CN114410526A

CN114410526A - Bacillus licheniformis XNRB-3 and application thereof

Info

Publication number: CN114410526A
Application number: CN202210077761.1A
Authority: CN
Inventors: 尹承苗; 段亚楠; 毛志泉; 刘鑫; 吕毅; 陈学森; 沈向
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2022-01-24
Filing date: 2022-01-24
Publication date: 2022-04-29
Anticipated expiration: 2042-01-24
Also published as: CN114410526B

Abstract

The invention discloses bacillus licheniformis XNRB-3 and application thereof, belonging to the technical field of agricultural microorganisms. The biological preservation number of the strain is as follows: CGMCC NO. 15308. The strain provided by the invention has the functions of degrading phenolic acid substances such as phlorizin and the like and antagonizing pathogenic bacteria, and fermentation metabolites of the strain contain antifungal active substances and substances for promoting plant growth, wherein alpha-bisabolol and 2, 4-di-tert-butylphenol have obvious inhibition effects on a plurality of pathogenic fungi, and succinic acid, monomethyl ester and dibutyl phthalate can promote root elongation and lateral root development of arabidopsis thaliana. The strain can also produce protease, cellulase, chitosanase, beta-1, 3-glucanase and the like; secretes siderophore and auxin and has certain capacities of dissolving phosphorus, dissolving potassium and fixing nitrogen. In pot culture and field experiments, the addition of the strain XNRB-3 obviously promotes the growth of apple rootstock Malus hupehensis Rehd seedlings and two-year-old apple saplings.

Description

Bacillus licheniformis XNRB-3 and application thereof

Technical Field

The invention relates to the technical field of agricultural microorganisms, and particularly relates to bacillus licheniformis XNRB-3 and application thereof.

Background

Apple Replant Disease (ARD) is a soil disease caused by both biotic and abiotic factors. It occurs in major apple growing areas around the world, and poses a significant threat to the development of the apple industry. More and more studies have shown that biological factors are the main causes of ARD, mainly including: nematodes, fungi (Rhizoctonia solani, Fusarium, Alternaria and Bacillus), oomycetes (Pythium, Phytophthora). Abiotic factors may also play an important role in continuous cropping disorders, such as soil physicochemical properties, nutrient elements, accumulation of phenolic compounds or phytotoxins in disease roots.

Previous studies have shown that fusarium is one of the major pathogens responsible for the development of ARD in china, south africa and italy. Currently, chemical fumigants and soil disinfection are effective means of controlling ARD. However, methyl bromide is now increasingly being restricted in use due to environmental pollution and related health threats. The use of biological control agents is considered an ecological, friendly sustainable method of reducing the effects of plant diseases. Plant Growth Promoting Rhizobacteria (PGPR) are a class of bacteria that colonize the roots of plants and promote their growth and development. Many different bacterial species, such as Bacillus, Klebsiella and Pseudomonas, can colonize different speciesThe plant organ of (1). These bacteria can stimulate plant growth, increase yield, reduce pathogenic infection, and reduce biotic or abiotic plant stress under a wide range of environmental conditions, making them the best candidates for biocontrol agents because they are effective in controlling many different plant diseases. Bacteria of the genus bacillus produce spores that are heat-resistant and desiccation-resistant and are therefore more suitable for use as a biological bactericide. Biological control agents control harmful microorganisms such as plant pathogens by producing antibiotics, antifungal metabolites, and various cell wall degrading enzymes. In addition to antifungal activity, N can also be fixed₂Promoting plant growth, dissolving insoluble phosphorus, and producing siderophores, phytohormones (such as IAA) and Volatile Organic Compounds (VOCs) to induce systemic disease resistance. 2-nonanone and 2-heptanone produced by bacillus amyloliquefaciens L3 separated from watermelon rhizosphere have strong antifungal performance on Fusarium Oxysporum (FON), and volatile organic compounds acetone and 2, 3-butanediol produced by the bacillus amyloliquefaciens can also promote plant growth. The Marques et al study found that all isolated bacteria produced indole acetic acid, hydrogen cyanide and ammonia when tested in vitro for their Plant Growth Promoting (PGP) ability. Azabou et al isolate a B.velezensis OEE1 with strong control effect on verticillium wilt from root tissue, and can significantly reduce the final average disease severity index (FMS), Percentage of Dead Plants (PDP) and area under the disease progression curve (AUDPC).

However, there are relatively few bacillus biocontrol agents available for controlling ARD. Therefore, more research on biocontrol agents is required to expand the range of ARD biocontrol agents.

Disclosure of Invention

Aiming at the prior art, the invention aims to provide a bacillus licheniformis XNRB-3 and application thereof in ARD biological control. The strain has obvious antagonism to fusarium oxysporum, fusarium verticilliculatum, fusarium laminarinum and fusarium solani; has degradation effect on phenolic acid substances such as phlorizin and the like which cause apple continuous cropping obstacles; the growth of the continuous cropping apple saplings can be promoted; can effectively prevent, control and relieve the problem of continuous cropping obstacles of apples.

Specifically, the invention relates to the following technical scheme:

the first aspect of the invention provides Bacillus licheniformis (Bacillus licheniformis) XNRB-3, which has been preserved in China general microbiological culture Collection center (CGMCC for short, with the address of No. 3 Hospital No.1 Xilu on the sunward area in Beijing) in 1 month and 25 days in 2018, and the biological preservation number is as follows: CGMCC NO. 15308.

The Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is separated from the root system of a healthy fruit tree in a continuous cropping apple orchard, and has the following characteristics:

culturing on LB plate culture medium at 37 deg.C for 24h, the colony surface is white, the edge is irregular, the surface is from flat to convex, smooth and opaque. The colonies grow in liquid media to form biofilms. Single bacteria were long-rod shaped when observed under a fluorescent microscope (100 ×/1.30 oil-scope); oval spores (0.5-0.7X 1.0-1.4 μm), mid-term or subterminal, gram-positive, are formed. The SU-8010 scanning electron microscope shows that the single bacterium is rod-shaped, and has blunt ends at two ends and no flagella; bacteria are grown singly, in pairs or in chains; they have a size of (0.1 to 0.8) μm x (1.5 to 3.5) μm.

The microbial inoculum containing the Bacillus licheniformis (XNRB-3) also belongs to the protection scope of the invention.

In the microbial inoculum, Bacillus licheniformis (Bacillus licheniformis) XNRB-3 can exist in the form of cultured live bacteria, fermentation liquor, bacterial suspension, cell-free culture filtrate or extracellular metabolites.

Preferably, the fermentation broth of Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is prepared by the following method:

inoculating Bacillus licheniformis (Bacillus licheniformis) XNRB-3 into liquid fermentation culture medium, and culturing at 33 deg.C and 191rpm for 2-4 days;

the liquid fermentation medium comprises the following components: 21.03g/L of cane sugar and 8.54g/L, MgSO of beef extract₄ 1.0g/L、K₂HPO₄ 1.5g/L、KCl 1.0g/L；pH 7.5。

Preferably, the bacterial suspension of the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is prepared by the following method:

after the fermentation liquor of Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is centrifuged, the bacterial precipitation is resuspended by sterile water to obtain bacterial suspension.

Preferably, the cell-free culture filtrate of Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is prepared by the following method:

centrifuging fermentation liquor of Bacillus licheniformis (Bacillus licheniformis) XNRB-3, taking supernatant, and filtering to obtain cell-free culture filtrate.

Preferably, the extracellular metabolite of Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is prepared by the following method:

extracting fermentation supernatant of Bacillus licheniformis (Bacillus licheniformis) XNRB-3 with ethyl acetate, and concentrating to obtain crude extract; the crude extract was dissolved in methanol.

