CN115960764A

CN115960764A - Bacillus marinus and application thereof

Info

Publication number: CN115960764A
Application number: CN202211340301.XA
Authority: CN
Inventors: 彭启超; 魏浩; 张志鹏; 邓祖科; 李俊; 黄德龙; 车欣宇; 金晶; 王莹; 吴书凤; 张鑫鹏
Original assignee: Beijing Century Amms Biological Engineering Co ltd; BEIJING CENTURY AMMS BIOTECHNOLOGY CO LTD
Current assignee: Beijing Century Amms Biological Engineering Co ltd; BEIJING CENTURY AMMS BIOTECHNOLOGY CO LTD
Priority date: 2022-10-29
Filing date: 2022-10-29
Publication date: 2023-04-14
Anticipated expiration: 2042-10-29
Also published as: CN115960764B

Abstract

The application relates to the technical field of agricultural microorganisms, and particularly discloses a Bacillus marinus and application thereof. The preservation number of the Bacillus marinus provided by the application is CGMCC NO.25168. The Bacillus marinus has functions of producing indoleacetic acid, protease, cellulase, inorganic phosphorus and inorganic potassium. The application also provides fermentation liquor, microbial inoculum and fertilizer containing the Bacillus marinus, and further provides application of the microbial inoculum and the fertilizer in high-yield planting of crops. The Bacillus marinus provided by the application can obviously promote the growth of crops, is simple in fermentation process, can meet the requirement of industrial production, and has great application potential in high-yield healthy planting of crops in China.

Description

Bacillus marinus and application thereof

Technical Field

The application relates to the technical field of agricultural microorganisms, in particular to a bacillus marinus and application thereof.

Background

The application of chemical fertilizers as a main measure for guaranteeing the crop yield causes a series of problems of environmental pollution, reduction of crop quality and safety, deterioration of soil quality and the like, and seriously influences the sustainable development of agriculture.

The plant rhizosphere growth-promoting bacteria live in soil or attached to plant roots and can promote the absorption of plants on nutrient components so as to promote the growth of the plants. Under the action of plant growth-promoting rhizobacteria, the nutrient components in the soil can be converted from a state that can not be directly utilized by the plants into a state that can be absorbed and utilized by the plants. Some plant growth-promoting rhizobacteria are also capable of synthesizing plant growth regulators. The plant growth regulator can act on plants to promote the growth and development of the plants.

The microbial fertilizer prepared by using the plant growth-promoting rhizobacteria can improve the utilization efficiency of crops on nutrient components in soil, is beneficial to reducing the use of chemical fertilizers, and has important effects on developing ecological and healthy agriculture and improving the yield of crops. Therefore, it is urgently needed to excavate and utilize more plant rhizosphere growth-promoting bacteria capable of effectively playing a role of promoting the growth of crops so as to promote the high-yield and healthy planting of the crops.

Disclosure of Invention

In order to promote the growth and yield improvement of crops, the application provides the Bacillus marinus and application thereof.

In a first aspect, the application provides a Bacillus marinus (Bacillus haynesii) with the preservation number of CGMCC NO.25168.

Further, the bacillus marinus provided by the application is oily in the early colony stage on the LB solid culture medium, and has smooth edges and no folds; the later period is light white, the edge is irregular, and the folds are obvious.

Further, the Bacillus marinus provided by the application has the functions of producing indoleacetic acid, producing protease, producing cellulase, dissolving inorganic phosphorus and dissolving inorganic potassium.

Further, the Bacillus marinus provided herein produces greater than 20 μ g/mL of indoleacetic acid in LB liquid medium.

The Bacillus marinus provided by the application can generate a plant growth regulator, namely indoleacetic acid (IAA), which has an important regulation effect on plant growth and development, can promote the growth, division and differentiation of plant cells, regulate rooting, and further can promote the growth of crops and improve the yield. The Bacillus marinus provided by the application also has the functions of secreting protease, secreting cellulase, dissolving inorganic phosphorus and dissolving inorganic potassium, so that the effects of activating soil nutrients, improving the effective amount of the soil nutrients, promoting crops to absorb and utilize nutrients are achieved, and the growth of the crops and the yield are further promoted to be improved.

