CN115961051A - Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification - Google Patents
Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification Download PDFInfo
- Publication number
- CN115961051A CN115961051A CN202211164761.1A CN202211164761A CN115961051A CN 115961051 A CN115961051 A CN 115961051A CN 202211164761 A CN202211164761 A CN 202211164761A CN 115961051 A CN115961051 A CN 115961051A
- Authority
- CN
- China
- Prior art keywords
- cercaria
- schistosoma japonicum
- sex
- female
- male
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 73
- 241000242677 Schistosoma japonicum Species 0.000 title claims abstract description 72
- 241000754688 Cercaria Species 0.000 title claims abstract description 70
- 210000000349 chromosome Anatomy 0.000 title claims abstract description 40
- 238000012216 screening Methods 0.000 title abstract description 20
- 238000000034 method Methods 0.000 claims abstract description 40
- 238000011144 upstream manufacturing Methods 0.000 claims description 10
- 239000002773 nucleotide Substances 0.000 claims description 2
- 125000003729 nucleotide group Chemical group 0.000 claims description 2
- 241000565675 Oncomelania Species 0.000 abstract description 27
- 101001135231 Homo sapiens 26S proteasome non-ATPase regulatory subunit 4 Proteins 0.000 abstract description 20
- 102100033458 26S proteasome non-ATPase regulatory subunit 4 Human genes 0.000 abstract description 15
- 108700039887 Essential Genes Proteins 0.000 abstract description 5
- 241001465754 Metazoa Species 0.000 abstract description 5
- 238000002474 experimental method Methods 0.000 abstract description 5
- 238000010171 animal model Methods 0.000 abstract description 3
- 230000008569 process Effects 0.000 abstract description 3
- 238000000265 homogenisation Methods 0.000 abstract description 2
- 108020004414 DNA Proteins 0.000 description 38
- 241001442514 Schistosomatidae Species 0.000 description 11
- 239000002299 complementary DNA Substances 0.000 description 11
- 241000242678 Schistosoma Species 0.000 description 10
- 241000565674 Oncomelania hupensis Species 0.000 description 8
- 241000242680 Schistosoma mansoni Species 0.000 description 7
- 108010067770 Endopeptidase K Proteins 0.000 description 6
- 238000011161 development Methods 0.000 description 6
- 230000018109 developmental process Effects 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 238000007400 DNA extraction Methods 0.000 description 5
- 238000001502 gel electrophoresis Methods 0.000 description 5
- 208000015181 infectious disease Diseases 0.000 description 5
- 239000000523 sample Substances 0.000 description 5
- 241000238631 Hexapoda Species 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 230000009977 dual effect Effects 0.000 description 4
- 201000004409 schistosomiasis Diseases 0.000 description 4
- 238000000246 agarose gel electrophoresis Methods 0.000 description 3
- 238000003766 bioinformatics method Methods 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 150000007523 nucleic acids Chemical group 0.000 description 3
- 238000003752 polymerase chain reaction Methods 0.000 description 3
- 210000003765 sex chromosome Anatomy 0.000 description 3
- 230000020509 sex determination Effects 0.000 description 3
- 238000012795 verification Methods 0.000 description 3
- 241000699666 Mus <mouse, genus> Species 0.000 description 2
- 241000699670 Mus sp. Species 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 208000009434 Schistosomiasis japonica Diseases 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000001514 detection method Methods 0.000 description 2
- 235000013601 eggs Nutrition 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 201000006675 intestinal schistosomiasis Diseases 0.000 description 2
- 238000012775 microarray technology Methods 0.000 description 2
- 230000000877 morphologic effect Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000010200 validation analysis Methods 0.000 description 2
- 108700026220 vif Genes Proteins 0.000 description 2
- 208000003322 Coinfection Diseases 0.000 description 1
- 239000003298 DNA probe Substances 0.000 description 1
- 241000935974 Paralichthys dentatus Species 0.000 description 1
- 208000019532 Schistosoma japonicum infectious disease Diseases 0.000 description 1
- 238000002105 Southern blotting Methods 0.000 description 1
- 241001489151 Trichuris Species 0.000 description 1
- 230000003187 abdominal effect Effects 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 239000000090 biomarker Substances 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 239000008367 deionised water Substances 0.000 description 1
- 229910021641 deionized water Inorganic materials 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 230000008774 maternal effect Effects 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000035938 sexual maturation Effects 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
- 239000012224 working solution Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a screening method of Schistosoma japonicum W chromosome specific genes and application thereof in cercaria sex identification, in particular to a double PCR method adopting specific primers containing Schistosoma japonicum W chromosome specific genes and Schistosoma japonicum internal reference gene PSMD4 primers, belonging to the field of biotechnology. The invention uses Schistosoma japonicum W chromosome specific gene primer and PSMD4 housekeeping gene primer, adopts double PCR method to rapidly identify Schistosoma japonicum cercaria sex, the whole process only needs 2 hours, compared with the traditional animal experiment identification method, the invention greatly shortens the identification time, and improves the standardization and homogenization of the Schistosoma japonicum animal model; meanwhile, the DNA of cercaria does not need to be extracted, and compared with the traditional PCR method, the method is simple, convenient and quick to operate, high in repeatability and capable of realizing high-throughput identification; the invention can identify the single female or male cercaria released by the positive oncomelania, and can also identify the male and female mixed sex cercaria released by the positive oncomelania.