Further, the microbial inoculum not only contains Bacillus licheniformis (Bacillus licheniformis) XNRB-3, but also can contain an agriculturally and pharmaceutically acceptable auxiliary material, and the agriculturally and pharmaceutically acceptable auxiliary material is selected from one or more of a dispersing agent, a wetting agent, a disintegrating agent, a binder and an antifoaming agent. The sources of the agriculturally and pharmaceutically acceptable auxiliary materials are not particularly limited, and the agriculturally and pharmaceutically acceptable auxiliary materials are generally commercially available products.

The formulation of the microbial inoculum can be wettable powder, water dispersant, water suspending agent or dispersible oil suspending agent.

In a second aspect of the present invention, there is provided a use of the above-mentioned Bacillus licheniformis (Bacillus licheniformis) XNRB-3 or a Bacillus licheniformis (Bacillus licheniformis) XNRB-3-containing microbial agent in at least one of the following (1) to (6):

(1) inhibiting the growth of plant pathogenic bacteria;

(2) preparing a product for inhibiting phytopathogens;

(3) preventing and controlling diseases caused by plant pathogenic bacteria;

(4) preparing a product for preventing and treating diseases caused by phytopathogens;

(5) degrading phenolic acid substances;

(6) preparing the product for degrading phenolic acid substances.

Preferably, the phytopathogen is one or more of Fusarium oxysporum (Fusarium oxysporum), Fusarium verticillium (Fusarium verticillioides), Fusarium solani apple specialization MR5(Fusarium proliferatium f.sp.malus domestica), Fusarium solani (Fusarium solani), Phytophthora parasitica (Phytophthora), Rhizoctonia solani (Rhizoctonia solani), Alternaria alternata (Alternaria alternata) and apple canker (Valsa mali).

Preferably, the phenolic acid substance is one or more of phlorizin, benzoic acid, ferulic acid, vanillic acid, gallic acid and phloretin.

In a third aspect of the present invention, there is provided a use of Bacillus licheniformis (XNRB-3) in at least one of the following (1) to (7):

(1) dissolving phosphate and potassium;

(2) fixing nitrogen;

(3) producing IAA, GA and ABA;

(4) production of ACC deaminase, ammonia and amylase;

(5) producing a siderophore;

(6) producing cellulase, pectinase, beta-1, 3-glucanase, chitosanase and protease;

(7) producing an antifungal active substance.

Preferably, the antifungal active substances are alpha-bisabolol and 2, 4-di-tert-butylphenol.

In a fourth aspect of the present invention, there is provided a use of the above-mentioned Bacillus licheniformis (Bacillus licheniformis) XNRB-3 or a Bacillus licheniformis (Bacillus licheniformis) XNRB-3-containing microbial agent in (1) or (2) below:

(1) reducing apple continuous cropping obstacles;

(2) preparing a biocontrol agent or bacterial manure for relieving continuous cropping obstacles of apple trees.

In a fifth aspect of the present invention, there is provided a use of the above-mentioned Bacillus licheniformis (Bacillus licheniformis) XNRB-3 or a Bacillus licheniformis (Bacillus licheniformis) XNRB-3-containing microbial agent in at least one of the following (1) to (4):

(1) promoting the growth of the overground part and the underground part of the continuous cropping apple seedlings/young trees;

(2) inhibiting the growth of pathogenic bacteria causing apple continuous cropping obstacles in soil;

(3) improving the ratio of bacteria to fungi in the continuous cropping soil;

(4) improving the activity of soil urease, phosphatase, sucrase and catalase in the apple continuous cropping soil.

In a sixth aspect of the present invention, there is provided a method for alleviating apple continuous cropping obstacles, comprising the steps of:

the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 or the microbial inoculum containing the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is applied to the apple continuous cropping soil.

The invention has the beneficial effects that:

according to the invention, a strain of Bacillus licheniformis (XNRB-3) is separated from the healthy fruit tree root system of the continuous cropping apple orchard for the first time, and the strain has an inhibiting effect on various pathogenic bacteria, and particularly has a very strong antagonistic effect on Fusarium oxysporum, Fusarium verticillatum, Fusarium supernatum and Fusarium solani which cause apple continuous cropping obstacles; the strain has a degradation effect on phenolic acid substances causing apple continuous cropping obstacles. The strain can also promote the growth of continuous cropping apple seedlings/saplings; has excellent effect on relieving apple continuous cropping obstacles, and can be used for preventing and treating apple continuous cropping obstacles.

Drawings

FIG. 1: the strain XNRB-3 is cultured for 24h (A) at 37 ℃ on an LB plate culture medium, and the morphological characteristics of cells are observed by a Nikon fluorescence microscope BX-51(B-C) and an SU-8010 scanning electron microscope D-I. Note: a is single colony morphology; B-C is the shape and size of the bacteria under the microscope, bar is 100 x/1.30 oil mirror; D-I is the shape and size of the bacteria under an electron microscope.

FIG. 2: strain XNRB-3 is a phylogenetic tree based on the 16S rDNA, gyrA, gyrB and rpoB sequences. The right side of the tree provides the branch number and latin names, which are referenced when dealing with species. The combined sequence data set included 35 intraclass groups, with paenibacillus polymyxa BLB267 being an extragroup group.

FIG. 3: biolog physiological and biochemical identification results of the XNRB-3 strain.

FIG. 4: growth curve of XNRB-3 strain under optimal liquid fermentation conditions.

FIG. 5: inhibition rate of strain XNRB-3 on plant pathogenic fungi. Lower case letters on the columns indicate that the difference is significant when p < 0.05. The V values are mean. + -. SD.

FIG. 6: the bacterial strain XNRB-3 has bacteriostatic activity on fusarium oxysporum. A-D are normal hyphae and spores of Fusarium oxysporum, and E-L are Fusarium oxysporum hyphae treated by strain XNRB-3 fermentation broth.

FIG. 7: effect of different treatments on germination of four fusarium spores.

FIG. 8: effect of different treatments on germination rate of fusarium spores. Lower case letters on the columns indicate that the difference is significant when p < 0.05. The V values are mean. + -. SD.

FIG. 9: growth of Strain XNRB-3 on phlorizin mineral salts media of different concentrations. A: control, B-D: 1mmol/L, E-G: 2mmol/L, H-J: 3mmol/L, K: 4mmol/L, L: 5 mmol/L.

FIG. 10: phlorizin standard curve. The ordinate is the absorbance value and the abscissa is the phlorizin concentration.

FIG. 11: the degradation of phlorizin was treated differently. The ordinate is the phlorizin concentration and the abscissa is the inoculation time.

FIG. 12: strain XNRB-3 has a variety of plant growth promoting activities. A: phosphate dissolution, B: potassium dissolution, C: nitrogen fixation, D: chitinase lytic activity, E: siderophore production, F: ammonia production, G: pectinase activity, H: amylase production, I: cellulose activity, J: β 1, 3-glucanase activity, K: protease activity, L: a chitosan enzyme activity.

FIG. 13: strain XNRB-3 produces IAA.

FIG. 14: GC-MS identification of extracellular metabolites.

FIG. 15: 2, 4-di-tert-butylphenol with different concentrations has the function of inhibiting the growth of plant fungi pathogenic bacteria on a PDA culture medium.

FIG. 16: inhibition of growth of plant fungal pathogens on PDA medium by various concentrations of alpha-bisabolol.

