed to obtain cDNA which is easier to preserve than RNA and can be preserved for a long period of time at-20deg.C or lower; on the other hand, the cost of the detection reagent can be saved, the detection cost of the RT-ddPCR reaction system of the one-step method is far higher than that of the ddPCR reaction system, and the difference between the detection result of the RT-ddPCR reaction system of the one-step method in the front stage of the applicant and the detection result of the ddPCR after reverse transcription is not obvious.
TABLE 1 reverse transcription reaction System and reaction procedure
3. ddPCR detection of tilapia lake virus
20 mu L of ddPCR reaction system is prepared by reference to ddPCR Supermix for Probes instruction manual, and the reaction system is transferred to a 96-well plate after generating microdroplets and is placed in a PCR instrument (digital PCR system QX 200) for amplification.
The reaction system and reaction procedure of ddPCR are shown in Table 2.
TABLE 2 ddPCR reaction System and reaction procedure
4. Interpretation of results
After ddPCR amplification, the sample was put into a droplet reader, and the result was analyzed after the completion of reading.
ddPCR data were image processed and analyzed using Quantasoft software. The standard established for ddPCR assay was a total number of microdroplets greater than 10000. While no positive microdroplets were detected in the negative and blank controls, indicating that the system was not contaminated or specifically amplified. After all the droplets are amplified by PCR, the droplets containing the target are amplified, the droplets with higher fluorescence intensity are judged to be positive droplets, the droplets without the target are not amplified, and the droplets with lower fluorescence intensity are judged to be negative droplets. Thus, after interpretation by the droplet reader, the droplet population will have a positive value p, and the number of copies of each positive droplet will be-ln (1-p) in combination with the poisson distribution algorithm, and the sample copy number per microliter concentration will be converted to a fixed and known volume of each droplet. Test data are expressed as "mean ± standard deviation (x±sd)" and treated with SPSS16.0 software to examine group-to-group differences using Duncan's multiple comparisons based on one-way anova analysis, with P <0.05 as a standard for significant differences.
cDNA molecules number = copy number per microliter (copies. Mu.L) -1 ) X20 mu LddPCR reaction system/cDNA template dose.
5. Construction of a Standard Curve
With ddH 2 O2-fold serial dilutions were performed on TiLV-cDNA, 20 gradients were added, and 3 replicates were performed on each gradient, and ddPCR and real-time fluorescence PCR detection were performed simultaneously (the primer probe sequence for real-time fluorescence PCR was identical to that for RT-ddPCR, and the reaction system and procedure were as shown in Table 3). Negative and blank controls were set up simultaneously.
TABLE 3 real-time fluorescent PCR reaction System and reaction procedure
A standard curve (relationship between the number of nucleic acid molecules and the fluorescence Ct value of the same sample) was constructed by taking the lg value of the number of molecules of each gradient TiLV-cDNA measured by ddPCR as the abscissa and the Ct value detected by fluorescence PCR as the ordinate.
As shown in FIG. 1, ddPCR results of different gradient TiLV-cDNA have excellent correlation in detection range, y= -3.7072x+39.894, R 2 = 0.9958. In the case of clinical sample detection, a laboratory incapable of developing ddRNA can calculate the number of nucleic acid molecules of the sample based on this standard curve.
Example 3 detection of clinical samples using the methods of the invention
Using the RT-ddPCR method of example 2, the liver and spleen nucleic acids of 53 clinical samples were detected, 5 of which were the remaining samples (from Shenzhen Heiguan animal and plant quarantine technology center) for the performance verification in 2020, and the remaining 48 tilapia were harvested from Dongguan tilapia farms. Real-time fluorescence PCR detection was performed simultaneously on 5 specimens remaining for the performance verification in 2020.
The detection results of partial clinical samples are shown in figure 2, and the results show that the generation number of the RT-ddPCR amplified microdroplets is more than 12000, and the results are true. The 48 tilapia samples are all negative.