Description
The application is a divisional application with the name of screening specific genes of schistosoma japonicum W chromosome and application thereof in cercaria sex identification on application date 2019, 6 and 18, and application number 201910527323.9.
Technical Field
The invention relates to the field of biotechnology, in particular to the screening of Schistosoma japonicum W chromosome specific genes and the application thereof in cercaria sex identification.
Background
The schistosome is a unique male and female allofluke, and the chromosomes comprise 7 pairs of autosomes and 1 pair of sex chromosomes, wherein the male sex chromosome is ZZ type, and the female sex chromosome is ZW type. Schistosoma japonicum, schistosoma mansoni and schistosoma japonicum are the most main three pathogens of human schistosomiasis. The schistosoma unisexual female can not develop and mature in a host body, sexual maturation of the schistosoma unisexual female depends on the embracing with a male worm, and a large number of worm eggs generated by the mature female are the key points for causing pathological damage of the host and disease retransmission. The development of the technology for quickly identifying the sex of the schistosoma japonicum cercaria is beneficial to the establishment of a schistosoma japonicum infected animal model with a single sex and has important significance for the research on the genetic evolution, development and reproduction mechanism of the schistosoma japonicum.
The life history of schistosome includes multiple development stages of egg, miracidium, maternal miracidium, subcontracting miracidium, cercaria, trichuris and imago, wherein only the imago stage has obvious sex dimorphism, and other development stages are difficult to carry out sex identification through the difference of the morphological structure of the imago. The traditional method for identifying the sex of the cercaria in animal experiments is to artificially infect an experimental mouse with the cercaria released by a single positive oncomelania, dissect and pick up the cercaria after the body of the cercaria develops to an adult (at least about 1 month of culture is needed) in the mouse, and identify the sex of the infected cercaria through the morphological structure difference of the adult. The method is time-consuming and labor-consuming, and cannot meet the requirement of rapidly identifying the sex of cercaria.
With the development of molecular biology technology, foreign scholars screen and obtain multiple W chromosome specific nucleic acid sequences such as D9, W1, W2 and W6 from Schistosoma mansoni genome, and design specific DNA probes and primers based on the sequences, and establish Schistosoma mansoni cercaria sex identification method through Southern hybridization or PCR. Unfortunately, the reported method for identifying the sex of the cercaria of Schistosoma mansoni is unstable in the sex identification result of the cercaria of Schistosoma mansoni from different geographical strains, and the specific probe and primer for the sex of Schistosoma mansoni cannot be used for the sex identification of the cercaria of Schistosoma japonicum and Schistosoma Egypti.
Although the time required by the traditional method for identifying the sex of the cercaria by PCR is greatly shortened compared with the method for identifying the sex of the cercaria by animal experiments, a plurality of problems still exist and need to be further solved. Firstly, the traditional method for identifying the sex of the cercaria by PCR needs to extract a plurality of pieces of cercaria DNA as a template to carry out specific nucleic acid sequence amplification, has complex operation and has the possibility of introducing template pollution. Meanwhile, as only one pair of specific amplification areas of the female worms are provided with the primers in the PCR system, the sample of the amplified target strip cannot be confirmed to be single-female cercaria, and the mixed infection of the female cercaria and the male cercaria must be eliminated; for the sample without amplified target band, it is not determined that the sample is male cercaria, and the possibility of failed DNA extraction must be excluded.