FIG. 17: the pure compound has the effect of promoting the growth of Arabidopsis thaliana Col-0. Wa water, En ethanol, A2, 3-butanediol (100. mu.g), B1, 2-phthalic acid, bis (1-methylethyl) ester (100. mu.g), C2, 4-di-tert-butylphenol (500. mu.g), D monomethyl succinate (500. mu.g), E α -bisabolol (500. mu.g), F acetoin (500. mu.g), G dibutyl phthalate (500. mu.g), H3-nonen-2-one (500. mu.g), I benzoic acid, 3, 4-dimethyl-methyl ester (100. mu.g).

FIG. 18: influence of different treatments on the biomass of the seedlings of the Malus hupehensis Rehd, A: plant height, B: ground diameter, C: fresh weight, D: dry weight. Lower case letters on the columns indicate that the difference is significant when p < 0.05. The V values are mean. + -. SD. CK 1: 31-year orchard soil, CK 2: methyl bromide fumigation, T1: fertilizer carrier, T2: XNRB-3 bacterial fertilizer.

FIG. 19: the biomass of the apple saplings treated differently includes plant height (C), ground diameter (D), branch number (E) and average branch length (F). (A) The growth condition of apple saplings is treated differently in 7 months in 2020; (B) the growth of apple saplings is treated differently in 10 months in 2021. A1-A3: CK128 year orchard soil, C1-C3: CK2 methyl bromide fumigation, B1-B3: T1 fertilizer carrier, D1-D3: T2 XNRB-3 bacterial fertilizer. Lower case letters on the columns indicate that the difference is significant when p < 0.05. V value is mean value. + -. SD

FIG. 20: a: effect of different treatments on soil phenolic acids in 7 months of 2020; b: effect of different treatments on soil phenolic acids at 10 months 2021; C-F: influence of the strain XNRB-3 on the rhizosphere microorganism quantity of the apple saplings; G-J: the effect of different treatments on soil enzyme activity; K-N: real-time qPCR analyzed the effect of different treatments on the copy number of the four fusarium genes. CK 1: 28-year orchard soil, CK 2: methyl bromide fumigation, T1: fertilizer carrier, T2: XNRB-3 bacterial fertilizer. Lower case letters on the columns indicate that the difference is significant when p < 0.05. The V values are mean. + -. SD.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As previously mentioned, there are relatively few bacillus biocontrol agents available for the control of ARD. Based on the method, a Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is separated from a healthy fruit tree root system. Compared with the existing reported Bacillus licheniformis, the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 has the following outstanding advantages:

(1) the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is a root endophytic strain, and has natural colonization advantage when being applied to continuous cropping prevention of fruit trees.

(2) The Bacillus licheniformis (Bacillus licheniformis) XNRB-3 integrates multiple functions and has the functions of degrading phenolic acid substances such as phlorizin and the like and antagonizing pathogenic bacteria; the fermentation metabolites contain antifungal active substances and substances for promoting plant growth, wherein alpha-bisabolol and 2, 4-di-tert-butylphenol have remarkable inhibitory action on a plurality of pathogenic fungi, and succinic acid, monomethyl ester and dibutyl phthalate can promote root elongation and lateral root development of arabidopsis thaliana. The strain can also produce protease, cellulase, chitosanase, beta-1, 3-glucanase and the like; secretes siderophore and auxin and has certain capacities of dissolving phosphorus, dissolving potassium and fixing nitrogen. In pot culture and field experiments, the addition of the strain XNRB-3 obviously promotes the growth of apple rootstock Malus hupehensis Rehd seedlings and two-year-old apple saplings.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments. If the experimental conditions not specified in the examples are specified, the conditions are generally conventional or recommended by the reagent company; reagents, consumables, and the like used in the following examples are commercially available unless otherwise specified. Wherein:

fermentation medium: 20.0g of cane sugar, 15.0g of yeast extract and MnSO₄ 1.0g，NaH₂PO₄.2H₂O 2.0g，Na₂HPO₄.2H₂O4.0 g, and 1000mL of distilled water.

An oxygen demand determination culture medium, a glucose oxidation fermentation culture medium, a starch hydrolysis culture medium, a nitrate reduction culture medium, a V-P culture medium and an M.R. culture medium are prepared according to a method of a common bacteria system identification manual (Dongxu pearl, Chuia Miaoying editions).

The ARD-specialized Fusarium proliferatum (Fusarium proliferatum) MR5, which is also called "Fusarium laminarum" by classification and designation, and the MR5 strain is deposited in the common microorganism center of the china committee for culture collection management of microorganisms with the collection number: CGMCC NO.22426, which has a preservation time of 2021, 5 months and 17 days, is described in patent CN113817613A and patent CN 113881573A. The strain MR5 is pathogenic only to apple rootstock, and belongs to apple specialization.

Compounds of phlorizin, Cinnamic Acid (CA), Ferulic Acid (FA), Benzoic Acid (BA) and p-hydroxybenzoic acid (PHBA) were purchased from Sigma.

Example 1: isolation and characterization of strains

1. Separating and purifying the strains:

an improved root-sticking segment method is adopted to select the root system of healthy and vigorous apples from re-planted orchards in Shanxi and jin cities to immediately separate and screen endogenous antagonistic bacteria. Washing root with tap water for 5min to remove adhered soil particles, soaking in 75% ethanol for 2min for surface sterilization, washing with sterile water for 3 times, soaking in 5% sodium hypochlorite solution for 5min, and washing with sterile water for 5 times. After appropriate drying, the surface sterilized roots were cut into 1cm root sections and transferred to LB medium to isolate the endophytic bacteria, four per dish, and the dishes were kept at 37 ℃ for one week. In addition, sterile water for washing the roots for the last time is spread on the same culture medium and placed under the same environment for culture, and whether the roots are completely disinfected or not is confirmed. The results show that no mixed bacteria are generated on the coated plate, and after single bacteria grow in the plate, single bacteria colonies with different forms are picked and streaked on a new LB plate for purification. Meanwhile, the purified strain was inoculated in liquid LB medium, constantly shaken at 180rpm at 37 ℃ for 12h, centrifuged at 10000r at 4 ℃ for 10min, the supernatant was decanted, 15% glycerol was added, and the mixture was stored at-80 ℃.

2. Screening of strains:

the antagonism of the separated strain to four kinds of Fusarium (Fusarium oxysporum, Fusarium verticillium, ARD specialized Fusarium proliferatum (Fusarium oxysporum) MR5 and Fusarium solani) is determined by adopting a plate opposition method, namely, the bacteria are firstly streaked and inoculated on an LB plate, a single colony is selected and inoculated in a fermentation culture medium (100 mL is filled in a 250mL conical flask), the constant oscillation culture is carried out for 48h at the temperature of 28 ℃ and at the speed of 180rpm, then the bacteria are centrifuged for 20min at the speed of 10000r to obtain the bacteria, the bacteria are resuspended in a PBS buffer solution (pH 7.0, 1/25 volume, 10mmol/L)), the concentration is adjusted to be 1 × 10⁹CFU/mL. A5 mm diameter Fusarium cake was inoculated into the center of the PDA plate, 4 sterile filter paper discs (6 mm diameter) were placed equidistantly around the cake, 10. mu.L of bacterial suspension was dropped onto each filter paper disc, and the experiment was repeated three times with Sterile Distilled Water (SDW) as a control. All plates were incubated at 28 ℃ for 7 days, the width of the zone of inhibition was measured and the rate of inhibition was calculated. The calculation formula is as follows: inhibition rate ═ control colony radius-treated colony radius)/control colony radius × 100%.

Finally, a strain with the strongest bacteriostatic action is separated from the root system of healthy fruit trees planted in the re-planted orchard in the Shanxi province and the city, and the strain is named as the strain XNRB-3.