In a second aspect, the present application provides a fermentation broth, wherein the fermentation broth is prepared from the bacillus marinus provided by the present application.

In a third aspect, the present application provides a microbial inoculum, which comprises the bacillus marinus or the fermentation broth provided by the present application.

Further, the type of the microbial inoculum provided by the application is a liquid microbial inoculum or a solid microbial inoculum.

In a fourth aspect, the application provides a fertilizer, wherein the fertilizer comprises a compound fertilizer and the microbial inoculum provided by the application.

According to the fermentation liquid, the microbial inoculum and the fertilizer, the Bacillus marinus is applied to the microbial fertilizer, the functions of producing indoleacetic acid, producing protease, producing cellulase, dissolving inorganic phosphorus and dissolving inorganic potassium by the Bacillus marinus are exerted, the growth of crop root systems and the absorption of nutrients are effectively promoted, the growth vigor of crops is further promoted, the yield of the crops is improved, and the planting benefit of the crops is further increased.

Further, the ratio of the microbial inoculum to the compound fertilizer in the fertilizer provided by the application is 1 (0.5-1.5).

According to the fertilizer provided by the application, the content ratio of the microbial inoculum to the compound fertilizer is set to be 1 (0.5-1.5), so that the potential of the Bacillus marinus for promoting the growth of crops can be better exerted, the growth of the crops is further promoted, and the yield of the crops is increased.

In a fifth aspect, the application provides the application of the microbial inoculum and the fertilizer in high-yield planting of crops.

Strain preservation information: the Bacillus marinus provided by the application is named as Bacillus marinus HT-8 (Bacillus haynesii), is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC NO.25168 and the preservation date of 2022 years, 6 months and 23 days.

In summary, the present application has the following beneficial effects:

1. the Bacillus marinus provided by the application can produce indoleacetic acid, and can promote the growth of plants through the regulation of phytohormones; the fertilizer also has the functions of producing protease, producing cellulase, dissolving inorganic phosphorus and dissolving inorganic potassium, can convert nutrient substances in soil into effective states which can be absorbed and utilized by plants, is applied to the soil, is beneficial to activating soil nutrients, and further promotes the growth of the crops by promoting the crops to absorb and utilize the nutrients. In addition, the Bacillus marinus provided by the application also has the advantages of strong stability and easiness in industrialization, and has great application potential in high-yield and healthy planting of crops in China.

2. The application provides fermentation liquor, microbial inoculum and fertilizer prepared by utilizing the Bacillus marinus, also provides application of the fertilizer and microbial inoculum in high-yield planting of crops, and effectively exerts the advantages of the Bacillus marinus as plant rhizosphere growth-promoting bacteria. The fermentation liquor, the microbial inoculum and the fertilizer provided by the application can be used as a biological fertilizer to play a role in improving the growth vigor and the yield of crops; the utilization efficiency of crops on nutrient components in soil can be improved, and further the use of chemical fertilizers is reduced; and the fermentation process is simple, can meet the requirement of industrial production, and has great application value.

Drawings

FIG. 1 is a pattern of cells of Bacillus marinus provided in example 1 under a 1000-fold optical microscope.

FIG. 2 is a phylogenetic tree constructed based on the 16S rDNA sequence provided in example 1 and comprising Bacillus marinus provided herein.

FIG. 3 shows the results of the protease producing ability of Bacillus marinus provided in the performance test 2.

FIG. 4 shows the results of the performance test 3 for the cellulase-producing ability of Bacillus marinus.

FIG. 5 shows the results of the determination of inorganic phosphorus-dissolving ability of Bacillus marinus in the performance test 4.

FIG. 6 shows the results of the measurement of the inorganic potassium-dissolving ability of Bacillus marinus provided in the performance test 5.

Fig. 7 is a comparison of the results of the eggplant obtained by the cultivation in example 6 and comparative example 2 in the performance test 6 in terms of growth vigor and quality of single fruit.