With the development of high-throughput sequencing technology, transcriptomes and genomes of schistosoma japonicum, schistosoma mansoni and schistosoma japonicum are successively decoded, and abundant information resources are provided for researchers to research schistosomiasis and schistosomiasis. However, the schistosoma japonicum genome is not yet assembled to the chromosome level, and a nucleic acid sequence or gene specific to the W chromosome cannot be selected by the genome sequence alone. At present, the molecular biology method for identifying the sex of schistosoma japonicum cercaria is rarely reported.
Disclosure of Invention
The invention aims to provide a method for screening schistosoma japonicum W chromosome specific genes.
Another purpose of the invention is to provide an application method of schistosoma japonicum W chromosome specific gene in cercaria sex identification.
In order to achieve the above purpose, the invention provides the following technical scheme:
firstly, primarily screening out female schistosoma japonicum specific expression genes by utilizing a Microarray technology, and further screening out candidate genes by combining bioinformatics analysis for PCR verification; designing specific primers according to the candidate gene sequences, and finally screening the schistosoma japonicum W chromosome specific genes by using cDNA and genomic DNA of female adults and male adults as templates and adopting a PCR method.
Then, a double PCR technical system is established by using the schistosoma japonicum W chromosome specific gene primer and the PSMD4 housekeeping gene primer, and sex identification verification is carried out on schistosoma japonicum strains in Anhui province, hunan province, jiangsu province and Jiangxi province in China.
Furthermore, a PCR template is directly prepared by digesting cercaria through protease K, and a DNA extraction-free duplex PCR method for rapidly identifying the sex of the cercaria is established by using a schistosoma japonicum W chromosome specific gene primer and a PSMD4 housekeeping gene primer.
Specifically, the Schistosoma japonicum W chromosome specific gene comprises a nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO. 3.
The screening method of Schistosoma japonicum W chromosome specific gene includes the following steps:
s1, primarily screening out female schistosoma japonicum specific expression genes by utilizing a Microarray technology;
s2, further screening out female fluke specific expression genes which are well compared with the schistosoma japonicum genome as candidate genes through bioinformatics analysis;
s3, designing a specific primer according to the candidate gene sequence;
s4, taking cDNA and genomic DNA of female and male adult schistosoma japonicum katsurada as templates, and screening out a female specific expression gene PCR product obtained by specifically amplifying the female genomic DNA template by a PCR method, namely the schistosoma japonicum W chromosome specific gene.
The invention also provides an application method of the schistosoma japonicum W chromosome specific gene in cercaria sex identification. The specific gene of Schistosoma japonicum W chromosome is used as biomarker for sex determination of Schistosoma japonicum cercaria, and double PCR process including specific primer of Schistosoma japonicum W chromosome and primer of Schistosoma japonicum internal reference gene PSMD4 is adopted. More particularly, the double PCR method for rapidly identifying the sex of schistosoma japonicum cercaria by using a schistosoma japonicum W chromosome specific gene primer and a PSMD4 housekeeping gene primer and directly preparing a PCR template through digesting the cercaria by using protease K and avoiding DNA extraction.
Wherein, a group of specific primers for identifying the sex of schistosoma japonicum cercaria comprise SjF4, sjF6 or SjF9 primers and a combination of any specific primer and PSMD4 primer.