The test results of 5 capacity test samples are shown in fig. 3 and table 4.
TABLE 4 Capacity validation sample TiLV RT-ddPCR and real-time fluorescence RT-PCR detection results
The results shown in Table 4 and FIG. 3 indicate that 3 positive samples were detected, which is consistent with the satisfactory result of the capacity verification in 2020, and that the viral nucleic acid detection results of 3 positive samples were 17 760 copies/. Mu.L, respectively -1 1.920 copies/. Mu.L -1 518 copies/. Mu.L -1 . The RT-ddPCR method established by the invention has good feasibility and is suitable for the detection of clinical samples and the calibration of standard samples.
Test example 1 primer and Probe optimization experiments
In the test example, 3 upstream primers, 3 downstream primers and 1 probe were designed, and 9 combinations of experiments were performed to obtain the optimal primer-probe combination.
1. Experimental grouping
The primer and probe sequences are shown in Table 5.
TABLE 5 primer, probe sequences
Primer probe set 1: F1R1P3
Primer probe group 2: F1R2P3
Primer probe set 3: F1R3P3
Primer probe set 4: F2R1P3
Primer probe group 5: F2R2P3
Primer probe group 6: F2R3P3
Primer probe set 7: F3R3P3
Primer probe set 8: F3R2P3
Primer probe group 9: F3R1P3
2. Experimental method
The pretreatment of the sample and the RT-ddPCR method were the same as in example 2.
3. Experimental results
The RT-ddPCR method is adopted, 9 primer probe groups are used for detecting the tilapia lake virus initially, the results are shown in fig. 4 and 5, and the comprehensive judgment is carried out on the results from fig. 4 and 5, and compared with other 8 primer probe groups, the effect of the primer probe group 7 is better, so that F3R3P3 is selected as a primer probe combination in the RT-ddPCR detection method.
Experimental example 2 optimization experiment of method for detecting Tilapia lake Virus by RT-ddPCR
A4-fold dilution gradient of TiLV-cDNA (RNA extraction and reverse transcription as in example 2) was used as template to optimize ddPCR reaction conditions, including probe, primer concentration and annealing temperature. The key factors for optimization are to maximize the difference in fluorescence amplitude between negative and positive droplet partitions, and to minimize the number of partitions with moderate fluorescence intensity.
1. Optimization of probe concentration
The ddPCR was performed by setting the concentration of 4 sets of probes (other conditions are the same as in example 2), 150 nmol.L each -1 、200nmol·L -1 、250nmol·L -1 、300nmol·L -1 Each set was set with 3 replicates.
The results are shown in Table 6 and FIG. 6.
TABLE 6 number of cDNA molecules detected by ddPCR at different probe concentrations
As is clear from the results in Table 6, the number of droplets produced by ddPCR amplification with different concentrations of probe was 15 or more, and the results were true. The cDNA molecules between different probe concentrations were 150 nmol.L in order -1 Group of>300nmol·L -1 Group of>200nmol·L -1 Group of>250nmol·L -1 Group, and there was no significant difference (P>0.05). In contrast, according to FIG. 6, when the probe concentration is 150 nmol.L -1 At this time, the number of cDNA molecules was greatest, but the fluorescence intensity of the ddPCR reaction was lowest and the difference in fluorescence amplitude between negative and positive droplet partitions was smallest, not meeting the optimal decision criteria. When the probe concentration reaches 300 nmol.L -1 When fluorescence intensity is maximized, the most efficient amplification reaction is obtained, and the limit of the distribution of positive droplets and negative droplets is most pronounced. Therefore, it was comprehensively judged that the optimum concentration of the probe was 300 nmol.L -1 。
2. Optimization of primer concentration
After the optimal probe concentration is determined, the final concentration of the upstream primer and the downstream primer is set to be 200 nmol.L respectively -1 、300nmol·L -1 、400nmol·L -1 、500nmol·L -1 、600nmol·L -1 、700nmol·L -1 、800nmol·L -1 、900nmol·L -1 、1000nmol·L -1 、1100nmol·L -1 、1200nmol·L -1 ddPCR reactions (other conditions were the same as in example 2) were performed with 3 replicates per set.