Detailed Description

The application provides a Bacillus marinus and provides a process for separating, screening and identifying the Bacillus marinus. In addition, the application also provides fermentation liquor, a microbial inoculum and a fertilizer prepared by utilizing the Bacillus marinus, and application of the microbial inoculum in high-yield planting of crops.

In a first aspect, the application provides a bacillus marinus with the preservation number of CGMCC NO.25168.

Further, the application also provides a preparation method of the solid microbial inoculum, which comprises the following steps:

(1) And (3) collecting thalli: filtering the fermentation liquor of the Bacillus marinus by a ceramic membrane, retaining thalli, removing part of the fermentation liquor, and concentrating the fermentation liquor by 2-5 times to obtain the fermentation concentrated solution rich in the Bacillus marinus thalli.

(2) Preparing a powder microbial inoculum: slowly adding diatomite serving as a carrier matrix into the fermentation concentrated solution rich in the bacillus marinus thalli, wherein the adding amount of the diatomite is 5-20% of the weight of the fermentation concentrated solution, and uniformly stirring to obtain a mixture of the fermentation concentrated solution and the diatomite. And (3) spray-drying the mixture, dispersing by an atomizer at about 65 ℃ and quickly evaporating to dryness by high-temperature air at 180 ℃, and then collecting by a cyclone separator to obtain the powdery microbial inoculum of the bacillus marinus.

(3) Coating: the rotating speed of the coating barrel is set to be 20-100rpm, humic acid particles with organic matters more than or equal to 60% are added, composite adhesive liquid is sprayed according to 0.2-5% of the addition amount of per ton of humic acid, and a powdery microbial inoculum is coated according to 0.1-10% of the addition amount of per ton of humic acid, so that the solid microbial inoculum of the bacillus marinus is obtained.

The media formulations referred to in this application are as follows:

LB solid Medium: 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride and 15g/L of agar.

LB liquid medium: 10g/L of peptone, 5g/L of yeast powder and 10g/L of sodium chloride.

Fermentation medium: 12g/L of glucose, 8g/L of tryptone, 8g/L of yeast powder, 1g/L of monopotassium phosphate, 0.5g/L of magnesium sulfate, 0.5g/L of manganese sulfate and 2g/L of calcium carbonate.

The special culture medium for detecting the protease comprises the following components: 5g/L tryptone, 3g/L yeast powder, 1g/L glucose, 15g/L agar, 7.0 pH, autoclaving at 121 ℃ for 30min, cooling the sterilized detection culture medium to about 50 ℃, adding 10% of skimmed milk into the culture medium, mixing uniformly, pouring into a culture dish, and cooling for later use.

The special culture medium for cellulose detection comprises: 0.25g/L of magnesium sulfate heptahydrate, 0.5g/L of dipotassium phosphate, 0.5g/L of ammonium sulfate, 1.88g/L of sodium carboxymethyl cellulose, 15g/L of agar and pH 9.0.

Solid phosphorus-dissolving culture medium: 10g/L glucose, 5g/L calcium phosphate, 0.1g/L ammonium sulfate, 0.2g/L potassium chloride, 0.25g/L magnesium sulfate, 5g/L magnesium chloride heptahydrate, 15g/L agar and 6.8-7.0 pH.

Liquid phosphorus-dissolving culture medium: 10g/L glucose, 5g/L calcium phosphate, 0.1g/L ammonium sulfate, 0.2g/L potassium chloride, 0.25g/L magnesium sulfate, 5g/L magnesium chloride heptahydrate and pH 6.8-7.0.

Potassium-dissolving culture medium: 10g/L of sucrose, 0.5g/L of yeast powder, 0.5g/L of heptahydrate and magnesium sulfate, 1g/L of ammonium sulfate, 2g/L of disodium hydrogen phosphate, 1g/L of calcium carbonate, 1g/L of potassium feldspar powder, 15g/L of agar and 7.0 of pH.

The present application will be described in further detail below with reference to FIGS. 1 to 7 and examples, comparative examples, and performance testing tests.