The Schistosoma japonicum specific gene SjF4 primer and the upstream and downstream primers are respectively shown as SEQ ID NO.4 and SEQ ID NO.5, and comprise:
an upstream primer SjF4-f:5' AGATGGCTCAACTGGTCTATCA-3
The downstream primer SjF4-r:5' ACCAGACATTTGCAGCACACAC-3
The specific gene SjF6 primer of female schistosoma japonicum, the upstream primer and the downstream primer are respectively shown as SEQ ID NO.6 and SEQ ID NO.7, and the specific gene SjF6 primer comprises the following components:
an upstream primer SjF6-f:5' GAATTCGTTGCAAGCGCTCAA-3
The downstream primer SjF6-r:5 'and 3' of TGGGACTCTTTTCACTTGGCA-
The specific gene SjF9 primer of female schistosoma japonicum katsurada, the upstream primer and the downstream primer are respectively shown as SEQ ID NO.8 and SEQ ID NO.9, comprising:
an upstream primer SjF9-f:5' GCGTCCAAATTTCGTGAGAT-3
A downstream primer SjF9-r:5' TTTGAACGGCAACTTTCGG-doped 3
The schistosoma japonicum internal reference gene PSMD4 primer and the upstream primer and the downstream primer are respectively shown as SEQ ID NO.10 and SEQ ID NO.11 and comprise:
an upstream primer PSMD4-f:5' CCTCCACACAACAATTTCCACATCT
The downstream primer PSMD4-r:5' GATCACTTATAGCCTTGCGAAACAT 3
Compared with the prior art, the invention has the beneficial effects that:
1. the invention adopts a double PCR method of a specific primer containing the Schistosoma japonicum W chromosome specific gene and a primer of a Schistosoma japonicum internal reference gene PSMD4 to identify the sex of cercaria, the whole process only needs 2 hours, compared with the traditional animal experiment cercaria sex identification method (about 1 month time), the invention greatly shortens the cercaria sex identification time and improves the standardization and homogenization of the Schistosoma japonicum animal model.
2. According to the invention, the PCR template is directly prepared by digesting cercaria through the protease K, the dual PCR method is used for identifying the sex of the cercaria without extracting DNA, the condition that the traditional PCR method does not amplify target strips due to the failure of sample DNA extraction is avoided, the detection accuracy is improved, meanwhile, the method is used without extracting the DNA of the cercaria, and the method is simple, convenient and rapid to operate and high in repeatability compared with the traditional PCR method, and can realize high-throughput identification.
3. The dual PCR method of the invention can identify single female or male cercaria released by the positive oncomelania, can identify mixed female and male cercaria released by the positive oncomelania, and has wider application range.
Drawings
In order to more clearly illustrate the embodiments of the present application or technical solutions in the prior art, the drawings required in the embodiments will be briefly described below, it is obvious that the drawings in the following description are only some embodiments described in the present invention, and other drawings can be obtained by those skilled in the art according to these drawings.
FIG. 1 is a schematic diagram showing the PCR screening result of the specific gene of Schistosoma japonicum W chromosome in example 1 of the present invention, wherein M is a 50bp DNA Ladder molecular weight standard; PSMD4 is a PCR product of an internal reference gene; 1-12 are PCR products of 12 female schistosoma japonicum specific expression genes respectively; a is a PCR product taking schistosome adult cDNA as a template, a female parent is a female adult cDNA template PCR product, and a male parent is a male adult cDNA template PCR product; b is a PCR product taking schistosome adult DNA as a template, a female parent is a PCR product of female adult DNA template, and a male parent is a PCR product of male adult DNA template;
FIG. 2 is a schematic diagram showing the double PCR validation results of Schistosoma japonicum W chromosome specific genes in genomic DNAs of different Geophilia japonicum strains in example 2 of the present invention; A. b and C are double PCR products of three Schistosoma japonicum W chromosome specific gene primers respectively; m is 50bp DNA Ladder molecular weight standard; 1-3 are double PCR products of female adult genome DNA, 4-6 are double PCR products of male adult genome DNA;
FIG. 3 is a schematic diagram showing the results of the dual PCR method for rapid sex determination of Schistosoma japonicum cercaria in example 4 of the present invention. A. B and C are dual PCR products of primers of a W chromosome specific gene SjF9 and a reference gene PSMD4 by taking schistosoma japonicum female cercaria, male cercaria and mixed male and female sex cercaria as templates respectively; m is a 50bp DNA Ladder molecular weight standard; 1-6 are double PCR products of 6 cercaria released from a single positive oncomelania.
Detailed Description
In order to make those skilled in the art better understand the technical solution of the present invention, the present invention will be further described in detail with reference to the following embodiments.