3. Classification and identification of the strain XNRB-3:

3.1 morphological and physiological biochemical identification:

the XNRB-3 strain is cultured on an LB plate medium at 37 ℃ for 24h, the colony surface is white, the edge is irregular, and the surface is smooth and opaque from flat to convex (figure 1A). The colonies grow in liquid media to form biofilms. Single bacteria were long-rod shaped when observed under a fluorescent microscope (100 ×/1.30 oil-scope); oval spores (0.5-0.7X 1.0-1.4 μm), mid-or subterminal, gram-positive (FIGS. 1B-C) were formed. The SU-8010 scanning electron microscope shows that the single bacterium is rod-shaped, and has blunt ends at two ends and no flagella; bacteria are grown singly, in pairs or in chains; they have a size of (0.1 to 0.8) μm x (1.5 to 3.5) μm (FIG. 1D-I).

The results of 14 physiological and biochemical index tests on the XNRB-3 strain are shown in Table 1.

Table 1: physiological and biochemical characteristics of XNRB-3 strains

Test index	Results	Test index	Results
				Reaction of hydrogen peroxide	+	Double hydrolysis reaction of arginine	_
Catalytic reaction	+	Sucrose fermentation reaction	+
				Starch hydrolyzing enzymes	+	Glucose fermentation reaction	_
Nitrate reductase	+	Methyl Red reaction	+
				Indole experiments	_	Voges-Proskauer reaction	+
Citric acid salt	_	Urease reaction	+
				Reaction of hydrogen sulfide	+	Gelatin hydrolase	+

Note: "+" indicates a positive reaction or availability; "-" indicates a negative reaction.

Physiological and biochemical experiments show that the strain XNRB-3 can generate hydrogen peroxide and hydrogen sulfide, hydrolyze starch, reduce nitrate and utilize sucrose. The catalase, the Voges-Proskauer reaction and the methylred reaction are positive, and the indolase, the arginine double hydrolysis reaction, the citrate enzyme and the glucose fermentation reaction are negative. According to Bergey's Manual of systematic bacteriology (second edition) and Manual of general bacteria identification, Strain XNRB-3 corresponds to the physiological and biochemical properties of Bacillus licheniformis (Table 1).

3.sequence analysis and phylogenetic analysis of 216S rDNA, gyrA, gyrB and rpoB fragments:

inoculating the XNRB-3 strain into a liquid LB culture medium, performing shake culture at the temperature of 30 ℃ at the speed of 200r/min for 12h, and extracting the whole genome DNA of the strain by adopting a bacterial genome extraction kit. Then, the bacterial XNRB-3 total DNA is used as a template, 16S rDNA gene, gyrA gene, gyrB gene and rpoB gene are adopted for PCR amplification, 1 percent agarose gel electrophoresis detection is carried out, and the DNA is sent to Shanghai biological engineering technology company Limited for sequencing.

The 16S rDNA gene amplification selects a universal primer 27F: 5'-AGAGTTTGATCCTGGCTCAG-3' and 1492R: 5'-GGTTACCTTGTTACGACTT-3' are provided. PCR reaction (50. mu.L): 3 mul of total DNA template, 1 mul of each primer, 1 mul of dNTP, 5 mul of 10x PCR buffer,taq DNA polymerase 0.6. mu.L, ddH₂O38.4. mu.L. PCR amplification reaction procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 deg.C for 1.5 min; annealing at 55 deg.C for 1 min; extending for 1.5min at 72 ℃; the total elongation is 72 ℃, 10min and the temperature is kept at 4 ℃ for 30 cycles.

Primers 42f: 5'-CAGTCAGGAAATGCGTACGTCCTT-3' and 1066r: 5'-CAAGGTAATGCTCCAGGCATTGCT-3' were selected for amplification of the gyrA gene. PCR reaction (30. mu.L): taq PCR Master Mix 15. mu.L, ddH₂O12. mu.L, primers 1. mu.L each, and DNA template 1. mu.L. And (3) PCR reaction system: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 deg.C for 1 min; annealing at 62 deg.C for 1 min; extending for 2min at 72 ℃; the total elongation is 72 ℃, 10min and the temperature is kept at 4 ℃ for 30 cycles.

Primers up1f: GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA and up2r: AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT are selected for amplification of gyrB gene. PCR reaction (30. mu.L): taq PCR Master Mix 15. mu.L, ddH₂O12. mu.L, primers 1. mu.L each, and DNA template 1. mu.L. PCR amplification reaction procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extending for 1min at 72 ℃; the total elongation is 72 ℃, 10min and the temperature is kept at 4 ℃ for 30 cycles.

Primers 2292F: AGGTCAACTAGTTCAGTATGGAC and 3354R: AAGAACCGTAACCGGCAACTT were used for rpoB gene amplification. PCR reaction (50. mu.L): 5 × PrimeSTAR Buffer (Mg)²⁺Plus)10μL，dNTP Mixture(2.5mM each)4μL，PrimeSTAR HS DNA Polymerase(2.5U/μL)0.5μL，ddH₂O31.5. mu.L, primers 1. mu.L each, and DNA template 2. mu.L. PCR amplification reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15 s; annealing at 56 ℃ for 30 s; extension at 72 ℃ for 30 s; the total elongation is 72 ℃, 10min and the temperature is kept at 4 ℃ for 30 cycles.

The sequencing results were submitted to GenBank of National Center for Biotechnology Information (NCBI) of the United states, the sequences of 16S rDNA, gyrA, gyrB and rpoB were aligned using the Maximum Likelihood (ML) method, and tree building analysis was performed using RAxML-HPC2 on CIPRRES website (http:// www.phylo.org). The treemaps are modified and refined in FigureTree v1.4.3 and Adobe Illustrator CS 6.

rpoB and gyrA were sequenced at 555-938 bases, 16S rDNA at 1455 bases, and gyrB at 1136 bases. Identity analysis showed no conflict between the 16S rDNA, gyrA, gyrB and rpoB sequences; thus, these sequences are combined. The maximum likelihood analysis based on the alignment of the four gene sequences showed that strain XNRB-3 has the highest homology to bacillus licheniformis (fig. 2). The strain XNRB-3 is identified to be Bacillus licheniformis (Bacillus licheniformis).

3.3 Biolog automatic analysis system for microorganisms:

the Biolog GEN III system is used for detecting absorbance change caused by the combination of a redox product generated by aerobic metabolism activity of bacteria by utilizing 95 carbon sources on a micropore plate and a chromogenic substance and turbidity difference caused by the growth of microorganisms, generating a characteristic fingerprint, and comparing the characteristic fingerprint with a standard strain spectrum database to identify strains. When the bacteria are cultured for 16-24 h, the SIM value is more than or equal to 0.50, the system automatically gives an identification result, and the closer the SIM value is to 1.00, the more accurate the identification result is.

By Biolog GEN III microplates^TMThe test on carbon source utilization and chemical sensitivity shows that the strain XNRB-3 can utilize 32 carbon sources such as dextrin, d-maltose, pentabiose and the like and is sensitive to the conditions of

pH value

6, 1% NaCl, 4% NaCl and 8% NaCl. Strain XNRB-3 belongs to bacillus licheniformis (b. licheniformis) and was identified based on carbon utilization (fig. 3). The PROB value is 0.689, the SIM value is 0.689, and the DIST value is 4.698, which shows that the matching result is reliable.

In conclusion, the isolated strain XNRB-3 was identified as Bacillus licheniformis (Bacillus licheniformis). And is preserved in the China general microbiological culture Collection center in 2018, 1 month and 25 days, with the preservation number: CGMCC No. 15308.