Example 1

This example provides a process for the isolation, screening and identification of bacillus marinus, comprising the following steps:

sampling site: the sampling site of this example is the peach orchard in the valley region of Beijing City.

Strain isolation: separating and purifying microorganisms in soil by adopting a dilution coating plate method, weighing 10g of collected rhizosphere soil, adding the rhizosphere soil into a conical flask filled with 90mL of sterile water, oscillating at 150rpm for 30min, standing for 2h, taking supernatant, performing next step of test, and performing gradient dilution on the supernatant to obtain the concentration of 10 ^-2 ，10 ^-3 ，10 ^-4 And 10 ^-5 The resulting dilution was applied to LB solid medium in an amount of 100. Mu.L per gradient and cultured at 28 ℃ for 24 hours. And after various single strains grow on the flat plate, further purifying the single strains on the flat plate to obtain purified strains, and storing for later use.

(II) strain screening: screening is carried out on the purified strains, and the screening standard is whether the strains can synthesize the indoleacetic acid or not.

Firstly, preparing a Salkowski color developing solution, adding 10mL of 0.5mol/L ferric trichloride solution into 500mL of 35% perchloric acid, and uniformly mixing for later use.

Then respectively inoculating each separated and purified strain into LB liquid culture medium with the L-tryptophan concentration of 100mg/L, and carrying out shake culture at 28 ℃ and 200rpm for 24h to obtain bacterial suspension.

And finally, detecting the indoleacetic acid in the bacterial suspension, dripping 50 mu L of the bacterial suspension on the surface of an LB solid culture medium, immediately adding an equivalent Salkowski developing solution, and replacing the bacterial suspension with an isovolumetric indoleacetic acid aqueous solution with the concentration of 50mg/L as a positive control.

And (3) standing for 30min at room temperature in a dark place, observing, screening a strain which is red after the bacterial suspension and the Salkowski color developing solution are mixed, wherein the strain has the capability of synthesizing indoleacetic acid.

(III) identifying strains:

(1) Morphological identification

And inoculating the screened strains into an LB solid culture medium by adopting a four-zone streaking method, culturing at 28 ℃ for 48 hours, observing the colony morphology, and observing the thallus morphology by using gram staining. After 48h of culture, observation shows that the bacterial colony is oily in the initial stage, smooth in edge and free of wrinkles; the later period is light white, the edge is irregular, and the folds are obvious. When the strain was observed under a microscope by gram staining, as shown in FIG. 1, it was found to be a gram-positive bacterium and to be in the form of a short rod.

(2) Molecular biological identification

The microbial species were identified using colony PCR and 16S rDNA sequencing techniques.

Inoculating the screened strains on the surface of an LB solid medium, culturing overnight, selecting different fresh single colonies, respectively placing the single colonies in 1.5mL centrifuge tubes, adding 10 muL S2 lysate (purchased from Beijing Optimalaceae biotechnology Co., ltd.), shaking and mixing uniformly, standing for 20min at room temperature, then diluting by 20 times, shaking and mixing uniformly, centrifuging for 2min at 12000rpm, taking the supernatant as a template, and carrying out PCR amplification.

The amplification primers were as follows:

27F：AGAGTTTGATCCTGGCTCAG；

1492R：TACGGCTACCTTGTTACGACTT。

amplification reagents: 2 × EasyTaq SuperMix (available from Biotechnology Ltd. Of Kyoengine, beijing).

The amplification procedure was as follows:

94℃5min；

30s at 94 ℃; 30s at 55 ℃; 90s at 72 ℃; circulating for 35 times;

storing at 72 deg.C for 7min and 4 deg.C.

The reaction system of colony PCR is shown in table 1:

TABLE 1 reaction System for colony PCR

Reagent	Amount of use (mu L)
		2×EasyTaq SuperMix	15
27F(10μM)	1.5
		1492R(10μM)	1.5
Form panel	5
		ddH ₂ O	7
Total volume	30

The formulation of the agarose gel is shown in table 2:

TABLE 2 agarose gel formulations

Reagent	Amount used (mL)
		Distilled water	2.16
30％Acr-Bis(29:1)	2.64
		1M Tris(pH＝8.8)	3.04
10％SDS	0.08
		10% sodium persulfate	0.08
TEMED	0.0032
		Total of	8.0032

And (4) carrying out agarose gel electrophoresis on the PCR amplification product, and recovering and purifying the gel block. Performing Sanger sequencing on the purified product to obtain a forward and reverse sequencing result, and splicing the obtained data by using DNAMAN software, wherein the 16S rDNA sequence is shown as SEQ ID No. 1.

(3) Phylogenetic identification

The sequence shown in SEQ ID No.1 was aligned with the 16S rDNA sequence in the ezBioCloud database (www. And estimating the repetition times 1000 times by MEGA 5.0 software by adopting a Neighbor-Joining method and a Bootstrap confidence value, constructing a phylogenetic tree, and determining the position of the strain in the phylogenetic tree. The construction result of the phylogenetic tree is shown in figure 2, wherein HT-8 is the strain screened by the application, and the identification and comparison result shows that the strain is Bacillus marinus (Bacillus haynesii).

Performance test 1

The indole acetic acid producing capacity of the bacillus marinus obtained by separation and identification in example 1 is determined by the following specific steps:

making a heteroauxin standard curve: preparing indoleacetic acid standard solutions with mass concentrations of 10.0 mu g/mL, 20.0 mu g/mL, 30.0 mu g/mL, 40.0 mu g/mL and 50.0 mu g/mL respectively, mixing 4mL of the indoleacetic acid standard solutions with the Salkowski color developing agent according to a volume ratio of 1.

Scraping the bacterial lawn of the Bacillus marinus on a double-ring LB solid plate, inoculating the bacterial lawn of the Bacillus marinus on an LB liquid culture medium, performing shake culture at 28 ℃ and 200rpm for 24h, taking out, centrifuging at 4,000rpm for 15min, taking 4mL of supernate, mixing with a Salkowski developer according to the volume ratio of 1, performing dark reaction at 25 ℃ for 30min, measuring the OD value of 530nm, and calculating the content of the indoleacetic acid in the bacterial liquid according to an indoleacetic acid standard curve regression equation.

Through determination, the indole acetic acid production amount of the Bacillus marinus reaches 21.46 mu g/mL, and the Bacillus marinus has great growth promotion potential.

Performance test 2

The protease-producing capability of the Bacillus marinus obtained by separation and identification in example 1 is determined by the following specific steps:

scraping the bacterial lawn of the Bacillus marinus on a ring of LB solid plates, inoculating the bacterial lawn on a special culture medium for detecting protease, culturing at 28 ℃ for 48h, and observing whether a lysis ring appears.

The results in FIG. 3 show that Bacillus marinus can secrete protease and has strong capability of decomposing protein, and the diameter of the lytic ring reaches 18.2mm.

Performance test 3

The method for measuring the cellulase production capacity of the Bacillus marinus obtained by separation and identification in example 1 comprises the following specific steps:

scraping the Bacillus marinus lawn on a ring of LB solid plate, inoculating to a special culture medium for cellulose detection, and culturing at 28 deg.C for 7 days. After 7 days, adding 5mL of Congo red dye solution with the concentration of 0.2mg/mL into the plate, and dyeing for 1h; after discarding Congo red dye solution, adding 1mol/L sodium chloride solution for washing for 1h, and discarding washing solution; the generation of hydrolysis circles around the colonies was observed, and the occurrence of hydrolysis circles indicated the production of cellulase.

As shown in FIG. 4, bacillus marinus can secrete cellulase, and has good capability of hydrolyzing cellulose, and the diameter of the hydrolysis ring reaches 22.5mm.

Performance test 4

The inorganic phosphorus dissolving capacity of the bacillus marinus obtained by separation and identification in example 1 is determined by the following specific steps:

scraping the bacterial lawn of the Bacillus marinus on a ring of LB solid plate, inoculating the bacterial lawn into a solid phosphorus-dissolving culture medium, and observing whether a dissolving ring appears, wherein the result of a graph 5 shows that the bacterial strain has the capability of dissolving inorganic phosphorus, and the diameter of the dissolving ring for dissolving the inorganic phosphorus reaches 16.8mm.

After the bacillus marinus strain is determined to have the function of dissolving inorganic phosphorus, the activated phosphorus of the strain is quantitatively determined. Scraping the bacterial lawn of the Bacillus intermedius on a ring of LB solid plate, inoculating the bacterial lawn on a liquid phosphorus-dissolved culture medium, shaking and culturing for 7 days at 28 ℃, and measuring the effective phosphorus content in the fermentation supernatant by a molybdenum-antimony colorimetric method. Taking 100 mu L of supernatant, putting the supernatant into a 50mL volumetric flask, diluting the supernatant to about 30mL by using distilled water, adding 2 drops of dinitrophenol indicator, dropwise adding 4mol/L sodium hydroxide solution until the solution just turns yellow, then adding 1 drop of 1mol/L sulfuric acid solution to make the yellow of the solution just fade, adding 5.00mL of molybdenum-antimony anti-color-developing agent, fixing the volume by using distilled water, fully shaking the solution uniformly, standing the solution at 25 ℃ for 30min, and then measuring the phosphorus content by using a spectrophotometer at the wavelength of 660 nm.

The determination proves that the inorganic phosphorus dissolving capacity of the Bacillus marinus reaches 112.27mg/L.

Performance test 5

The inorganic potassium dissolving capacity of the bacillus marinus obtained in the separation and identification in the example 1 is determined by the following specific steps:

scraping the thallus Porphyrae of the Bacillus licheniformis on a ring of LB solid plate, inoculating the thallus Porphyrae into a potassium-dissolving culture medium, and observing whether the Bacillus licheniformis grows and the colony morphology of the Bacillus licheniformis.

FIG. 6 shows the results that the Bacillus marinus provided herein was able to grow and form transparent oil droplet-like colonies on potassium lysis medium, indicating that the Bacillus marinus provided herein has the ability to solubilize inorganic potassium.

Example 2

The embodiment provides a fermentation liquid of Bacillus marinus, which is prepared by the following specific steps:

(1) Activating strains: and (3) streaking and inoculating the preserved Bacillus marinus on an LB solid culture medium plate, culturing for 24h at 28 ℃, selecting a single colony, streaking and transferring to the LB solid culture medium plate again, and culturing for 24h at 28 ℃.

(2) Preparing a first-level seed solution: scraping the bacterial lawn of the activated Bacillus marinus in the two-ring step (1), inoculating the bacterial lawn in an LB liquid culture medium, culturing at 37 ℃ and 120-160rpm in a shaking flask for 20h to obtain a first-stage seed solution.

(3) Preparing a secondary seed liquid: inoculating the primary seed solution into a fermentation tank filled with LB liquid culture medium according to the proportion of 5% (v: v) for fermentation culture at the rotation speed of 150-200rpm, the temperature of 37 ℃, the aeration rate of 1.8-1 and the irrigation pressure of 0.04-0.06MPa, and culturing for 12h to obtain a secondary seed solution.

(4) And (3) fermentation liquor culture: inoculating the secondary seed liquid into a fermentation tank filled with a fermentation culture medium according to the proportion of 5% (v: v) for fermentation culture at the rotation speed of 160-180rpm, the temperature of 37 ℃, the aeration amount of 1.8-1, the filling pressure of 0.04-0.06MPa and the culture time of 20h, and obtaining the fermentation liquid of the Bacillus marinus.

Example 3

This example provides a liquid microbial inoculum of bacillus marinus, and the fermentation broth in example 2 is directly used as the liquid microbial inoculum of this example.

Example 4

The embodiment provides a solid microbial inoculum of bacillus marinus, which comprises the following specific preparation steps:

(1) And (3) collecting thalli: and (3) filtering the fermentation liquor provided in the embodiment 2 by using a ceramic membrane, reserving the thallus, removing part of the fermentation liquor, and concentrating the fermentation liquor by 5 times to obtain a fermentation concentrated solution rich in the thallus of the Bacillus marinus.

(2) Preparing a powder microbial inoculum: slowly adding diatomite into the fermentation concentrated solution to serve as a carrier substrate, wherein the adding amount of the diatomite is 10% of the weight of the fermentation concentrated solution, and uniformly stirring to obtain a mixture of the fermentation concentrated solution and the diatomite. And (3) spray-drying the mixture, dispersing by an atomizer at about 65 ℃ and quickly evaporating to dryness by high-temperature air at 180 ℃, and collecting by a cyclone separator to obtain the bacillus marinus powder microbial inoculum.

(3) Coating a film: the rotating speed of the coating barrel is set to be 50rpm, humic acid particles with organic matters of more than or equal to 60% are added, composite adhesive liquid is sprayed according to 5% of the addition amount of per ton of humic acid, and a powdery microbial inoculum is coated according to 0.5% of the addition amount of per ton of humic acid, so that a solid microbial inoculum of bacillus marinus is obtained, wherein the effective viable count of the solid microbial inoculum provided by the embodiment is more than or equal to 2.0 hundred million/g.

Example 5

The embodiment provides a case of applying the solid microbial inoculum in embodiment 4 to eggplant cultivation, and the cultivation site of the embodiment is arranged in Beijing Pinggu, and the specific operations are as follows:

(1) Preparing a fertilizer: mixing solid microbial agent and compound fertilizer (15-15-15, ames biotechnology limited of Beijing century, N + P) ₂ O ₅ +K ₂ O, total nutrient is more than or equal to 45%) according to the weight ratio of 1:0.5 to obtain the mixed fertilizer.

(2) Fertilizer application: randomly selecting 3 blocks with the area of 30m ² Test field of (1), according to 100kg/667m ² Fertilizers were applied to the plots at 4.5kg per plot.

(3) Eggplant cultivation: culturing eggplant with matrix, transplanting seedling after 30 days, planting in single row with row spacing of 50 cm and plant spacing of 40 cm, watering and spraying pesticide according to conventional agricultural management, topdressing for 1 time in young fruit stage, each time 10kg/667m ² Applying additional fertilizer for 3 times in the fruit picking period, each time 15kg/667m ² (the additional fertilizer adopts 16-6-23, N + P of Ames biotechnology Limited in Beijing century ₂ O ₅ +K ₂ O, total nutrient is more than or equal to 45％)。

Example 6

The embodiment provides a case of applying the solid microbial inoculum in the embodiment 4 to eggplant cultivation, and the difference from the embodiment 5 is that in the fertilizer of the embodiment, the mixing ratio of the solid microbial inoculum to the compound fertilizer is 1.

Example 7

The present example provides a case of using the solid microbial inoculum in example 4 for eggplant cultivation, and is different from example 5 in that in the fertilizer of the present example, the mixing ratio of the solid microbial inoculum to the compound fertilizer is 1:1.5 the rest of the operations are the same.

Comparative example 1

The comparative example provides a case of eggplant cultivation, and is different from example 6 in that the fertilizer of the comparative example only contains compound fertilizer, 2.25kg of the compound fertilizer is applied to each test field, and the rest operations are completely the same.

Comparative example 2

The comparative example provides a case of eggplant cultivation, and is different from the example 6 in that humic acid particles with equal weight organic matter of more than or equal to 60 percent are used for replacing a solid microbial inoculum, and the rest operations are completely the same.

Performance test 6

The average plant height and stem thickness, the weight per fruit and the yield data of the eggplants obtained by the cultivation of the examples 5-7 and the comparative examples 1-2 are counted by taking the cases provided by the examples 5-7 and the comparative examples 1-2 as detection objects, and the results are shown in table 3:

TABLE 3 growth and yield of eggplant obtained by cultivation in examples 5-7 and comparative examples 1-2

Examples/comparative examples	Plant height (cm)	Stem diameter (cm)	Weight of single fruit (g)	Yield (kg/mu)
					Example 5	52.69	1.87	622.15	4637.54
Example 6	54.34	1.95	637.16	4758.29
					Example 7	51.01	1.85	618.59	4521.36
Comparative example 1	45.23	1.69	573.48	4062.77
					Comparative example 2	46.67	1.76	576.27	4123.38

The fertilizer in the comparative example 1 only contains the compound fertilizer, and the application amount of the fertilizer is 2.25kg, which is equivalent to that in the comparative example 1, only 2.25kg of the compound fertilizer is applied to the soil; the fertilizer in example 6 is prepared by mixing a solid microbial inoculum and a compound fertilizer according to a ratio of 1. As shown in Table 3, the plant height of example 6 was increased by 20.14% as compared with comparative example 1, the stem thickness was increased by 15.38% as compared with comparative example 1, the fruit weight per unit was increased by 11.10% as compared with comparative example 1, and the yield was increased by 17.12% as compared with comparative example 1. The solid microbial inoculum provided by the application can promote the growth of crops and improve the yield.

Comparative example 2 the solid microbial inoculum in example 6 was replaced by equal weight of humic acid, and comparative example 2 differs from example 6 in whether the fertilizer contains Bacillus marinus. As shown in fig. 7, the eggplant of example 6 had better plant growth and fruit quality than those of comparative example 2. As shown in Table 3, the plant height of example 6 was increased by 16.43% as compared with comparative example 2, and the stem thickness was increased by 10.80% as compared with comparative example 2, which indicates that the application of Bacillus marinus to soil can increase the plant height and stem thickness of eggplant and significantly promote the growth vigor of crops; the fruit weight of the eggplant of example 6 was increased by 10.57% compared with comparative example 2, and the yield was increased by 15.40% compared with comparative example 2, indicating that bacillus marinus could also significantly increase the fruit weight and yield of the eggplant. The application provides a Bacillus marinus can promote crops root system growth and to the absorption of nutrient, and then promotes the growth vigor of crops to promote the output of crops, thereby increase the planting benefit of crops.

The difference between examples 5-7 is that the ratio of solid microbial inoculum to compound fertilizer in the fertilizer, as shown in table 3, is improved in the plant height, stem thickness, weight per fruit and yield data of eggplant in example 6 compared with those in examples 5 and 7. The content of the solid microbial inoculum and the compound fertilizer in the fertilizer is shown to be 1.

The present embodiment is only for explaining the present application, and it is not limited to the present application, and those skilled in the art can make modifications of the present embodiment without inventive contribution as needed after reading the present specification, but all of them are protected by patent law within the scope of the claims of the present application.

Claims

1. The Bacillus marinus is characterized in that the preservation number is CGMCC NO.25168.

2. The Bacillus marinus according to claim 1, wherein the Bacillus marinus is initially oily on LB solid medium, smooth on edges, and non-wrinkled; the later period is light white, the edge is irregular, and the folds are obvious.

3. The Bacillus marinus according to claim 1, wherein the Bacillus marinus has functions of indoleacetic acid production, protease production, cellulase production, inorganic phosphorus solubilization, and inorganic potassium solubilization.

4. The Bacillus marinus as claimed in claim 3, wherein the Bacillus marinus produces greater than 20 μ g/mL of indoleacetic acid in LB liquid medium.

5. A fermentation broth obtained from the Bacillus marinus of claim 1.

6. A microbial preparation comprising the Bacillus marinus of claim 1 or the fermentation broth of claim 5.

7. The microbial inoculum according to claim 6, which is in the form of a liquid microbial inoculum or a solid microbial inoculum.

8. A fertilizer, which is characterized by comprising a compound fertilizer and the microbial inoculum according to claim 6.

9. The fertilizer as claimed in claim 8, wherein the ratio of the contents of said microbial inoculum and said compound fertilizer in said fertilizer is 1 (0.5-1.5).

10. The microbial inoculum of claim 6 and the fertilizer of claim 8 are applied to high-yield planting of crops.