Example 1 Schistosoma japonicum W chromosome specific Gene screening
(1) Primarily screening 100 specific expressed genes of the female and male adult according to the ratio of the expressed fluorescent signals of the genes of the female and male adult, and further screening 12 candidate genes of which the gene sequences are well compared with the schistosoma japonicum genome through bioinformatics analysis.
(2) Designing a PCR primer: gene specific primers were designed using PrimerPremier 5.0 software according to the gene sequence, and the primer information of 12 Schistosoma japonicum female specific expression candidate genes is shown in Table 1.
TABLE 1 primer information of female schistosoma japonicum specific expression genes
(3) PCR screening of Schistosoma japonicum W chromosome specific gene: PCR verification and W chromosome specific gene screening are carried out on 12 Schistosoma japonicum female and male adult Schistosoma japonicum cDNA and genomic DNA respectively used as templates, a housekeeping gene PSMD4 used as an internal reference gene, an upstream primer thereof used as 5' -CCTCCAACAATTCCACATCT-. The PCR reaction system is as follows:
PCR amplification procedure: 1min at 98 ℃; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 5s for 35 cycles; and finally extension at 72 ℃ for 10s.
(4) The PCR product was detected by 2.5% agarose gel electrophoresis, and the presence of the desired band was observed, with the results shown in FIG. 1. The result shows that 12 pairs of Japanese blood fluke female specific expression gene primers amplify specific target bands in female blood fluke cDNA templates, and no target band is amplified in male cDNA templates; 3 pairs of primers (4, 6 and 9) in 12 pairs of female schistosoma japonicum specific expression gene primers only amplify a target band in a female schistosoma japonicum DNA template, and the target band is a W chromosome specific gene. FIG. 1A shows the electrophoresis result of PCR products using adult female and male cDNA as templates, where M is 50bp DNA ladder molecular weight, PSMD4 is internal reference gene PCR product, 1-12 are PCR products of 12 female schistosoma japonicum specific expression genes, female adult cDNA template PCR product, and male adult cDNA template PCR product, respectively. FIG. 1B shows the electrophoresis result of PCR product with adult male and female genome DNA as template, M is 50bp DNA Ladder molecular weight standard, PSMD4 is internal reference gene PCR product, 1-12 are PCR products of 12 female blood fluke specific expression genes, female blood fluke DNA template PCR product and male adult blood fluke DNA template PCR product.
Example 2 validation of Schistosoma japonicum W chromosome-specific genes in different Geographical insect strains
(1) Extracting genome DNA: collecting the male and female adult Japanese blood flukes in Anhui province, hunan province, jiangxi province and Jiangsu province of China, and respectively extracting the genome DNA of the male and female adult by using a genome DNA extraction kit (QIAGEN company), wherein the female and male adult are subjected to three biological repetitions respectively to prepare a PCR template.
(2) Taking the genome DNA of male and female schistosoma japonicum adult schistosoma japonicum in different provinces as a template and PSMD4 as an internal reference gene, and respectively carrying out double PCR detection by using primers of specific genes SjF4, sjF6 and SjF9 of the schistosoma japonicum W chromosome. The PCR reaction system is as follows:
the PCR amplification procedure was the same as in example 1.
(3) The double PCR product was detected by 2.5% agarose gel electrophoresis and the presence of the desired band was observed. The gel electrophoresis result is shown in FIG. 2, wherein M is a 50bp DNA Ladder molecular weight standard, and the gel electrophoresis results of DNA template PCR products of adult schistosoma japonicum in Anhui province, hunan province, jiangsu province and Jiangxi province sequentially from left to right, 1-3 are DNA template PCR products of female adults, and 4-6 are DNA template PCR products of male adults. FIG. 2A shows that a clear and bright band is amplified at 129bp of all female insect DNA templates and is a PCR product of PSMD4 reference gene, a clear and bright band is amplified at 190bp of all female insect DNA templates and is a PCR product of W chromosome specific gene SjF4, and a clear and bright band is amplified at 129bp of all male insect DNA templates and is a PCR product of reference gene; the result of FIG. 2B shows that a clear and bright band amplified from all female DNA templates at 129bp is the PCR product of PSMD4 reference gene, a clear and bright band amplified from 226bp is the PCR product of W chromosome specific gene SjF9, and a clear and bright band amplified from all male DNA templates at 129bp is the PCR product of PSMD4 reference gene; the result of FIG. 2C shows that a clear and bright band amplified from all female DNA templates at 129bp is the PCR product of PSMD4 reference gene and a clear and bright band at 260bp is the PCR product of W chromosome specific gene SjF6, and a clear and bright band amplified from all male DNA templates at 129bp is the PCR product of PSMD4 reference gene.
EXAMPLE 3 Single and Mixed sex Schistosoma japonicum infection-positive Oncomelania hupensis preparation
(1) Screening negative oncomelania: oncomelania hupensis is collected in non-schistosomiasis japonica epidemic areas and is further verified as non-schistosoma japonicum infected negative Oncomelania hupensis by a photoperiosis method.
(2) Preparing artificial infection positive oncomelania: and (3) infecting oncomelania by using single oncomelania or infecting oncomelania by using a plurality of mixed oncomelania, and culturing the oncomelania in a light culture box for 3 months after infection.
(3) Animal infection experiment identification of cercaria sex: and (3) placing one artificial infected oncomelania into each test tube, numbering, releasing cercaria in single positive oncomelania by a light irradiation cercaria escape method, selecting about 60 cercarias from each oncomelania, infecting mice one by an abdominal patch method, feeding the infected mice for 5 weeks, dissecting, and taking adults to identify the sex of the cercaria. The sex identification results of 20 positive oncomelania-releasing cercaria are shown in Table 2, and 8 single female schistosomes infected with positive oncomelania, 7 single male schistosomes infected with positive oncomelania and 5 female and male mixed sex schistosomes infected with oncomelania are obtained.
TABLE 2 sex determination results of artificial infection positive oncomelania-releasing cercaria
Wherein F represents a female, M represents a male, and FM represents a sex-mixed sex.
Example 4 double PCR method for fast identification of cercaria sex without DNA extraction
(1) Preparing cercaria: each tube was filled with one positive oncomelania (3 oncomelania were individually taken from single female, single male and mixed female and male, 3 oncomelania, the sex of cercariae was identified in example 3), cercariae was released by illuminating cercariae escape method, cercariae was dipped with sterile pipette tip and transferred to 24-well plate containing deionized water, and cercariae was killed by incubating at 60 ℃ for 5 min.
(2) Cercaria proteinase K digestion: under an inverted microscope, single cercaria was picked with sterile pipette tips into PCR tubes containing 5. Mu.l of proteinase K working solution (QIAGEN Co.) (6 cercaria released from each positive oncomelania were picked), the PCR tubes were placed in a PCR instrument and incubated at 60 ℃ for 5min to digest cercaria, and at 98 ℃ for 10min to inactivate proteinase K thermally.
(3) Double PCR: and (3) centrifuging the PCR tube for a short time, and adding the premixed PCR reaction solution into the PCR tube, wherein the PCR reaction system is as follows:
the PCR amplification procedure was the same as in example 1.
(4) The PCR product was checked by 2.5% agarose gel electrophoresis and the presence of the desired band was observed, as shown in FIG. 3, where M is a 50bp DNA Ladder molecular weight standard. FIG. 3A is the result of gel electrophoresis of the PCR products of 3 single female blood flukes infected with the cercaria released from Oncomelania hupensis, showing that a clear and bright band at 129bp is the internal reference gene PCR product, a clear and bright band at 226bp is the PCR product of the W chromosome specific gene SjF9, confirming that all the 3 positive Oncomelania hupensis infections are single female blood flukes; FIG. 3B is the result of gel electrophoresis of the PCR product of 3 single male blood flukes infected with oncomelania releasing cercaria, showing that only 129bp has a clear and bright band as the reference gene PCR product, confirming that all 3 positive oncomelania infected with single male blood flukes; FIG. 3C is the result of gel electrophoresis of PCR products of 3 mixed sex blood fluke infected Oncomelania hupensis to release cercaria, and the result shows that the female and male ratios of 6 cercaria released by 3 Oncomelania hupensis are 3, 4 and 3 respectively, and the result shows that the cercaria released by 3 positive Oncomelania hupensis is mixed sex male and female.