The results are shown in Table 7 and FIG. 7.
TABLE 7 number of cDNA molecules detected by ddPCR at different primer concentrations
As is clear from the results in Table 7, the probe concentration was300nmol·L -1 When the cDNA molecules with different primer concentrations are from big to small, the cDNA molecules are as follows: 900 nmol.L -1 Group of>500nmol·L -1 Group of>600nmol·L -1 Group of>800nmol·L -1 Group of>1000nmol·L -1 Group of>300nmol·L -1 Group of>400nmol·L -1 Group of>700nmol·L -1 Group of>1200nmol·L -1 Group of>1100nmol·L -1 Group of>200nmol·L -1 Group, but without significant difference (P>0.05). According to FIG. 7, when the final primer concentration is 500 nmol.L -1 When the amplification reaction is performed with maximum efficiency, the distribution of positive droplets and negative droplets is clearly defined. Therefore, the optimal concentration of the primer is 500 nmol.L -1 。
3. Optimization of annealing temperature
Optimal concentration of primer and probe (500 nmol.L, respectively) -1 、300nmol·L -1 ) After the determination, ddPCR reactions were performed at 61 ℃, 60.2 ℃, 58.8 ℃, 56.7 ℃,54.2 ℃, 52.1 ℃, 50.8 ℃ and 50 ℃ under the same conditions as in example 2, with 3 replicates for each annealing temperature.
The results are shown in Table 8 and FIG. 8.
TABLE 8 number of cDNA molecules detected by ddPCR at different annealing temperatures
As is clear from the results of Table 8, the number of droplets amplified by ddPCR at different annealing temperatures was 15,000 or more, and the results were true. The number of cDNA molecules between different annealing temperatures is 54.2 ℃ from large to small>61 ℃ group>Group at 50.8 DEG C>52.1 ℃ group>Group at 56.7 DEG C>Group at 58.8 ℃>Group at 50 DEG C>60.2 ℃ group, and there was no significant difference (P>0.05). In contrast, referring to FIG. 8, when the annealing temperature is 54.2 ℃, the amplification reaction with the highest efficiency can be obtained, the limit of the distribution of the positive droplets and the negative droplets is most obvious, and the average copy number is 16360 copies/. Mu.L -1 Thus, the optimal annealing temperature is 54.2 ℃.
Test example 3 specificity of the method of the invention
Using the method of example 2 of the present invention, DNA or cDNA of Carp edema virus (Carp edition virus, CEV), koi herpesvirus (Koi hepesvirus, KHV), grass Carp hemorrhagic virus (Grass Carp reovirus, GCRV), crucian Carp hematopoietic necrosis virus (Cyprinid herpesvirus, cyHV-2), cytomegaly iridovirus (Red sea bream iridovirus, RSIV) positive nucleic acid (supplied by Guangdong animal epidemic disease prevention control center) and TiLV standard (purchased from Shenzhen customs animal and plant inspection and quarantine technology center) were detected, and the specificity of RT-ddPCR of the present invention for detecting tilapia lake virus was evaluated.
As shown in FIG. 9, the results were confirmed in that the droplet generation numbers of ddPCR amplification were 15000 or more, as shown in FIG. 9. No positive droplets were present for all other 5 positive viral nucleic acid assays except for TiLV positive samples (259). The RT-ddPCR detection method established by the invention has better specificity to TiLV.
Test example 4 reproducibility of the method of the invention
The intra-group variation coefficient of the RT-ddPCR method established in example 2 was analyzed by selecting 4-fold diluted TiLV-cDNA as a template and 15 replicates. To evaluate the reproducibility of the RT-ddPCR method of the present invention.