Example 2: strain XNRB-3 fermentation process optimization and fermentation related product preparation

1. Optimizing liquid fermentation conditions:

the determination of the thallus fermentation liquor adopts a turbidimetric method, namely 10-15 mL of fermentation liquor is centrifuged for 2min at 2000r/min, and the OD of the bacteria liquor is determined₆₀₀Values (absorbance of the solution at 600 nm), combined with the results of the one-way experiment, orthogonal experiment, Plackett Burman and Box Behnken in response surface analysis (RSM) to optimize the composition and development of Bacillus licheniformis XNRB-3 liquid fermentation MediumAnd (4) fermenting.

Through optimization, the optimal liquid fermentation conditions of the strain XNRB-3 are as follows:

composition of liquid fermentation medium: 21.03g/L of cane sugar and 8.54g/L, MgSO of beef extract₄ 1.0g/L、K₂HPO₄1.5g/L、KCl 1.0g/L；pH 7.5。

The fermentation process parameters are as follows: the temperature is 32.73 ℃, the rotating speed is 191.46, the inoculation amount is 5 percent, and the filling amount is 40 percent.

Determining OD of bacterial solution at different culture time under optimum liquid fermentation condition with CK as control₆₀₀Absorbance values (after dilution); by OD₆₀₀The absorbance values were plotted on the vertical axis and the incubation time on the horizontal axis, and a growth curve was plotted (FIG. 4).

2. Preparation of Strain XNRB-3 fermentation broth:

inoculating strain XNRB-3 into the optimized liquid fermentation medium (sucrose 21.03g/L, beef extract 8.54g/L, MgSO)₄ 1.0g/L、K₂HPO₄1.5g/L, KCl 1.0.0 g/L; pH 7.5), at 33 ℃, 191rpm for 3 days, to prepare strain XNRB-3 fermentation broth.

3. Preparation of cell-free culture solution of Strain XNRB-3:

bacterial strain XNRB-3 fermentation liquor is taken and centrifuged for 10 minutes at 13400g, and supernatant fluid is taken and filtered by a membrane with the diameter of 0.22 mu m to obtain cell-free culture filtrate.

4. Preparation of crude extract of Strain XNRB-3:

taking bacterial strain XNRB-3 fermentation liquor, centrifuging for 10 minutes at 13400g, and separating supernatant; extracting the supernatant with ethyl acetate, and concentrating to obtain crude extract.

Example 3: functional identification of strain XNRB-3 and fermentation related products

1. The bacterial strain XNRB-3 has broad-spectrum antibacterial effect:

in order to further verify whether the XNRB-3 strain has broad-spectrum antibacterial action on the plant-derived diseases, 4 other common pathogenic fungi are selected for further antibacterial test. The results are shown in FIG. 5.

The results of the confrontation tests show that the XNRB-3 strain has strong inhibition effect on the growth of 4 pathogenic fusarium hyphae. Has strong inhibiting effect on phytophthora, rhizoctonia solani, alternaria alternata and apple tree canker. Therefore, the strain XNRB-3 has broad-spectrum bacteriostatic action on plant pathogenic bacteria under the in-vitro culture dish test condition.

2. Effect of fermentation related products of strain XNRB-3 on germination of fusarium oxysporum spores:

the effect of fermentation-related products of strain XNRB-3 on germination of fusarium oxysporum spores was slightly modified with reference to the method of et al (2011). The following different treatments were set:

CK: mixing the fusarium oxysporum spore suspension with sterile water according to the volume ratio of 1: 1;

FB: mixing a fusarium oxysporum spore suspension with the strain XNRB-3 fermentation broth prepared in example 2 in a volume ratio of 1: 1;

CFCF: mixing a fusarium oxysporum spore suspension with the cell-free culture solution of the strain XNRB-3 prepared in example 2 in a volume ratio of 1: 1;

loud extract (CE): a suspension of Fusarium oxysporum spores was mixed with the crude extract of the strain XNRB-3 prepared in example 2 in a volume ratio of 1: 1.

Each treated mixture (approximately 50. mu.L) was placed on a microscope slide, placed on moist sterile filter paper in a petri dish, and stored at 20 ℃ for 24 h. Spore germination rates (200 spores per treatment) were determined using a Nikon BX-51 fluorescence microscope. Conidia are considered to have germinated when the germ tube length is at least equal to the diameter of the conidia. The experiment was repeated three times.

Microscopic morphological observation of hyphae and spores showed that the contrast Fusarium hyphae were uniform in thickness, less in branching, full in spores, complete in structure, and strong in growth (FIGS. 6A-D). Hyphae after the strain XNRB-3 fermentation liquor treatment are irregular and netted, uneven in thickness, shriveled (shown in figure 6G-L), thinned (shown in figure 6I, K) and broken (shown in figure 6I, G and H); spore cell wall disruption (fig. 6E, I, K, H); the hyphae dissolved and the cells had ruptured. The fermentation broth, cell-free culture filtrate and crude extract of strain XNRB-3 all significantly inhibited the germination of fusarium spores (fig. 7).

Further, the above-mentioned method was used to examine the influence of the fermentation broth, cell-free culture filtrate and crude extract of strain XNRB-3 on the germination rate of Fusarium verticillioides (Fusarium verticillioides), Fusarium solani apple specialization MR5(Fusarium proliferatum f.sp.malus domestica), Fusarium oxysporum (Fusarium oxysporum) and Fusarium solani (Fusarium solani) spores, and the results showed that: the spore germination rate decreased by more than 60% (fig. 8).

3. The strain XNRB-3 degrades phenolic acid substances:

microbial growth and phenolic acid degradation assays in MSM solution reference the procedure of Wang et al (2021) with some modifications. Mineral Salt Medium (MSM) (K) containing phlorizin (0-10 mmol/L) as sole carbon source₂HPO₄ 5.8g/L，(NH₄)₂SO₄ 2.0g/L，KH₂PO₄ 4.5g/L，CaCl₂ 0.02g/L，MgCl₂ 0.16g/L，FeCl₃ 0.0018g/L，Na₂MoO₄·2H₂O 0.0024g/L，MnCl₂·2H₂O0.0015 g/L; pH 7.0) was used to verify the ability of strain XNRB-3 to degrade phlorizin. The strain XNRB-3 is inoculated into MSM containing 0-10mmol/L phlorizin and cultured in the dark at 33 ℃ to determine the maximum tolerance of the phlorizin. The results show that: at a phlorizin concentration of 4mmol/L, the strain XNRB-3 had been growth-restricted, and at a content of 5mmol/L, growth was stopped, so that its maximum tolerated concentration was 4mmol/L (FIG. 9).

The absorbance value of the MSM solution was measured at each wavelength using phlorizin (10mmol/L) to determine the maximum absorbance wavelength of 280nm (Table 2), and a total of 11 MSM solutions with concentrations of 0 to 10mmol/L were prepared. MSM solution containing 0mmol/L phloretin was used as a reference solution for blank calibration. The absorbance value at 280nm was measured. The absorbance values were plotted as ordinate and the phlorizin concentration was plotted as abscissa, and a standard curve was plotted (fig. 10).

Table 2: absorbance values of 10mmol/L liquid phlorizin culture medium at different wavelengths

Strain XNRB-3 was inoculated into 6mL of liquid fermentation medium and then inoculated at 33The culture was carried out overnight at the temperature of ℃. After centrifugation at 2500g for 5min, the supernatant was discarded and ddH was used₂O diluting the bacterial pellet to OD₆₀₀A value of 1.0, resulting in a resuspended isolate; 0.1mL and 0.2mL of the resuspended isolate were transferred to 10mL of MSM solution containing phlorizin (3mmol/L) and incubated for 60h at 33 ℃ under shaking (191 rpm) in the dark, respectively. 1mL of bacterial suspension was extracted from each treatment, centrifuged at 13000g for 5min, and the supernatant was taken at OD₂₈₀And (5) detecting, and converting into phlorizin concentration according to a standard curve.

Phlorizin degradation rate ═ phlorizin concentration in the non-inoculated bacterial culture solution-phlorizin concentration in the inoculated bacterial culture solution)/phlorizin concentration in the non-inoculated bacterial culture solution ] × 100%.

The results show that: the utilization efficiency of the strain XNRB-3 on phlorizin in MSM solution is high (figure 11), after 60 hours of culture, the degradation rate is 60.75% when the inoculation amount is 1% (namely the transfer amount of the resuspension isolate is 0.1mL), and the degradation rate is 68.83% when the inoculation amount is 2%. With the increase of the inoculation amount, the degrading capability of the strain XNRB-3 on phlorizin is enhanced.

To test the ability of strain XNRB-3 to utilize other phenolic acids, strain XNRB-3 was inoculated into a MSM solution containing 0.5g/L CA, FA, BA or PHBA and tested for growth according to the method described previously, 0.2mL of the resuspension isolate was transferred to 10mL of MSM solution to which 0.5g L was added^-1CA, FA, BA or PHBA. After incubation at 33 ℃ for 12, 24, 36, 48 and 60 hours, shaking (190 rpm), 1mL of bacterial suspension was extracted from each treatment and centrifuged at 13000g for 5 min. With 1mL ddH₂O resuspending the particles to detect OD₆₀₀And the supernatant was mixed with an equal volume of methanol. 0.1mL of the mixed solution was added to 1.9mL of a 50% methanol solution, and subjected to high performance liquid chromatography analysis after filtration sterilization through a 0.22 μm pore size filter. Controls used phenolic acid MSM solution, but no bacteria, all assays were performed in 3 replicates.

The concentration of phenolic acids was determined according to peak area using an external standard using an UltiMate 3000HPLC system (Dionex, USA). All separations were performed

C₁₈Columns (4.6 mm. times.150 mm, 5.0 μm; Waters, Milford, Mass., U.S.A.). The mobile phase solutions were 0.1% formic acid + 2% methanol (a) and acetonitrile (B). The gradient elution used consisted of: 0min, 96% a plus 4% B for 10 min; 10% A plus 90% B for 16 min; 96% A plus 4% B for 30 min; the flow rate was 1.0mL/min, the injection amount was 10. mu.L, the column temperature was 20 ℃ and the ultraviolet detection wavelength was 280 nm.

The results show that: the strain XNRB-3 can effectively degrade CA, BA, FA and PHBA (table 3), and the degradation rate is 45.65-69.20%.

Table 3: degradation of Cinnamic Acid (CA), Ferulic Acid (FA), Benzoic Acid (BA) and p-hydroxybenzoic acid (PHBA) by the strain after 60 hours of culture.

Note: the lower case letters above the columns indicate a significant difference at p < 0.05. The V values are mean. + -. SD.

Strain XNRB-3 was also able to efficiently degrade phlorizin, CA, BA, FA and PHBA in the soil (Table 4). After 9 days of inoculation, the phlorizin content dropped to 2.9292 μ g/g. After 9 days of inoculation, the BA content and the PHBA content in the soil are respectively reduced to 18.4953 mu g/g and 5.2882 mu g/g. At 9d after treatment, the soil FA and CA concentrations dropped to 13.3669 and 0.3785. mu.g/g, respectively, which are only 13.31% and 3.63% of the controls.

Table 4: the bacterial strain XNRB-3 has the effect of degrading phenolic acid in soil; phlorizin, Cinnamic Acid (CA), Ferulic Acid (FA), Benzoic Acid (BA) and p-hydroxybenzoic acid (PHBA) (μ g/g) were added to the soil samples.

Note: the lower case letters above the columns indicate a significant difference at p < 0.05. Values are mean ± SD.

4. Other functions are as follows:

fermentation broth of Bacillus licheniformis XNRB-3 in 1Centrifuge at 3400g for 10 minutes. The supernatant (extracellular medium) was removed, frozen at 4 ℃ and used for amino acid analysis. Amino acids were pre-column derivatized with PITC and under optimal conditions (30 mM phosphate and 3mM beta-CD buffer run at pH 7.0; voltage 20kV) by Biochrom 30 coupled to a PA800 high Performance capillary electrophoresis System (HPCE) equipped with an on-column UV detection System⁺Amino acid was isolated and quantified by an amino acid analyzer. The capillary was a bare fused silica capillary with an inner diameter of 50 μm, an outer diameter of 375 μm and a diameter of 67cm (3 tubes per package). The individual amino acid concentration is calculated by comparing the peak area of a particular amino acid to a standard curve for that amino acid.

The HPCE method was used to identify 20 PITC-derived amino acids, with a total of 17 amino acids isolated, including aspartic acid (Asp), threonine (Thr), serine (Ser), glutamic acid (Glu), proline (Pro), glycine (Gly), alanine (Ala), cystine (Cys), valine (Val), methionine (Met), isoleucine (Ile), leucine (Leu), tyrosine (Tyr), phenylalanine (Phe), histidine (His), lysine (Lys) and arginine (Arg).

Phytohormones were extracted and quantified by gas chromatography-mass spectrometry/selective ion monitoring (GC-MS/SIM). The bacillus licheniformis XNRB-3 is cultured in an optimized liquid fermentation medium for 7 days. Seven days later, pure culture filtrate for growth of Bacillus licheniformis XNRB-3 was added using [ D5] -IAA, [2H2] GA, [ (+ -) -3, 5, 5, 7, 7, 7-D6] -ABA ] as an internal standard, extracted, and subjected to GC-MS/SIM measurement and quantification. In addition, GC/MS for quantitation was equipped with an HP-5 capillary column HP-5(30m long, 0.25mm internal diameter, 0.25 μm membrane, maximum temperature 325 ℃ C.) using He (99.999%) as carrier gas, an indenter pressure of 30kPa, a sample introduction temperature of 200 ℃ and an ionization voltage of 70 eV. And calculating the concentration of the phytohormone according to the ratio of the peak area of the sample to the corresponding internal standard substance.

The results show that: endophyte XNRB-3 has a variety of PGP properties, such as phosphate and potassium solubilization, nitrogen fixation, ACC deaminase, ammonia and amylase production; siderophores, cell wall degrading enzymes (cellulase, pectinase,. beta.1, 3-glucanase, chitosanase, and protease) (FIGS. 12A-L). Production of IAA, GA and ABA (figure 13, table 5).

TABLE 5 IAA, GA and ABA production levels of Strain XNRB-3

Example 4: isolation and identification of extracellular metabolites of strain XNRB-3

GC-MS identification of extracellular metabolites

The fermentation supernatant of strain XNRB-3 was extracted with ethyl acetate and then concentrated under reduced pressure using a rotary evaporator to obtain a crude extract. Adding a small amount of methanol to dissolve the extract, filtering with 0.22 μm filter membrane, and refrigerating at 4 deg.C. The compounds in the active extracts were identified by gas chromatography-mass spectrometry (GC-MS) and NIST17 database search. Gas chromatography-mass spectrometry was performed using a GCMSQP2010 Plus instrument. And calculating the relative content of each component by adopting a peak area normalization method. Chromatographic and mass spectrometric conditions the method of paragraph et al (2021) is referred to.

The main antibacterial substances with area% of >0.62 and retention index RI >700 were screened by GC-MS chromatographic detection (Table 6). The substances identified from the fractions were mainly organic acids and esters, alcohols, ketones, alkanes and phenols (fig. 14).

Table 6: GC-MS identification of extracellular metabolites

Of the 42 compounds identified, 16 pure compounds were purchased for separate antifungal performance tests, and the results showed that 9 pure compounds all exhibited antifungal activity against pathogenic fungi (table 7). Among them, 2, 4-di-tert-butylphenol and alpha-bisabolol have the strongest inhibitory action on plant pathogenic fungi, especially on Fusarium sp. At a concentration of 1000. mu.g/L, the inhibition was higher than 50% (FIG. 15, FIG. 16).

Table 7: inhibition of mycelial growth of plant fungal pathogens by pure compounds identified from Bacillus licheniformis XNRB3

Note: according to the Duncan test, there is no significant difference in the values in the columns followed by the same letter at P < 0.05. The V values are mean. + -. SD. -, no inhibitory effect on fungi. No measure of the diameter of the fungus.

The 9 pure compounds were diluted with alcohol separately and 20. mu.L of each suspension was applied to a sterile filter paper disc on the other side of a 9cm diameter bipartite culture plate. The fresh weight of Arabidopsis thaliana Col-0 seedlings was determined 10 days later.

Of these 9 pure compounds, succinic acid, monomethyl ester (500 μ g) and dibutyl phthalate (500 μ g) significantly enhanced the fresh weight and root growth of arabidopsis plants compared to controls (water and ethanol), followed by 2, 4-di-tert-butylphenol (500 μ g), α -bisabolol (500 μ g), 3-nonen-2-one (500 μ g), benzoic acid, 3, 4-dimethyl-methyl ester (100 μ g), 2, 3-butanediol (100 μ g) and acetoin (500 μ g) (fig. 17).

The above results show that: the strain XNRB-3 extracellular metabolite has obvious inhibition effect on various pathogenic bacteria; and has a promoting activity on plant growth, and can promote root elongation and lateral root development of Arabidopsis thaliana.

Example 6: pot culture test and field test

1. And (3) pot experiment design:

the potting test is carried out in the national apple engineering experiment center of the institute of horticultural science and engineering of Shandong agricultural university and the national key laboratory of crop biology. Potted plant test the test plants were seedlings of Malus hupehensis Rehd.

And 3, transplanting the seedlings into a nursery garden in 2017, and when the seedlings grow to a third true leaf, selecting the seedlings with the same growth vigor, transplanting the seedlings into a clay pot with the upper caliber of 38cm, the lower caliber of 28cm and the height of 26cm, and performing a potting test. Each pot contained approximately 7.543kg of soil, 3 seedlings of Malus hupehensis Rehd per pot, and 20 replicates per treatment set. When the seedlings grow to 20-30cm, two seedlings with similar growth vigor are left in each pot. The potting soil is treated as follows: soil in 31-year old orchards (CK1), soil in 31-year old orchards fumigated by methyl bromide (CK2), treated by bacterial manure carriers (T1), and treated by bacillus licheniformis XNRB-3 bacterial manure (T2); and each treatment group is uniformly managed with normal water and fertilizer, and the bacillus licheniformis XNRB-3 bacterial fertilizer and the bacterial fertilizer carrier are applied according to 1 percent of the soil mass.

The bacillus licheniformis XNRB-3 bacterial fertilizer used for the pot culture test is manufactured by microbial resource Limited of Chuangdi, Tex, China, and the manufacturing method comprises the following steps: firstly, carrying out liquid fermentation on the Bacillus licheniformis XNRB-3 strain (fermentation culture medium: 20.0g of sucrose, 15.0g of yeast extract and MnSO)₄ 1.0g，NaH₂PO₄.2H₂O 2.0g，Na₂HPO₄.2H₂O4.0 g and distilled water 1000mL) to obtain a liquid microbial inoculum; then mixing the liquid microbial inoculum and the sterilized bacterial fertilizer carrier according to the proportion of 1 ml: 10g of the mixture is uniformly mixed, so that the mixture of the liquid microbial inoculum and the carrier is fully wet (the humidity of 45 percent is the best), and the mixture is suitable for holding by hands without leaving watermarks; after being stirred uniformly, the mixture is put on a sunshade and covered with plastic cloth to be kept stand for 24 hours, and the temperature is kept at the best temperature of 35-38 ℃; after 24 hours, the mixture of the liquid microbial inoculum and the carrier is put into a sealed container and fermented for 15 days for use.

The prepared Bacillus licheniformis XNRB-3 bacterial fertilizer has viable count of 5.0 × 10⁹cfu/g. All operations were carried out under optimized fermentation conditions. Wherein OM is 46.21%, TN is 2.36%, P₂O₅1.49%, K₂O is 3.03%.

The bacterial manure carrier is a mixture of cow dung and wheat straw (cow dung: straw 1: 2 by weight), and is provided by the microbial resource limited of Chuangdi, Tex, China.

2. And (3) field test design:

to test the potential of XNRB-3 bacterial manure to control ARD under field conditions. A field test was conducted in Haitancun, Laizhou, Shandong province. After the apple orchard is rebuilt, serious ARD occurs, the fruit trees grow slowly, and the survival rate is lower than 50%. In 3 months of 2020, 28-year-old fruit trees are removed from the orchard, and a replanted orchard is established at the same time. The apple seedlings used for the experiment are 2-year-old grafted seedlings. The combination of the rootstock and the ear is 3/T337 of tobacco. The stem of the grafted seedling is about 10mm thick, and the fixed stem length is 1.4 m. Purchased from natrual horticulture, inc. The row spacing of the plants is 1.5m multiplied by 4m, and the tree form is trimmed into a spindle shape. The production of the XNRB-3 bacterial fertilizer is as described above.

The experiment was divided into 4 treatments: old orchard soil of 28 years old (CK1), old orchard soil of 28 years old (CK2) fumigation treatment with methyl bromide, bacterial fertilizer carrier treatment (T1) and bacterial fertilizer treatment with XNRB-3 (T2). Digging 80cm according to line spacing³Planting holes, and backfilling the mixture of the bacterial manure carrier, the XNRB-3 bacterial manure and soil. The application amount of each young tree is controlled to be 1kg, and 20 young trees are treated. All treatments were performed at the beginning of the second spring. All indices were measured at 7/15 days of 2020 and 10/20 days of 2021. The surface soil was removed and multiple samples were taken within 0.5m around the differently treated apple trees. Each group was repeated 3 times. Impurities such as root systems, weeds, soil animals, stones and the like are removed, and the samples are divided into 3 parts: 1 part of the mixture is stored in a refrigerator at 4 ℃ and is used for measuring the microbial structure of soil; wherein, one part of the soil is naturally dried to detect the activity of soil enzyme, soil nutrients and soil phenolic acid; one portion was stored in an 80 ℃ freezer for DNA extraction and real-time fluorescence quantification (Sheng et al, 2020).

3 results of measurement

3.1 Effect of XNRB-3 bacterial manure on Malus hupehensis seedling under Pot culture test

In 9 months in 2017, the seedlings of the Malus hupehensis Rehd processed by XNRB-3(T2) are obviously higher than the control seedlings in biomass, plant height, ground diameter, fresh weight and dry weight by 88.07%, 61.28%, 181.35% and 140.44% respectively, and are only treated by methyl bromide fumigation (figure 18).

3.2 Effect of Strain XNRB-3 on apple Tree seedling Biomass

XNRB-3 bacterial manure treatment (T2) significantly promoted the growth of young apple trees, and this difference became significant 10 months in 2021 (fig. 19A-B). The biomass index of CK1 and T1 was significantly lower than CK2 and T2 in 7 months in 2020 and 10 months in 2021. At 10 months 2021, T2 increased branch length by an average of 38.10%, 62.79%, 49.17%, 176.00% relative to control CK1, plant height, ground diameter, number of branches, and T2 had plant height, ground diameter, number of branches, and average branch length that were 1.27, 1.25, 1.37, 1.77, 2.45, and 2.21 times that of T1, respectively (FIGS. 19C-F).

3.3 Effect of Strain XNRB-3 on soil Environment

In 7 months in 2020 and 10 months in 2021, the soil phenolic acid content is highest at CK1 and T1, and lowest at CK2 and T2 (FIG. 20A-B). The total phenolic acid content of the soil in the T2 group is obviously lower than that in the CK1 group. The contents of cinnamic acid, phlorizin, benzoic acid, ferulic acid and p-hydroxybenzoic acid in T2 soil in 7 months in 2020 are 54.38%, 74.02%, 77.29%, 54.70% and 71.83% respectively lower than CK 1. The contents of cinnamic acid, phlorizin, benzoic acid, ferulic acid and p-hydroxybenzoic acid in T2 soil at 10 months in 2021 were 87.23%, 91.95%, 89.80%, 84.11% and 91.98% lower than CK1, respectively.

Urease, phosphatase, sucrase and catalase activities were stably elevated relative to CK1 in 7 months in 2020 and 10 months in 2021, T1 and T2. The soil enzyme activity decreased the first year of fumigation treatment and then continued to increase, with the most significant increase with T2 treatment (fig. 20G-J). The urease activity of T2 group is 1.65 times and 1.64 times higher than that of CK1 group respectively in 10 months of 2020-2021 year, the phosphatase activity is 1.56 times and 1.93 times higher than that of CK1 group respectively, the sucrase activity is 2.03 times and 2.34 times higher than that of sucrase activity, and the catalase activity is 1.69 times and 1.87 times higher than that of catalase activity respectively.

In 7 months in 2020 and 10 months in 2021, the number of XNRB-3 bacterial manure treated (T2) soil bacteria was significantly increased, and the number of T2 soil bacteria was increased by 107.21%, 45.13%, 100.79% and 113.08% respectively, compared with CK1 (FIG. 20C). The number of fungi in different soil treatments varies significantly. Compared with CK1, the soil fungus number of CK2, T1 and T2 is obviously reduced, the soil fungus number of T1 is obviously higher than that of T2, and the effect of T2 is similar to that of fumigation treatment. In 7 months of 2020 and 10 months of 2021, the soil fungal populations of CK2 and T2 were reduced by 58.55%, 50.26%, 62.74% and 52.83%, respectively, compared to control CK1 (fig. 20D). The number of actinomycetes and the ratio of bacteria/fungi in the soil were significantly higher than in the T2 control (FIGS. 20E-F). The qPCR results showed that the abundance of fusarium in CK2 and T2 was significantly reduced compared to CK1 and T1 at 7

months

2020 and 10 months 2021 (fig. 20K-N). Month 7 in 2020, month 10 in 2021, f.proliferatum, f.solani, f.verticillium and f.oxysporum increased by 50.43%, 40.74%, 25.96% and 22.20%, respectively. The decrease in T2 relative to T1 was 60.43%, 57.97%, 28.69% and 40.31%, respectively.

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Shandong university of agriculture

<120> bacillus licheniformis XNRB-3 and application thereof

<130> 2022

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Universal primer 27F

<400> 1

agagtttgat cctggctcag 20

<210> 2

<211> 19

<212> DNA

<213> Universal primer 1492R

<400> 2

ggttaccttg ttacgactt 19

<210> 3

<211> 24

<212> DNA

<213> primer 42f

<400> 3

cagtcaggaa atgcgtacgt cctt 24

<210> 4

<211> 24

<212> DNA

<213> primer 1066r

<400> 4

caaggtaatg ctccaggcat tgct 24

<210> 5

<211> 41

<212> DNA

<213> primer up1f

<220>

<221> misc_feature

<222> (27)..(27)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (30)..(30)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (33)..(33)

<223> n is a, c, g, or t

<400> 5

gaagtcatca tgaccgttct gcaygcnggn ggnaarttyg a 41

<210> 6

<211> 44

<212> DNA

<213> primer up2r

<220>

<221> misc_feature

<222> (27)..(27)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (33)..(33)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (39)..(39)

<223> n is a, c, g, or t

<400> 6

agcagggtac ggatgtgcga gccrtcnacr tcngcrtcng tcat 44

<210> 7

<211> 23

<212> DNA

<213> primer 2292F

<400> 7

aggtcaacta gttcagtatg gac 23

<210> 8

<211> 21

<212> DNA

<213> primer 3354R

<400> 8

aagaaccgta accggcaact t 21

Claims

1. A strain of Bacillus licheniformis (Bacillus licheniformis) XNRB-3 with the biological preservation number as follows: CGMCC No. 15308.

2. A microbial preparation comprising the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 of claim 1.

3. The microbial preparation according to claim 2, wherein the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 is present in the form of cultured viable bacteria, fermentation broth, bacterial suspension, cell-free culture filtrate or extracellular metabolites.

4. The microbial inoculum according to claim 2 or 3, wherein the formulation of the microbial inoculum is wettable powder, water dispersant, water suspending agent or dispersible oil suspending agent.

5. Use of the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 according to claim 1 or the Bacillus licheniformis (Bacillus licheniformis) XNRB-3-containing microbial agent according to any of claims 2 to 4 in at least one of the following (1) to (6):

(1) inhibiting the growth of plant pathogenic bacteria;

(2) preparing a product for inhibiting phytopathogens;

(3) preventing and controlling diseases caused by plant pathogenic bacteria;

(5) degrading phenolic acid substances;

(6) preparing the product for degrading phenolic acid substances.

6. The use according to claim 5, wherein the phytopathogen is one or more of Fusarium oxysporum (Fusarium oxysporum), Fusarium verticillium (Fusarium verticillioides), Fusarium cambium proprietary-apple MR5(Fusarium proliferatum f.sp.malus domestica), Fusarium solani (Fusarium solani), Phytophthora (Phytophtora), Rhizoctonia solani (Rhizoctonia solani), Alternaria alternata (Alternaria alternata) and Malassezia apples (Valsamalyi);

the phenolic acid substance is one or more of phlorizin, benzoic acid, ferulic acid, vanillic acid, gallic acid and phloretin.

7. Use of the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 of claim 1 in at least one of the following (1) to (7):

(1) dissolving phosphate and potassium;

(2) fixing nitrogen;

(3) producing IAA, GA and ABA;

(4) production of ACC deaminase, ammonia and amylase;

(5) producing a siderophore;

(7) producing an antifungal active;

8. Use of the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 according to claim 1 or the Bacillus licheniformis (Bacillus licheniformis) XNRB-3-containing microbial agent according to any of claims 2 to 4 in (1) or (2) as follows:

(1) reducing apple continuous cropping obstacles;

9. Use of the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 according to claim 1 or the Bacillus licheniformis (Bacillus licheniformis) XNRB-3-containing microbial agent according to any of claims 2 to 4 in at least one of the following (1) to (4):

(3) improving the ratio of bacteria to fungi in the continuous cropping soil;

10. A method for alleviating apple continuous cropping obstacles, comprising the steps of:

applying the Bacillus licheniformis (Bacillus licheniformis) XNRB-3 as described in claim 1 or the Bacillus licheniformis (Bacillus licheniformis) XNRB-3-containing inoculant according to any one of claims 2-4 to the apple replant soil.