The above examples are only intended to illustrate the technical solution of the present invention, and not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: it is to be understood that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof, but such modifications or substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention. The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like made within the spirit and principle of the present invention should be included in the scope of the present invention.
Claims (1)
1. The Schistosoma japonicum W chromosome specific gene SjF6 is applied to the identification of cercaria sex by a molecular biology method, the nucleotide sequence of the Schistosoma japonicum W chromosome specific gene SjF6 is shown as SEQ ID NO.2, and the specific upstream primer sequence and the specific downstream primer sequence of the SjF6 gene are respectively shown as SEQ ID NO.6 and SEQ ID NO. 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211164761.1A CN115961051A (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910527323.9A CN110144413B (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
| CN202211164761.1A CN115961051A (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910527323.9A Division CN110144413B (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115961051A true CN115961051A (en) | 2023-04-14 |
Family
ID=67591641
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211164761.1A Pending CN115961051A (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
| CN201910527323.9A Active CN110144413B (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
| CN202211165248.4A Pending CN115961013A (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910527323.9A Active CN110144413B (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
| CN202211165248.4A Pending CN115961013A (en) | 2019-06-18 | 2019-06-18 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (3) | CN115961051A (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115961051A (en) * | 2019-06-18 | 2023-04-14 | 中国医学科学院病原生物学研究所 | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002029055A2 (en) * | 2000-10-02 | 2002-04-11 | Incyte Genomics, Inc. | Carbohydrate-associated proteins |
| CN1986567A (en) * | 2005-12-20 | 2007-06-27 | 上海人类基因组研究中心 | Japanese blood fluke specific female fluke sex gene and its coded protein and application |
| CN1986564A (en) * | 2005-12-20 | 2007-06-27 | 上海人类基因组研究中心 | Japanese blood fluke specific female fluke gene and its coded protein and application |
| CN101597645A (en) * | 2009-06-26 | 2009-12-09 | 华南农业大学 | A kind of schistosoma japonicam sex specific detection primer, detection kit and detection method |
| CN105254732A (en) * | 2015-11-23 | 2016-01-20 | 中国医学科学院病原生物学研究所 | Schistosoma japonicum katsurada recombinant protein SjSAPLP5 as well as encoding gene and application thereof |
| CN105384803A (en) * | 2015-11-23 | 2016-03-09 | 中国医学科学院病原生物学研究所 | Schistosoma japonicum katsurada recombinant protein SjSAPLP4 as well as encoding gene and application thereof |
| CN109536623A (en) * | 2019-01-15 | 2019-03-29 | 苏州大学 | It is a kind of that schistosoma japonicum cercariae method for distinguishing is identified using Multiplex PCR |
| CN110144413A (en) * | 2019-06-18 | 2019-08-20 | 中国医学科学院病原生物学研究所 | The screening of Schistosoma japonicum W chromosome specific gene and its application in cercaria sex identification |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357559A (en) * | 2014-10-27 | 2015-02-18 | 同济大学 | Identification method for key ribosomal proteins in developmental regulation of female schistosoma japonicum katsurada |
-
2019
- 2019-06-18 CN CN202211164761.1A patent/CN115961051A/en active Pending
- 2019-06-18 CN CN201910527323.9A patent/CN110144413B/en active Active
- 2019-06-18 CN CN202211165248.4A patent/CN115961013A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002029055A2 (en) * | 2000-10-02 | 2002-04-11 | Incyte Genomics, Inc. | Carbohydrate-associated proteins |
| CN1986567A (en) * | 2005-12-20 | 2007-06-27 | 上海人类基因组研究中心 | Japanese blood fluke specific female fluke sex gene and its coded protein and application |
| CN1986564A (en) * | 2005-12-20 | 2007-06-27 | 上海人类基因组研究中心 | Japanese blood fluke specific female fluke gene and its coded protein and application |
| CN101597645A (en) * | 2009-06-26 | 2009-12-09 | 华南农业大学 | A kind of schistosoma japonicam sex specific detection primer, detection kit and detection method |
| CN105254732A (en) * | 2015-11-23 | 2016-01-20 | 中国医学科学院病原生物学研究所 | Schistosoma japonicum katsurada recombinant protein SjSAPLP5 as well as encoding gene and application thereof |
| CN105384803A (en) * | 2015-11-23 | 2016-03-09 | 中国医学科学院病原生物学研究所 | Schistosoma japonicum katsurada recombinant protein SjSAPLP4 as well as encoding gene and application thereof |
| CN109536623A (en) * | 2019-01-15 | 2019-03-29 | 苏州大学 | It is a kind of that schistosoma japonicum cercariae method for distinguishing is identified using Multiplex PCR |
| CN110144413A (en) * | 2019-06-18 | 2019-08-20 | 中国医学科学院病原生物学研究所 | The screening of Schistosoma japonicum W chromosome specific gene and its application in cercaria sex identification |
Non-Patent Citations (3)
| Title |
|---|
| NAB HOU 等: "A novel Schistosoma japonicum endonuclease homologous to DNase II", BMC GENOMICS, vol. 16, no. 126, 31 December 2015 (2015-12-31), pages 1 - 11 * |
| PENGFEI CAI等: "Comprehensive Transcriptome Analysis of Sex-Biased Expressed Genes Reveals Discrete Biological and Physiological Features of Male and Female Schistosoma japonicum", PLOS NEGL TROP DIS, vol. 10, 29 April 2016 (2016-04-29), pages 1 - 24 * |
| SHUAI LIU 等: "Duplex real-time PCR for sexing Schistosoma japonicum cercariae based on W chromosome-specific genes and its applications", PLOS NEGLECTED TROPICAL DISEASES, vol. 14, no. 8, 21 August 2020 (2020-08-21), pages 1 - 18 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110144413B (en) | 2022-12-20 |
| CN110144413A (en) | 2019-08-20 |
| CN115961013A (en) | 2023-04-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105647969B (en) | Method for breeding zebra fish with stat1a gene deletion by gene knockout | |
| CN106906211B (en) | Molecular joint and application thereof | |
| CN110551853A (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN113481311B (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
| CN111534635A (en) | Integrated molecular diagnosis system and application thereof in tracing beta coronavirus animal source | |
| CN106947834B (en) | Multiplex PCR method for detecting six duck susceptibility viruses | |
| CN111793704A (en) | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof | |
| CN111304365A (en) | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof | |
| CN115044710A (en) | Primer group, kit and application for detecting pangolin beta coronavirus | |
| CN111187756A (en) | Areca-nut yellows-related virus and detection method thereof | |
| CN113943831A (en) | Multiple fluorescent quantitative primer and probe combination capable of diagnosing three high-incidence pathogens of porcine diarrhea disease simultaneously and application thereof | |
| CN110144413B (en) | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification | |
| CN112359104A (en) | Development method and application of sex specific marker of mandarin fish | |
| CN109371110B (en) | LAMP (loop-mediated isothermal amplification) detection kit for bacterial canker pathogen of poplar | |
| CN115976272A (en) | TaqMan fluorescent quantitative PCR method for rapidly detecting prawn hemangiocyte iridovirus | |
| CN110607398A (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN114438265A (en) | Nucleic acid composition, kit and detection method for simultaneously detecting porcine delta coronavirus, reovirus and porcine kobuvirus | |
| CN115491431A (en) | Detection kit for detecting Japanese encephalitis B virus nucleic acid based on gene editing technology and application | |
| CN111534634A (en) | Visual isothermal amplification detection reagent for type II canine adenovirus and application thereof | |
| CN113718044A (en) | Primer, probe and kit for fluorescent quantitative detection of swine mycoplasma, mycoplasma microformis and new mycoplasma haemophilus | |
| CN111440901B (en) | PCR-HRM primer for identifying porcine acute diarrhea syndrome virus and porcine epidemic diarrhea virus, method and application thereof | |
| CN114592091B (en) | Kit for detecting rhabdovirus of micropterus salmoides and detection method thereof | |
| CN113337626B (en) | Method for detecting acute strain and subacute strain of prawn VPAHPND | |
| CN116574844B (en) | RPA primer pair, kit and detection method for detecting bovine viral diarrhea virus | |
| CN116516069B (en) | RPA kit for rapidly detecting Epstein-Barr virus in cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |