CN115975848A - Tropical bacillus and application thereof - Google Patents

Abstract

The application relates to the technical field of agricultural microorganisms, and particularly discloses tropical bacillus and application thereof, wherein the tropical bacillus is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms, the preservation number is CGMCC No.24737, and the preservation date is 2022 years, 4 months and 21 days. And a culture method of the tropical bacillus, and a fermentation liquid, a growth-promoting bacterium suspension and a growth-promoting microbial agent prepared by using the tropical bacillus. The bacillus tropicalis has the capability of synthesizing IAA, siderophores and protease, has the functions of dissolving phosphorus and potassium, and can promote the growth and fructification of crops. The tropical bacillus also has the capabilities of acid and alkali resistance, salt resistance and high temperature resistance, and creates conditions for the application of the tropical bacillus in agriculture.

Description

Tropical bacillus and application thereof

Technical Field

The application relates to the technical field of agricultural microorganisms, in particular to tropical bacillus and application thereof.

Background

The tropical Bacillus (Bacillus tropicus) belongs to the genus Bacillus, is a gram-positive bacterium, has good stability, has good stress resistance to temperature, salt ion concentration, acidity and alkalinity, dryness, radiation, ultraviolet rays and the like, and can resist adverse conditions by forming spores in extreme environments.

The bacillus strain has the characteristics of strong environmental adaptability and long storage period, and is the rhizosphere strain which is most widely applied at present. In addition, the bacillus strain can secrete various physiologically active substances such as enzymes, and therefore has important application value. Research shows that the tropical bacillus has potential in biodegradation, can degrade two refractory organic compounds, namely pyridine and quinoline, and can also degrade lignin in municipal waste. The research also shows that the tropical bacillus has the function of repairing the substrate sludge pollution, the synthesized siderophore enables the strain to have certain tolerance and complexing ability to heavy metals, the dissolubility of insoluble heavy metals can be improved, the growth of plants under the stress of the heavy metals can be promoted, and reference are provided for enriching siderophore and the scientific research and application practice of microorganism-plant combined repairing of the heavy metal polluted soil.

However, reports on the aspects of promoting plant growth and dissolving insoluble phosphorus and potassium and the like of the tropical bacillus, especially reports on promoting plant growth and improving stress resistance of crops under high-salt and high-temperature conditions, are not found in the existing research.

Disclosure of Invention

In order to provide a new function of the tropical bacillus and enrich application scenes of the tropical bacillus, the application provides the tropical bacillus and application of the tropical bacillus. The bacillus tropicalis can metabolize and synthesize various growth promoting substances such as indole-3-acetic acid (IAA), siderophores, protease and the like, has the functions of phosphate and potassium dissolving, has high tolerance on acid-base, salt concentration and temperature, and can stably survive and propagate in soil to further remarkably promote the growth of crops.

In a first aspect, the present application provides a bacillus tropicalis, which adopts the following technical scheme:

the bacillus tropicalis is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.24737 and the preservation date of 2022 years, 4 months and 21 days.

In the application, the tropical Bacillus is named as tropical Bacillus tropicus S03.

In the application, the tropical bacillus is obtained by separating and screening rhizosphere soil in Ledong Li autonomous prefecture in Hainan province, and can well grow in a pH value range of 4-11, a high-temperature condition of 50 ℃ and a 15% NaCl high-salt solution. The strain can stably survive and propagate in the growing environment of various crops, and has important application significance in agriculture.

In the application, the tropical bacillus also has a good growth promoting effect, and the growth promoting mechanism mainly comprises the following aspects: (1) The tropical bacillus can synthesize auxin IAA, promote the division of plant cells and regulate the growth of plants. (2) The tropical bacillus can secrete an iron carrier to form an iron-iron carrier complex with indissolvable iron in soil, so that nutrient elements in plants are converted and utilized by the plants, and the plants are promoted to absorb nutrient substances. (3) The tropical bacillus can also secrete active substances such as protease, can control diseases by degrading pathogenic bacteria cell membranes, and can decompose protein in the fertilizer to promote absorption of nutrient substances. (4) The tropical bacillus also has the functions of phosphate and potassium dissolving, can convert phosphorus and potassium which are not easy to be absorbed into a form which is easy to be absorbed, and improves the absorption efficiency of crops to phosphorus and potassium.

In a second aspect, the present application provides a method for culturing the bacillus tropicalis, which adopts the following technical scheme:

a method for culturing a Bacillus tropicalis, comprising:

inoculating the tropical bacillus into a culture medium, and culturing at 25-50 ℃ for 18-50 h.

In the application, the tropical bacillus culture medium is simple in components, the culture method is mature in technology, the culture cost is low, and conditions are created for agricultural application of the tropical bacillus culture medium.

In some specific embodiments, the temperature of the culture is 25-28 ℃, 25-30 ℃, 25-37 ℃, 25-40 ℃, 25-45 ℃, 28-30 ℃, 28-37 ℃, 28-40 ℃, 28-45 ℃, 28-50 ℃, 30-37 ℃, 30-40 ℃, 30-45 ℃, 30-50 ℃, 37-40 ℃, 37-45 ℃, 37-50 ℃, 40-45 ℃, 40-50 ℃ or 45-50 ℃ and the like.

In a specific embodiment, the temperature of the culture is 25 ℃,28 ℃,30 ℃, 37 ℃,40 ℃, 45 ℃ or 50 ℃ or the like.

In some particular embodiments of the present invention, the substrate is, the culture time is 18-20 h, 18-22 h, 18-24 h, 18-28 h, 18-30 h, 18-35 h, 18-40 h, 18-48 h, 20-22 h, 20-24 h, 20-28 h, 20-30 h, 20-35 h, 20-40 h, 20-48 h, 20-50 h, 22-24 h, 22-28 h, 22-30 h, 22-35 h, 22-40 h, 22-48 h, 22-50 h, 24-28 h, 24-30 h, 24-35 h, 24-40 h, 24-48 h, 24-50 h, 28-30 h, 28-35 h, 28-40 h, 28-48 h, 28-50 h, 30-35 h, 30-40 h, 30-48 h, 30-50 h, 35-40 h, 35-48 h, 35-50 h, 35-48 h, 40-50 h, or 50h, etc.

In a specific embodiment, the culturing time is 18h, 20h, 22h, 24h, 28h, 30h, 35h, 40h, 48h or 50h, etc.

In a third aspect, the present application provides a fermentation broth, which adopts the following technical scheme:

a fermentation broth fermented with the bacillus tropicalis of the first aspect.

In a fourth aspect, the present application provides a growth-promoting bacterial suspension, which adopts the following technical scheme:

a growth-promoting bacterial suspension comprising the bacillus tropicalis of the first aspect and/or the fermentation broth of the third aspect.

Preferably, the effective viable count of the tropical bacillus in the growth-promoting bacterial suspension is not less than 1 x 10 ⁸ cfu/mL。

In some embodiments, the viable count of the tropical bacillus in the growth-promoting bacterial suspension is (1-2) × 10 ⁸ cfu/mL、(1～3)×10 ⁸ cfu/mL、(1～4)×10 ⁸ cfu/mL、(1～5)×10 ⁸ cfu/mL、(1～6)×10 ⁸ cfu/mL、(1～7)×10 ⁸ cfu/mL、(1～8)×10 ⁸ cfu/mL、(1～9)×10 ⁸ cfu/mL、(2～3)×10 ⁸ cfu/mL、(2～4)×10 ⁸ cfu/mL、(2～5)×10 ⁸ cfu/mL、(2～6)×10 ⁸ cfu/mL、(2～7)×10 ⁸ cfu/mL、(2～8)×10 ⁸ cfu/mL、(2～9)×10 ⁸ cfu/mL、(3～4)×10 ⁸ cfu/mL、(3～5)×10 ⁸ cfu/mL、(3～6)×10 ⁸ cfu/mL、(3～7)×10 ⁸ cfu/mL、(3～8)×10 ⁸ cfu/mL、(3～9)×10 ⁸ cfu/mL、(4～5)×10 ⁸ cfu/mL、(4～6)×10 ⁸ cfu/mL、(4～7)×10 ⁸ cfu/mL、(4～8)×10 ⁸ cfu/mL、(4～9)×10 ⁸ cfu/mL、(5～6)×10 ⁸ cfu/mL、(5～7)×10 ⁸ cfu/mL、(5～8)×10 ⁸ cfu/mL、(5～9)×10 ⁸ cfu/mL、(6～7)×10 ⁸ cfu/mL、(6～8)×10 ⁸ cfu/mL、(6～9)×10 ⁸ cfu/mL、(7～8)×10 ⁸ cfu/mL、(7～9)×10 ⁸ cfu/mL or (8-9). Times.10 ⁸ cfu/mL, etc.

In a specific embodiment, the viable count of the tropical bacillus in the growth-promoting bacterial suspension is 1 × 10 ⁸ cfu/mL、2×10 ⁸ cfu/mL、3×10 ⁸ cfu/mL、4×10 ⁸ cfu/mL、5×10 ⁸ cfu/mL、6×10 ⁸ cfu/mL、7×10 ⁸ cfu/mL、8×10 ⁸ cfu/mL or 9X 10 ⁸ cfu/mL, etc.

In a fifth aspect, the present application provides use of a bacillus tropicalis according to the first aspect, a fermentation broth according to the third aspect, or a growth-promoting suspension according to the fourth aspect, in the preparation of a growth-promoting microbial agent.

In a sixth aspect, the present application provides a growth-promoting microbial inoculum, which adopts the following technical scheme:

a growth-promoting microbial inoculant comprising the bacillus tropicalis of the first aspect, the fermentation broth of the third aspect, or the growth-promoting microbial suspension of the fourth aspect.

Preferably, the number of effective viable bacteria of the tropical bacillus in the growth promoting microbial agent is not less than 5 hundred million/mL.

In some particular embodiments of the method of the present invention, the effective viable count of tropical bacillus in the growth promoting microbial agent is 5-5.5 hundred million/mL, 5-6 hundred million/mL, 5-6.5 hundred million/mL, 5-7 hundred million/mL, 5-7.5 hundred million/mL, 5-8 hundred million/mL, 5-8.5 hundred million/mL, 5-9 hundred million/mL, 5-9.5 hundred million/mL, 5-10 hundred million/mL, 5.5-6 hundred million/mL, 5.5-6.5 hundred million/mL, 5.5-7.5 hundred million/mL, 5.5-8 hundred million/mL, 5.5-8.5 hundred million/mL, 5.5-9 hundred million/mL, 5.5-9.5 hundred million/mL, 5.5-10 hundred million/mL, 6-6.5 hundred million/mL, 6-7 hundred million/mL, 6-7.5 hundred million/mL, 6-8 hundred million/mL, 6-8.5 hundred million/mL, 6-6 hundred million/mL, 6.5 hundred million-6.5 hundred million/mL, 6-7 hundred million/mL, 6.5-7 hundred million/mL, 6.5-7.5 hundred million/mL, 6.5-8 hundred million/mL, 6.5-8.5 hundred million/mL, 6.5-9 hundred million/mL, 6.5-9.5 hundred million/mL, 6.5-10 hundred million/mL, 7-7.5 hundred million/mL, 7-8 hundred million/mL, 7-8.5 hundred million/mL, 7-9 hundred million/mL, 7-9.5 hundred million/mL, 7-10 hundred million/mL, 7.5-8 hundred million/mL, or 7.5-8.5, 7.5-9, 7.5-9.5, 7.5-10, 8-8.5, 8-9, 8-9.5, 8-10, 8.5-9, 8.5-9.5, 8.5-10, 9-9.5, 9-10, or 9.5-10 billion/mL.

In a specific embodiment, the number of viable bacteria of the tropical bacillus in the growth-promoting microbial agent is 5 hundred million/mL, 5.5 hundred million/mL, 6 hundred million/mL, 6.5 hundred million/mL, 7 hundred million/mL, 7.5 hundred million/mL, 8 hundred million/mL, 8.5 hundred million/mL, 9 hundred million/mL, 9.5 hundred million/mL, or 10 hundred million/mL, etc.

In a seventh aspect, the present application provides use of the bacillus tropicalis of the first aspect, the fermentation broth of the third aspect, the growth-promoting bacterial suspension of the fourth aspect, or the growth-promoting microbial agent of the sixth aspect in preparation of a microbial fertilizer.

In the application, the growth-promoting bacterium suspension and the growth-promoting microbial agent can be used independently to promote the growth of crops, and can also be mixed with a conventional fertilizer to produce a synergistic effect. The conventional fertilizer contains abundant nitrogen, phosphorus and potassium elements, but lacks biological growth promoting substances, and the existence form of the phosphorus and the potassium elements is not beneficial to the absorption of crops. After the mixed growth-promoting microbial agent is mixed with the growth-promoting microbial agent, on one hand, tropical bacillus in the microbial agent can secrete biological growth-promoting substances such as IAA, siderophores, protease and the like, and on the other hand, the tropical bacillus can convert phosphorus and potassium elements which are not easily absorbed in the fertilizer into a form which is easily absorbed, so that the element absorption efficiency of crops is improved, and the promotion effect on the growth of the crops is very obvious.

In an eighth aspect, the present application provides use of the bacillus tropicalis of the first aspect, the fermentation broth of the third aspect, the growth-promoting microbial suspension of the fourth aspect, or the growth-promoting microbial agent of the sixth aspect in crop cultivation.

In summary, the present application has the following beneficial effects:

1. the IAA synthetic amount of tropical bacillus in the application can reach more than 35.65mg/mL, the growth of crops can be promoted, various growth promoting substances such as siderophores, protease and the like can be synthesized and secreted, the absorption capacity of the crops on nutrients is improved, and diseases can be prevented and controlled to a certain extent; the tropical bacillus also has the functions of phosphate and potassium dissolution, improves the utilization efficiency of phosphorus and potassium elements, and has remarkable promotion effect on the growth of crop plants and the improvement of yield.

2. The tropical bacillus in the application has high tolerance on acid-base, salt concentration, high-temperature environment and the like, can survive and split in a pH value range of 4-11, a high-temperature condition of 50 ℃ and a 15% NaCl high-salt solution, has strong resistance to adverse environment, reduces the defect that the activity of functional strains is reduced due to the influence of environmental factors such as temperature and weather in the transportation process of related products, and ensures the quality of the products. In addition, the difference of the growth environments of different crops is large, and the strong environment tolerance capability also provides a foundation for the application of the fertilizer in different culture environments and the culture of different crops.

3. The tropical bacillus in the application can be used independently, and can also be used together with a common fertilizer, so that the utilization efficiency of the fertilizer is improved, the synergistic effect is achieved, and the growth and the fructification of crops are promoted. At present, no report related to growth promotion of plants by tropical bacillus exists, functions of the tropical bacillus are enriched, the blank of the tropical bacillus in agricultural application is filled, and a foundation is laid for subsequent related researches.

Drawings

FIG. 1 is a photograph showing the results of IAA coloration test of the strain S03 in example 1.

FIG. 2 is a photograph showing the colony morphology of the strain having IAA synthesizing ability in example 2.

FIG. 3 is a photograph showing the cell morphology of the IAA-synthesizing strain of example 2 (magnification =1000 times).

FIG. 4 is a photograph showing the construction results of a phylogenetic tree of the IAA-synthesizing strain of example 2.

FIG. 5 is a graph showing the results of measurement of the siderophore synthesis ability of Bacillus thermophilus S03 in example 3.

FIG. 6 is a photograph showing the results of measurement of the protease synthesizing ability of Bacillus thermophilus S03 in example 3.

FIG. 7 is a graph showing the results of measurement of the phosphorus solubilizing ability of Bacillus thermobifidus S03 in example 3.

FIG. 8 is a graph showing the results of measurement of potassium-solubilizing ability of Bacillus thermoacidophilus S03 in example 3.

FIG. 9 is a photograph showing the results of culturing seedlings of Brassica napus in example 7 in different groups.

FIG. 10 is a photograph showing the results of culturing seedlings of different groups of tomatoes in example 8.

Detailed Description

The application provides tropical Bacillus named as Bacillus tropicus S03, which is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.24737 and the preservation date of 2022 years, 4 months and 21 days.

The application also provides a culture method of the bacillus tropicalis, which specifically comprises the following steps:

inoculating the tropical bacillus into a culture medium, and culturing at 25-50 ℃ for 18-50 h.

Specifically, the culture medium comprises an LB culture medium, a King B culture medium, a beef extract peptone culture medium or a fermentation culture medium.

Specifically, the LB medium comprises 10g/L of peptone, 5g/L of yeast powder and 10g/L of NaCl.

Specifically, the King B culture medium comprises peptone 20.0g/L, potassium phosphate 1.5g/L and magnesium sulfate 1.5g/L, and the pH value is 7.2 +/-0.2.

Specifically, the beef extract peptone medium comprises 3.0g/L beef extract, 10.0g/L, naCl 5.0.0 g/L peptone and 15g/L agar, and the pH is 7.2-7.5.

Specifically, the fermentation medium comprises 12g/L of glucose, 8g/L of tryptone, 8g/L of yeast powder, 1g/L of monopotassium phosphate, 0.5g/L of magnesium sulfate, 0.5g/L of manganese sulfate and 2g/L of calcium carbonate.

The application also provides a fermentation liquid which is obtained by fermenting the tropical bacillus.

The application also provides a growth-promoting bacterial suspension which comprises the tropical bacillus and/or the fermentation liquor.

Specifically, the effective viable count of the tropical bacillus in the growth promoting bacterial suspension is not less than 1 × 10 ⁸ cfu/mL。

The application provides a growth-promoting microbial agent which comprises the bacillus tropicalis, fermentation liquor or growth-promoting microbial suspension.

Specifically, the effective viable count of the tropical bacillus in the growth promoting microbial agent is not less than 5 hundred million/mL.

The technical solution of the present application will be further described below with reference to examples 1 to 9 and accompanying drawings 1 to 10.

Example 1

This example provides a method for isolating a strain having IAA synthesizing ability. The strain with IAA synthesis capacity is separated from rhizosphere soil of crops, and the separation steps are as follows:

(1) Strain separation:

preparation of LB solid Medium:

weighing 10g of peptone, 5g of yeast powder, 10g of NaCl and 15g of agar, adding water to a constant volume of 1000mL, and carrying out autoclaving at 121 ℃ for 30min. And cooling the sterilized culture medium to 50 ℃, mixing uniformly, pouring into a culture dish, and cooling for later use.

Weighing 10g of the collected rhizosphere soil, adding the rhizosphere soil into a conical flask filled with 90mL of sterile water, shaking at 200rpm for 30min, and standing for 2h.

Taking the supernatant and standing according to 10 ^-2 ～10 ^-5 Is diluted by a concentration gradient of (a). After dilution, 100. Mu.L of each concentration gradient was pipetted and spread on the surface of LB solid medium and cultured at 28 ℃ for 24 hours.

And after the single colony grows on the surface of the culture medium, selecting according to the colony morphology, color and size, and purifying and storing on a solid culture medium.

(2) Primary screening:

preparation of Salkowski color development liquid:

taking 10mL of FeCl at 0.5mol/L ₃ Solution of is added to500mL 35% perchloric acid, mixing uniformly for use.

Preparation of King B solid medium:

weighing 20.0g of peptone, 1.5g of potassium phosphate, 1.5g of magnesium sulfate and 15g of agar, adding water for dissolving, adjusting the pH value to 7.2 +/-0.2, adding water for fixing the volume to 1000mL, and autoclaving at 121 ℃ for 30min. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.

Inoculating the separated and purified strain on the surface of King B solid medium by adopting a four-region streaking method, culturing at 28 ℃ for 24h, and adding about 1mL of Salkowski developing solution for developing reaction.

A King B solid medium supplemented with 50. Mu.L IAA (50 mg/L) was added dropwise as a positive control. The solid culture medium is observed after being placed for 30min at room temperature in a dark condition, and the IAA can be synthesized when the color turns red.

After screening, the color of the culture medium of the strain S03 turns red, which indicates that IAA can be synthesized. The image of the results of the IAA color test of the strain S03 is shown in FIG. 1.

(3) Re-screening:

preparation of LB liquid Medium:

weighing 10g of peptone, 5g of yeast powder and 10g of NaCl, adding water to a constant volume of 1000mL, carrying out autoclaving at 121 ℃ for 30min, and cooling for later use.

Inoculating the selected strain S03 in LB liquid culture medium, shake culturing at 28 deg.C and 200rpm for 24h, taking out, centrifuging at 4000rpm for 15min, mixing 4mL of supernatant with equal volume of Salkowski developer, reacting at 25 deg.C in dark place for 30min, and determining OD ₅₃₀ And (5) calculating the IAA content in the bacteria liquid according to the regression equation of the IAA standard curve of the value at nm.

The method for making the IAA standard curve comprises the following steps: preparing IAA standard solutions with mass concentrations of 0, 10. Mu.g/mL, 30. Mu.g/mL, 50. Mu.g/mL, 80. Mu.g/mL, 100. Mu.g/mL and 120. Mu.g/mL, respectively, mixing with Salkowski developer at a volume ratio of 1:1, protecting from light at room temperature for 30min, measuring at OD ₅₃₀ The same operation was carried out with a mixture of distilled water and Salkowski developer in a volume ratio of 1:1 at nm as a blank.

Through determination, the separated strain S03 has color reaction, which shows that the strain S03 can synthesize IAA with the content of 35.65 mu g/mL.

Example 2

This example provides a procedure for identifying the above-described strains having IAA-synthesizing ability.

The strain S03 with IAA synthesis ability isolated in example 1 was subjected to morphological identification, molecular biological identification, phylogenetic identification and whole genome sequence analysis.

Morphological identification

Preparation of beef extract peptone medium:

weighing 3.0g of beef extract, 10.0g of peptone, 5.0g of NaCl and 15g of agar, adding water to dissolve, adjusting the pH to 7.2-7.5, adding water to fix the volume to 1000mL, and sterilizing at 121 ℃ under high pressure for 30min. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.

Inoculating the strain S03 with IAA synthesis ability to the surface of a beef extract peptone medium by adopting a four-zone streaking method, culturing at 30 ℃ for 48h, observing colony morphology, and observing thallus morphology by gram staining.

The colony morphology of the strain with IAA-synthesizing ability is shown in FIG. 2. After 48h culture, the colony of the strain S03 is milky white, round and large as can be seen from figure 2.

FIG. 3 shows the morphological pattern of the strain having IAA-synthesizing ability. When the strain S03 is observed under a microscope after gram staining, as can be seen from FIG. 3, the strain is a gram-positive bacterium, is long-rod-shaped, and can appear singly or in pairs.

Molecular biological identification

The species of the microorganism is identified by 16S rDNA sequencing technology and colony PCR technology.

Inoculating the S03 strain obtained by separation and screening on the surface of an LB solid medium, culturing for 24h, selecting 1 fresh single colony, placing the single colony in a 1.5mL centrifuge tube, adding 10 mu L S2 lysate (purchased from Beijing Optimalaceae biotechnology Co., ltd.), shaking and mixing uniformly, standing for 20min at room temperature, then diluting for 20 times, shaking and mixing uniformly, centrifuging at 12000rpm for 2min, taking the supernatant as a template, and carrying out PCR amplification.

The amplification primers were as follows:

27F(SEQ ID No.1)：AGAGTTTGATCCTGGCTCAG；

1492R(SEQ ID No.2)：TACGGCTACCTTGTTACGACTT。

amplification reagents: 2 × EasyTaq SuperMix (available from Biotechnology Ltd. Of Kyoengine, beijing).

The amplification procedure was as follows:

94℃ 5min；

30s at 94 ℃; 30s at 55 ℃; 90s at 72 ℃; circulating for 35 times;

storing at 72 deg.C for 7min and 4 deg.C.

The reaction system of colony PCR is shown in Table 1.

TABLE 1 reaction System for colony PCR

Reagent	Amount used (μ L)
		2×EasyTaq SuperMix	15
27F(10μM)	1.5
		1492R(10μM)	1.5
Form panel	5
		ddH 2 O	7
Total volume	30

The formulation of the agarose gel is shown in table 2.

TABLE 2 agarose gel formulations

And (4) carrying out agarose gel electrophoresis on the PCR amplification product, and recovering and purifying the gel block. And performing Sanger sequencing on the purified product to obtain a forward and reverse sequencing result, wherein the 16S rDNA sequence of the forward and reverse sequencing result is shown in SEQ ID No. 3.

Phylogenetic identification

The obtained data are spliced by DNAMAN software, 16S rDNA sequences are compared in a www.ezbiocloud.net database, the repetition times are estimated for 1000 times by adopting a Neighbor-Joining method and Bootstrap confidence values through Mega 5.0 software, a phylogenetic evolutionary tree is constructed, the position of the strain S03 in the phylogenetic tree is determined, and the construction result of the phylogenetic tree is shown in figure 4. According to FIG. 4, the identification and alignment result indicates that the S03 strain is Bacillus tropicalis (Bacillus tropicus).

Whole genome sequence analysis

Inoculating the strain S03 into LB liquid culture medium, shake culturing at 28 deg.C and 200rpm for 24h, centrifuging at 4000rpm for 15min, and collecting thallus.

And uploading the sequencing result to www.ezbiocloud.net and https:// ggdc.dsmz.de/ggdc.php #, and calculating an ANI value and a dDDH value, wherein the calculation result shows that the ANI value is 99.74, the dDDH value is 98.1 and the strain S03 is proved to be Bacillus tropicalis (Bacillus tropicus).

The Bacillus tropicalis S03 is preserved in China general microbiological culture Collection center (CGMCC) at 21.4.2022, wherein the preservation address is No.3 of Xilu 1 of Beijing Korean district, the postal code is 100101, and the preservation number is CGMCC No.24737.

Example 3

This example provides methods for measuring the siderophore synthesis ability, protease synthesis ability, phosphate solubilizing ability and potassium solubilizing ability of the Bacillus tropicalis S03.

Determination of the Synthesis Capacity of siderophores

The preparation method of 0.1mol/L phosphate buffer solution comprises the following steps:

5.91g of sodium dihydrogen phosphate, 24.27g of disodium hydrogen phosphate, 2.50g of ammonium chloride, 0.75g of potassium dihydrogen phosphate and 1.25g of sodium chloride are weighed, and deionized water is added to the mixture to reach the volume of 1L.

The preparation method of the culture medium containing the iron carrier CAS comprises the following steps:

60.5mg of CAS (available from Shanghai Maxim Biochemical technologies, inc.), 72.9mg of hexadecyltrimethylammonium bromide (HDTMA, available from Beijing Sobel technology, inc.), and 1mmol/L of FeCl were weighed ₃ ·6H ₂ 10mL of O (prepared by 10 mmol/LHCl), 50mL of 0.1mol/L phosphate buffer solution and 9.0g of agar, adding deionized water to the volume of 1000mL, and sterilizing the mixture for 30min at 121 ℃. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.

The method for measuring the synthetic capacity of the siderophore comprises the following steps:

the activated tropical bacillus S03 is inoculated in a blue culture medium containing a siderophore CAS and cultured for 48h at 28 ℃. If the bacteria synthesize siderophores, chelating iron (ferric iron) in the medium, a reddish halo is produced around the colony.

FIG. 5 is a graph showing the results of measurement of siderophore synthesis ability of Bacillus tropicalis S03. As shown in FIG. 5, the tropical bacillus S03 can synthesize the siderophore, and the halo diameter of the tropical bacillus S03 can reach 3.85cm, which shows that the tropical bacillus S03 has good siderophore synthesis capacity and can promote the absorption and utilization of iron elements for crops.

Determination of protease synthesizing ability

The preparation method of the protease detection culture medium comprises the following steps:

weighing 5.00g of tryptone, 3.00g of yeast extract, 1.00g of glucose and 15.00g of agar, adding distilled water to dissolve, adjusting the pH to 7.0, adding distilled water to a constant volume of 1000mL, and sterilizing at 121 ℃ under high pressure for 30min. And cooling the sterilized culture medium to 50 ℃, adding the skim milk into the culture medium according to the volume ratio of 10%, uniformly mixing, pouring into a culture dish, and cooling for later use.

Inoculating the activated tropical bacillus S03 to the surface of a protease detection culture medium, culturing for 48h at 28 ℃, and observing whether a lysis ring appears.

FIG. 6 is a graph showing the results of measurement of the protease synthesizing ability of Bacillus tropicalis S03. As shown in FIG. 6, the Bacillus tropicalis S03 has good protein dissolving capacity and high protease yield, and the dissolving ring diameter can reach 3.3cm.

Determination of phosphate solubilizing ability

The preparation method of the phosphate solubilizing culture medium comprises the following steps:

weighing 10g of glucose, 5g of calcium phosphate, 0.1g of ammonium sulfate, 0.2g of potassium chloride, 0.25g of magnesium sulfate, 5g of magnesium chloride heptahydrate and 15g of agar, adding distilled water to dissolve, adjusting the pH to 6.8-7.0, adding distilled water to constant volume to 1L, and autoclaving at 121 ℃ for 30min. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.

Inoculating the activated tropical bacillus S03 to the surface of a phosphate solubilizing culture medium, culturing for 48h at 28 ℃, and observing whether a lysis ring appears.

FIG. 7 is a graph showing the measurement results of the phosphate solubilizing ability of Bacillus tropicalis S03. As shown in FIG. 7, the tropical bacillus S03 has the phosphate solubilizing capability, and the diameter of a dissolving ring for dissolving organic phosphorus can reach 1.9cm.

Measurement of Potassium-solubilizing ability

The preparation method of the potassium dissolving culture medium comprises the following steps:

weighing 10g of sucrose, 0.5g of yeast powder, 0.5g of magnesium sulfate heptahydrate, 1g of ammonium sulfate, 2g of disodium hydrogen phosphate, 1g of calcium carbonate, 1g of potassium feldspar powder and 15g of agar, adding deionized water to dissolve, adjusting the pH value to 7.0, adding deionized water to a constant volume of 1L, and sterilizing at 121 ℃ for 30min under high pressure. And cooling the sterilized culture medium to 50 ℃, mixing uniformly, pouring into a culture dish, and cooling for later use.

Inoculating the activated Bacillus thermonatriens S03 to the surface of a potassium-dissolving culture medium, culturing for 48 hours at 28 ℃, and observing the appearance of an oilless dropwise dissolving ring.

FIG. 8 is a graph showing the results of measurement of potassium-solubilizing ability of Bacillus tropicalis S03. As shown in FIG. 8, the Bacillus tropicalis S03 has potassium-dissolving capacity, and the diameter of an oil drop-shaped dissolving ring can reach 1.3cm.

Example 4

This example provides a method for measuring the acid-base tolerance, salt concentration tolerance, and high-temperature tolerance of Bacillus tropicalis S03.

Acid-base tolerance determination

Inoculating activated Bacillus tropicalis S03 into LB liquid culture medium with pH values of 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0, respectively, shake culturing at 180rpm and 28 deg.C for 24 hr, and measuring OD of culture medium with different pH values ₆₀₀ The numerical values and results are shown in Table 3.

TABLE 3 determination of acid-base tolerance of Bacillus tropicalis S03

As can be seen from Table 3, the growth of the tropical bacillus S03 in the pH value range of 4-11 is basically not influenced, which shows that the tropical bacillus S03 has very strong acid and alkali resistance and creates conditions for the application in different soil environments.

Salt concentration tolerance determination

Inoculating activated Bacillus tropicalis S03 into LB liquid culture medium with NaCl concentration of 5.0%, 10.0%, 12.5%, 15.0%, 17.5% and 20.0%, respectively, shake culturing at 180rpm and 37 deg.C for 24 hr, and measuring OD of culture medium with different salt concentration ₆₀₀ The numerical values and results are shown in Table 4.

TABLE 4 measurement results of tolerance to S03 salt concentration of Bacillus tropicalis

As can be seen from Table 4, the tropical Bacillus S03 can grow normally at a NaCl concentration of 5% to 15%, and can not be divided and proliferated at a NaCl concentration of 20% in a growth state at a NaCl concentration of 17.5%, indicating that the tropical Bacillus S03 has certain salt tolerance.

High temperature tolerance determination

Inoculating activated tropical Bacillus bacteria S03 into LB liquid culture medium at 25 deg.C, 30 deg.C, 35 deg.C, 40 deg.C, 45 deg.C, 50 deg.C, 55 deg.C and 60 deg.C, respectively, performing shake culture at 180rpm and 37 deg.C for 24h, and measuring OD of culture medium with different pH ₆₀₀ The numerical values and results are shown in Table 5.

TABLE 5 determination results of high temperature tolerance of tropical bacillus S03

/>

As can be seen from Table 5, the growth of the tropical bacillus S03 at 25-50 ℃ is not affected basically, which indicates that the tropical bacillus S03 has very strong high temperature tolerance and creates conditions for the application of the tropical bacillus S03 in agriculture.

Example 5

In this example, a bacterial suspension of the bacillus tropicalis S03 is prepared according to the following steps:

(1) Activating strains: inoculating the preserved tropical bacillus S03 on the surface of an LB solid medium, and culturing at 28 ℃ for 24h; and selecting a single colony, streaking and transferring the single colony to the surface of an LB solid culture medium again, and culturing the single colony for 24 hours at 28 ℃.

(2) Preparing a bacterial suspension: scraping the activated tropical bacillus S03 in the two-ring step (1), inoculating the tropical bacillus S03 in an LB liquid culture medium, and performing shake culture at 28 ℃ and 180rpm for 30 hours to obtain a bacterial suspension.

Example 6

The liquid microbial inoculum of the tropical bacillus S03 is prepared by the following steps:

preparation of a fermentation medium:

weighing 15g of corn flour, 5g of peanut meal, 5g of soybean peptone, 8g of ammonium sulfate, 1g of monopotassium phosphate, 0.5g of magnesium sulfate, 0.5g of manganese sulfate and FeCl ₃ 0.05g and 1g of calcium carbonate, adding water to a constant volume of 1000mL, sterilizing at 121 ℃ for 30min under high pressure, and cooling for later use.

(1) Activating strains: inoculating the preserved tropical bacillus S03 on the surface of an LB solid medium, and culturing at 28 ℃ for 24h; and selecting a single colony, streaking and transferring the single colony to the surface of an LB solid culture medium again, and culturing the single colony for 24 hours at 28 ℃.

(2) Preparing a first-level seed liquid: scraping the activated tropical bacillus S03 in the two-ring step (1), inoculating the tropical bacillus S03 in an LB liquid culture medium, and performing shake culture at 28 ℃ and 180rpm for 24 hours to obtain a first-stage seed solution.

(3) Preparing a secondary seed solution: inoculating the primary seed liquid into a fermentation tank filled with LB liquid culture medium according to the proportion of 1-8% (v: v) for fermentation culture under the conditions of the rotating speed of 180rpm, the temperature of 28 ℃, the ventilation volume of 1 (0.8-1.2) and the filling pressure of 0.04-0.06 MPa, and culturing for 24 hours to obtain the secondary seed liquid.

(4) And (3) fermentation liquor culture: inoculating the secondary seed liquid into a fermentation tank filled with a fermentation culture medium according to the proportion of 5-10% (v: v) for fermentation culture under the conditions of the rotation speed of 150-180 rpm, the temperature of 28 ℃, the air permeability of 1 (0.8-1.2) and the filling pressure of 0.04-0.06 MPa for 20-30 h to obtain the liquid microbial inoculum of the tropical bacillus S03.

Example 7

This example demonstrates the growth promoting ability of the suspension of bacillus tropicalis S03 prepared in example 5 on brassica napus seedlings, and the steps are as follows:

putting double-layer filter paper into a culture dish, then uniformly adding the bacterial suspension of the tropical bacillus S03 prepared in the example 5 onto the filter paper, wherein the bacterial suspension is preferably permeated into the double-layer filter paper, and finally adding 15 prepared small rape seeds and culturing for 7 days. The same procedure was carried out on canola seeds as a Control (CK) using distilled water instead of the bacterial suspension of bacillus tropicalis S03.

The fresh weight of the roots, the fresh weight of the aerial parts and the height of the aerial parts of the small rape seedlings are measured, and the average value is taken as the final determination result.

The measurement results are shown in Table 6, and the pictures of the culture results of the seedlings of Brassica napus of different groups are shown in FIG. 9.

TABLE 6 determination of growth-promoting ability of Brassica napus seedlings by suspension of Bacillus tropicalis S03

In combination with the data in FIG. 9 and Table 6, it can be seen that the seed soaking with the bacterial suspension of Bacillus tropicalis S03 has a significant effect on the growth of Brassica napus seedlings, using 1X 10 ⁸ The cfu/mL of the bacterial suspension of the tropical bacillus S03 can improve the root fresh weight of the young rape seedlings by 38.71 percent, improve the fresh weight of the overground part by 26.51 percent and improve the height of the overground part of the seedlings by 32.32 percent. The tropical bacillus S03 is proved to have good effect of promoting the growth of crops.

Example 8

This example demonstrates the growth promoting ability of the liquid microbial inoculum of bacillus tropicalis S03 prepared in example 6 on tomato seedlings, and the steps are as follows:

a special plastic pot with the inner diameter of 15cm and the height of 20cm is adopted, 2kg of soil is filled in each pot, tomato seedlings with good growth vigor are transplanted into the pot, the seedlings are revived for 10 days, and the test is carried out after the seedlings recover to the healthy growth vigor.

The test is arranged in a test greenhouse of Ames bioengineering company in Beijing century, and tomato seedlings are randomly grouped. The experiment sets up 2 and handles the group, and every is handled the group and repeats 3 times, carries out the effect of promoting growth of tomato and verifies, and experimental group of handling is respectively:

treatment 1: adding 20mL of liquid microbial inoculum of tropical bacillus S03 (the effective viable count is more than or equal to 5.0 hundred million/mL) into the pot culture;

and (3) treatment 2: equal amounts of distilled water were added to the pots as controls.

After 20 days, the plant height and stem thickness of the tomato seedlings were measured, the measurement results are shown in Table 7, and the pictures of the culture results of different groups of tomato seedlings are shown in FIG. 10.

TABLE 7 determination results of tomato seedling growth promoting ability of liquid fungicide of tropical bacillus S03

Treatment group	Plant height (cm)	Stem diameter (mm)
			Process 1	15.8	4.67
Treatment 2	10.77	4.12

Combining the data in fig. 10 and table 7, it can be seen that the tomato plant height and stem thickness of treatment 1 are significantly better than those of treatment 2 during the seedling stage, and that the tomato plant height of treatment 1, which is applied with the liquid fungicide of bacillus tropicalis S03, is increased by 46.70% and the tomato stem thickness is increased by 13.35% compared to treatment 2. The results show that the liquid microbial inoculum using the tropical bacillus S03 has obvious advantages in promoting the growth of the tomato in the seedling stage, and can well increase the planting benefit of crops.

Example 9

This example compares IAA synthesis ability, siderophore synthesis ability, protease synthesis ability, phosphate solubilizing ability and potassium solubilizing ability of Bacillus tropicalis S03, bacillus belgii DPT-03 (CGMCC No. 20317) and Bacillus licheniformis XW02 (CCTCC NO: M2020872) in the present application, and the specific steps are as described above and the results are shown in Table 8.

TABLE 8 results of measurement of physiological metabolic characteristics of various strains

As can be seen from Table 8, the Bacillus tropicalis S03 has obvious advantages in the aspects of synthesizing IAA, siderophores, protease, phosphate and potassium, and the like, the synthetic amount is remarkably high at Yu Beilai Bacillus licheniformis DPT-03 and Bacillus licheniformis XW02, the absorption of insoluble iron, phosphorus, potassium, protein and other nutrient elements by crops can be promoted, and the bacillus tropicalis S03 has huge potential in the aspects of promoting the growth of crops and improving the utilization rate of fertilizers, and the growth of crops can be remarkably promoted and the yield can be improved through the mutual cooperation of the effects.

This example also tested the acid-base tolerance and salt concentration tolerance of the above-described bacillus tropicalis S03, bacillus belgii DPT-03 and bacillus licheniformis XW02, set pH values of 4.0, 7.0 and 11.0, and NaCl concentrations of 5%, 12.5% and 17.5%, see above for specific procedures, and the results are shown in table 9.

TABLE 9 results of testing acid-base tolerance and salt concentration tolerance of different strains

As can be seen from Table 9, the OD of the Bacillus tropicalis S03 was found to be within the acid-base tolerance under the acid-base conditions of pH 4, 7 and 11 ₆₀₀ The values are all remarkably high by Yu Beilai bacillus licheniformis DPT-03 and bacillus licheniformis XW02, and the acid and alkali resistance is good; in the salt concentration tolerance, the Bacillus beleisi DPT-03 and the Bacillus licheniformis XW02 were compared at NaCl concentrations of 5% and 12.5%,OD of Bacillus tropicalis S03 ₆₀₀ The values also have a clear advantage, although the OD of the B.tropicalis S03 is at a NaCl concentration of 17.5% ₆₀₀ The value is lower than that of Bacillus belgii DPT-03 and Bacillus licheniformis XW02, but the bacillus belgii DPT-03 and the Bacillus licheniformis XW02 can still survive. The results show that the bacillus tropicalis S03 has outstanding growth advantages under acidic and alkaline conditions, has certain salt tolerance and creates conditions for the utilization of the bacillus tropicalis S03 in different crop growth environments.

The present embodiment is only for explaining the present application, and it is not limited to the present application, and those skilled in the art can make modifications of the present embodiment without inventive contribution as needed after reading the present specification, but all of them are protected by patent law within the scope of the claims of the present application.

Claims (10)

1. The bacillus tropicalis is characterized in that the bacillus tropicalis is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms, the preservation number is CGMCC No.24737, and the preservation date is 2022 years, 4 months and 21 days.

2. The method for culturing a tropical bacillus according to claim 1, comprising:

inoculating the bacillus tropicalis into a culture medium, and culturing at 25-50 ℃ for 18-50 h.

3. A fermentation broth obtained by fermentation of the Bacillus tropicalis strain of claim 1.

4. A growth-promoting bacterial suspension comprising the bacillus tropicalis of claim 1 and/or the fermentation broth of claim 3.

5. The growth-promoting bacterial suspension of claim 4, wherein the effective viable count of the Bacillus tropicalis in the growth-promoting bacterial suspension is not less than1×10 ⁸ cfu/mL。

6. Use of the bacillus tropicalis of claim 1, the fermentation broth of claim 3, or the growth-promoting bacterial suspension of any one of claim 4~5 in the preparation of a growth-promoting microbial agent.

7. A growth-promoting microbial inoculant comprising a bacillus tropicalis according to claim 1, a fermentation broth according to claim 3 or a growth-promoting suspension according to any one of claims 4~5.

8. The growth-promoting microbial inoculant according to claim 7, wherein the effective viable count of the bacillus tropicalis in the growth-promoting microbial inoculant is not less than 5 hundred million/mL.

9. Use of a bacillus tropicalis according to claim 1, a fermentation broth according to claim 3, a growth-promoting bacterial suspension according to any one of claims 4~5, or a growth-promoting microbial inoculant according to any one of claims 7~8 for the preparation of a microbial fertilizer.

10. Use of a bacillus tropicalis according to claim 1, a fermentation broth according to claim 3, a growth-promoting suspension according to any one of claims 4~5, or a growth-promoting microbial inoculant according to any one of claims 7~8 in crop cultivation.

Images