As shown in Table 9 and FIG. 10, the number of generated droplets by ddPCR amplification was 17000 or more, and the results were true. The Coefficient of Variation (CV) of the in-group test was 4.86%, demonstrating good reproducibility of the established RT-ddPCR.
TABLE 9 within-group repeatability assay of ddPCR
Test example 5 sensitivity comparison of RT-ddPCR and real-time fluorescence PCR method for detecting Tilapia lake virus
With ddH 2 O2-fold serial dilutions of TiLV-cDNA (RNA extraction and reverse transcription as in example 2) were performed for 20 gradients, each gradient was subjected to 3 replicates, while ddPCR and real-time fluorescence PCR detection (real-time fluorescence PCR)The primer probe sequence and the primer probe set of RT-ddPCR, the reaction system and the procedure are shown in Table 3). Negative and blank controls were set up simultaneously.
The results of RT-ddPCR and real-time fluorescence PCR methods for detecting tilapia lake virus are shown in Table 10 and Table 11, respectively.
TABLE 10 sensitivity test of TiLV-cDNA ddPCR
TABLE 11 sensitivity test of real-time fluorescent PCR method
ddPCR experiments were performed on 20 TiLV-cDNAs of different gradients, and the number of amplified droplets was 13000 or more, which was found to be true. The results in tables 10 and 11 show that: the average lower limit of the ddPCR detection method is 2 copies/. Mu.l -1 The sensitivity is 2 times higher than that of the real-time fluorescence PCR detection method.
The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.
The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.
Claims (10)
1. A primer for detecting tilapia lake virus by reverse transcription microdroplet digital PCR is characterized by comprising an upstream primer with a nucleotide sequence shown as SEQ ID NO.1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 2.
2. A reverse transcription microdroplet digital PCR probe for detecting tilapia lake virus is characterized in that the nucleotide sequence of the probe is shown as SEQ ID NO. 3.
3. The probe for detecting tilapia lake virus by reverse transcription microdroplet digital PCR according to claim 2, wherein the probe is modified with FAM at the 5 'end and BHQ1 at the 3' end.
4. Use of the primer of claim 1 or the probe of claim 2 or 3 in the preparation of a kit for detecting tilapia lake virus by reverse transcription microdroplet digital PCR.
5. Use of the primer of claim 1 or the probe of claim 2 or 3 in tilapia lake virus standard calibration or quality control product concentration calibration.
6. A kit for detecting tilapia lake virus by reverse transcription microdroplet digital PCR, comprising the primer of claim 1 and the probe of claim 3 or 4.
7. The kit for detecting tilapia lake virus by reverse transcription microdroplet digital PCR according to claim 6, wherein the working concentration of the primer is 450 nmol.L -1 ～550nmol·L -1 The method comprises the steps of carrying out a first treatment on the surface of the And/or the working concentration of the probe is 250 nmol.L -1 ～350nmol·L -1 。
8. A method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR, which is characterized by comprising the following steps: and using cDNA of the sample to be detected as a template, performing ddPCR amplification by using the kit, and microdroplet reading ddPCR amplification results.
9. The method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR according to claim 8, wherein the reaction procedure of ddPCR amplification is: 95 ℃ for 10min;94 ℃ for 30s,54.2 ℃ for 60s and 40 cycles; 98 ℃ for 10min;4 ℃ is infinity.
10. The method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR according to claim 8, wherein the reaction system for ddPCR amplification comprises: ddPCR Supermix forProbes, primer, probe, cDNA template and dd H 2 O。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211043373.8A CN116064941A (en) | 2022-08-29 | 2022-08-29 | Primer, probe and method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211043373.8A CN116064941A (en) | 2022-08-29 | 2022-08-29 | Primer, probe and method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116064941A true CN116064941A (en) | 2023-05-05 |
Family
ID=86172210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211043373.8A Pending CN116064941A (en) | 2022-08-29 | 2022-08-29 | Primer, probe and method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116064941A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107974515A (en) * | 2017-11-27 | 2018-05-01 | 广州双螺旋基因技术有限公司 | A kind of constant temperature quick detection kit of Tilapia mossambica Luohu virus |
| CN110819740A (en) * | 2019-12-16 | 2020-02-21 | 中国检验检疫科学研究院 | Digital PCR (polymerase chain reaction) kit for detecting carp edema virus |
| CN111004865A (en) * | 2018-10-05 | 2020-04-14 | 福又达生物科技股份有限公司 | Method for detecting fish pathogens |
| CN113637802A (en) * | 2021-08-24 | 2021-11-12 | 中国水产科学研究院珠江水产研究所 | Kit and method for detecting rhabdovirus of weever by using digital PCR technology |
-
2022
- 2022-08-29 CN CN202211043373.8A patent/CN116064941A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107974515A (en) * | 2017-11-27 | 2018-05-01 | 广州双螺旋基因技术有限公司 | A kind of constant temperature quick detection kit of Tilapia mossambica Luohu virus |
| CN111004865A (en) * | 2018-10-05 | 2020-04-14 | 福又达生物科技股份有限公司 | Method for detecting fish pathogens |
| CN110819740A (en) * | 2019-12-16 | 2020-02-21 | 中国检验检疫科学研究院 | Digital PCR (polymerase chain reaction) kit for detecting carp edema virus |
| CN113637802A (en) * | 2021-08-24 | 2021-11-12 | 中国水产科学研究院珠江水产研究所 | Kit and method for detecting rhabdovirus of weever by using digital PCR technology |
Non-Patent Citations (2)
| Title |
|---|
| 张险朋等: "数字 PCR 技术及对动物疫病检测应用", 《畜牧兽医科技信息》, no. 1, 31 December 2020 (2020-12-31), pages 18 - 20 * |
| 龙浩等主编: "《现代肺癌诊断与治疗-临床实践与临床研究》", 31 July 2020, 广东科技出版社, pages: 76 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN111020062A (en) | Triple real-time fluorescent quantitative PCR kit for detecting African swine fever wild strain and gene deletion strain | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN105567877B (en) | A kind of the primer combination and its application of identification chicken parvovirus and Avianreovirus | |
| CN111270019A (en) | Primer group for detecting African swine fever virus, fluorescence visualization rapid detection kit and method | |
| CN107828915A (en) | Shrimp cream head virus（YHV）RAA constant temperature fluorescence detection method and reagent | |
| CN111926116A (en) | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof | |
| CN111394515B (en) | LAMP primer group, fluorescence visualization rapid kit and method for detecting canine parvovirus | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| Zeng et al. | A one‐step molecular biology method for simple and rapid detection of grass carp Ctenopharyngodon idella reovirus (GCRV) HZ08 strain | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| CN113046484B (en) | Primer probe, kit and method for detecting African swine fever virus p72 gene | |
| JP4903722B2 (en) | Method for detecting live cells in a sample by using a virus | |
| CN116875743B (en) | Fluorescent quantitative PCR kit for detecting two cat enteroviruses at one time and application thereof | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| Selim et al. | Development of real time reverse transcription loop-mediated isothermal amplification assay for rapid detection of genotype VII of Newcastle disease viruses | |
| CN115976272A (en) | TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| Sung et al. | Reverse transcription loop-mediated isothermal amplification for rapid and sensitive detection of nervous necrosis virus in groupers | |
| CN113234862B (en) | African swine fever virus LAMP detection primer group and kit | |
| KR101236197B1 (en) | Differential detection of West nile virus and Japanese encephalitis virus | |
| CN116064941A (en) | Primer, probe and method for detecting tilapia lake virus by reverse transcription microdroplet digital PCR | |
| CN109182597B (en) | Multiplex fluorescence quantitative PCR kit for simultaneously detecting avian adenovirus group I, II and III and detection method thereof | |
| CN109897918B (en) | Double real-time fluorescence quantitative detection method for carp edema virus and koi herpesvirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |