CN115960744A - Bacillus licheniformis and application thereof - Google Patents
Bacillus licheniformis and application thereof Download PDFInfo
- Publication number
- CN115960744A CN115960744A CN202210864870.8A CN202210864870A CN115960744A CN 115960744 A CN115960744 A CN 115960744A CN 202210864870 A CN202210864870 A CN 202210864870A CN 115960744 A CN115960744 A CN 115960744A
- Authority
- CN
- China
- Prior art keywords
- bacillus licheniformis
- growth
- hundred million
- promoting
- bacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W30/00—Technologies for solid waste management
- Y02W30/40—Bio-organic fraction processing; Production of fertilisers from the organic fraction of waste or refuse
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The application relates to the technical field of agricultural microorganisms, and particularly discloses bacillus licheniformis and application thereof, wherein the bacillus licheniformis is preserved in the China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.24738 and the preservation date of 2022 years, 4 months and 21 days. And the culture method of the bacillus licheniformis, and the fermentation liquor, the bacterial suspension, the growth promoting microbial agent and the microbial fertilizer prepared by the method. The bacillus licheniformis has good IAA synthesis capability, can synthesize siderophores and protease, has the functions of phosphate and potassium dissolving, promotes the absorption of crops on nutrient substances, and further promotes the growth and yield improvement of crops. The bacillus licheniformis has good acid and alkali resistance and salt tolerance, has good compatibility with other functional bacteria, and creates conditions for the application of the bacillus licheniformis in different crop growth environments.
Description
Technical Field
The application relates to the technical field of agricultural microorganisms, in particular to bacillus licheniformis and application thereof.
Background
Soil microorganisms are an important component in an agricultural ecological system, and microorganisms with a growth promoting function are used as a part of agricultural microorganisms, can directly or indirectly promote the growth and the fertility of crops, and have important significance for the high-yield planting of the crops. Growth-promoting bacteria promote crop growth by different mechanisms of action, such as synthesis of indoleacetic acid (IAA). The IAA is a main hormone for regulating the growth and development of plants, and can promote the absorption and utilization of nutrients by crops. The IAA synthesis capability of the strain is a key index for measuring the growth promoting capability of the strain. In addition, the strain can also promote the growth of crops by synthesizing siderophores, protease, phosphate dissolving, potassium dissolving and the like. The amount or the type of the products synthesized by the growth-promoting bacteria is also an important factor for measuring the growth-promoting capacity and the industrialization of the strains, and the more the amount or the type of the products synthesized by the growth-promoting bacteria is, the more the potential and the value of the agricultural application are outstanding.
Tolerance of microorganisms to acid and base, salt concentrations, and compatibility with other strains are important factors in strain survival and functional expression. Microorganisms with low environmental stress tolerance often die or hibernate and are difficult to express functionality, and microorganisms with high environmental stress tolerance are easier to survive and propagate in soil; the strain with good compatibility with other functional strains is easier to be compounded with the functional strains without antagonism, achieves the effect of synergy, and is more beneficial to promoting the growth of crops and increasing the yield of the crops.
The bacillus licheniformis has higher safety in the safe classification catalogue of strains in rural areas of agriculture and has larger application potential in agriculture. However, the existing bacillus licheniformis is limited in growth promoting function or poor in adaptability to extreme environments, and application of the bacillus licheniformis in agriculture is limited.
The bacillus licheniformis with obvious growth promoting function and strong environmental adaptability is more beneficial to the survival and propagation of the bacillus licheniformis in soil, thereby exerting the high-efficiency growth promoting function of the bacillus licheniformis. The digging and application of the growth-promoting bacteria with rich metabolites and higher environmental tolerance have important significance for the high-yield planting of agriculture.
Disclosure of Invention
In order to improve the growth promoting effect and the environment tolerance of the bacillus licheniformis, the application provides bacillus licheniformis and application thereof. The bacillus licheniformis has high IAA secretion amount, has the capacity of secreting siderophores and proteases and dissolving phosphorus and potassium, and has very obvious growth promoting effect on crops; the bacillus licheniformis has good acid and alkali resistance and salt tolerance, and has strong adaptability to the environment; the compatibility with other strains is good, and conditions are created for the application of the strain in agriculture.
In a first aspect, the present application provides a bacillus licheniformis, which adopts the following technical scheme:
the bacillus licheniformis is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.24738 and the preservation date of 2022 years, 4 months and 21 days.
In the present application, the Bacillus licheniformis is named Bacillus licheniformis S05.
In the application, the bacillus licheniformis is obtained by separating and screening rhizosphere soil in autonomous county of Ledong Li nationality of Hainan province, and the bacillus licheniformis obtained by separation has good acid and alkali resistance and tolerance to high salt ion concentration, has good compatibility with other functional bacteria, can stably survive and propagate in the soil, and creates conditions for application of the bacillus licheniformis in different crop growth environments.
In the application, the bacillus licheniformis has good IAA synthesis capacity which can reach 53.26 mu g/mL. In addition, the bacillus licheniformis can also synthesize an iron carrier, so that an iron-iron carrier complex is formed with insoluble iron in soil, and the absorption and utilization of nutrient elements by plants are promoted. The bacillus licheniformis also has protease synthesis capacity, and on one hand, the bacillus licheniformis can decompose protein in the fertilizer and promote absorption of nutrient substances; on the other hand, the secreted protease can decompose the cell membrane of pathogenic bacteria, inhibit the pathogenic bacteria and reduce the consumption of nutrients by physiological metabolism of the pathogenic bacteria. The bacillus licheniformis also has the functions of phosphate and potassium dissolving, and can convert phosphorus and potassium which are difficult to be absorbed by crops in soil into forms which are easy to be absorbed, so that the absorption and utilization efficiency of the crops on the elements is improved. Through the mutual matching of the functions, the bacillus licheniformis has obvious effect of promoting the growth of crops.
In a second aspect, the present application provides a method for culturing the bacillus licheniformis, which adopts the following technical scheme:
a method for culturing Bacillus licheniformis, which comprises the following steps:
inoculating the bacillus licheniformis in a culture medium, and culturing for 12-50 h at 25-40 ℃.
In the application, the bacillus licheniformis culture medium is simple in components, the culture method is easy to operate, and conditions are created for large-scale production and application of the bacillus licheniformis culture medium.
In some specific embodiments, the temperature of the culture is 25-28 ℃, 25-30 ℃, 25-37 ℃, 28-30 ℃, 28-37 ℃, 28-40 ℃, 30-37 ℃, 30-40 ℃ or 37-40 ℃, etc.
In a specific embodiment, the temperature of the culture is 25 ℃,28 ℃,30 ℃,37 ℃ or 40 ℃ and the like.
In some particular embodiments of the present invention, the substrate is, the culture time is 12-15 h, 12-18 h, 12-20 h, 12-22 h, 12-24 h, 12-28 h, 12-30 h, 12-35 h, 12-40 h, 12-48 h, 15-18 h, 15-20 h, 15-22 h, 15-24 h, 15-28 h, 15-30 h, 15-35 h, 15-40 h, 15-48 h, 15-50 h, 18-20 h, 18-22 h, 18-24 h, 18-28 h, 18-30 h, 18-35 h, 18-40 h, 18-48 h, 18-50 h, 20-22 h, 20-24 h, 20-28 h 20 to 30 hours, 20 to 35 hours, 20 to 40 hours, 20 to 48 hours, 20 to 50 hours, 22 to 24 hours, 22 to 28 hours, 22 to 30 hours, 22 to 35 hours, 22 to 40 hours, 22 to 48 hours, 22 to 50 hours, 24 to 28 hours, 24 to 30 hours, 24 to 35 hours, 24 to 40 hours, 24 to 48 hours, 24 to 50 hours, 28 to 30 hours, 28 to 35 hours, 28 to 40 hours, 28 to 48 hours, 28 to 50 hours, 30 to 35 hours, 30 to 40 hours, 30 to 48 hours, 30 to 50 hours, 35 to 40 hours, 35 to 48 hours, 35 to 50 hours, 40 to 48 hours, 40 to 50 hours or 48 to 50 hours and the like.
In a specific embodiment, the culturing time is 12h, 15h, 18h, 20h, 22h, 24h, 28h, 30h, 35h, 40h, 48h, 50h, or the like.
In a third aspect, the present application provides a fermentation broth, which adopts the following technical scheme:
a fermentation broth obtained by fermentation with the bacillus licheniformis of the first aspect.
In a fourth aspect, the present application provides a bacterial suspension, which adopts the following technical scheme:
a bacterial suspension prepared using the bacillus licheniformis of the first aspect.
In a fifth aspect, the invention provides the use of a bacillus licheniformis solution of the first aspect, a fermentation broth of the third aspect or a bacterial suspension of the fourth aspect in the preparation of a growth-promoting microbial agent.
In a sixth aspect, the invention provides a growth-promoting microbial agent, which adopts the following technical scheme:
a growth-promoting microbial inoculant comprising the bacillus licheniformis of the first aspect, the fermentation broth of the third aspect, or the bacterial suspension of the fourth aspect.
Preferably, the effective viable count of the bacillus licheniformis in the growth-promoting microbial agent is not less than 1 hundred million/mL, or the effective viable count of the bacillus licheniformis in the growth-promoting microbial agent is not less than 5 hundred million/g.
In some specific embodiments, the growth-promoting microbial agent is a liquid, wherein the effective viable bacteria number of the Bacillus licheniformis is 1-2 hundred million/mL, 1-3 hundred million/mL, 1-4 hundred million/mL, 1-5 hundred million/mL, 1-6 hundred million/mL, 1-7 hundred million/mL, 1-8 hundred million/mL, 1-9 hundred million/mL, 1-10 hundred million/mL, 2-3 hundred million/mL, 2-4 hundred million/mL, 2-5 hundred million/mL, 2-6 hundred million/mL, 2-7 hundred million/mL, 2-8 hundred million/mL, 2-9 hundred million/mL, 2-10 hundred million/mL, 3-4 hundred million/mL, 3-5 hundred million/mL, 3-6 hundred million/mL, 3-7 hundred million/mL, 3-8 hundred million/mL 3-9, 3-10, 4-5, 4-6, 4-7, 4-8, 4-9, 4-10, 5-6, 5-7, 5-8, 5-9, 5-10, 6-8, 6-9, 6-10, 7-8, 7-9, 7-10, 8-9, 8-10, or 9-10 hundred million/mL, etc.
In a particular embodiment, the pro-microbial agent is a liquid, wherein the effective viable count of Bacillus licheniformis is 1 hundred million/mL, 2 hundred million/mL, 3 hundred million/mL, 4 hundred million/mL, 5 hundred million/mL, 6 hundred million/mL, 7 hundred million/mL, 8 hundred million/mL, 9 hundred million/mL, or 10 hundred million/mL, and the like.
In some specific embodiments, the growth-promoting microbial agent is a solid, wherein the effective viable count of the bacillus licheniformis is 5-5.5 hundred million/g, 5-6 hundred million/g, 5-6.5 hundred million/g, 5-7 hundred million/g, 5-7.5 hundred million/g, 5-8.5 hundred million/g, 5-9 hundred million/g, 5-9.5 hundred million/g, 5-10 hundred million/g, 5.5-6 hundred million/g, 5.5-6.5 hundred million/g, 5.5-7.5 hundred million/g, 5.5-8 hundred million/g, 5.5-8.5 hundred million/g, 5.5-9 hundred million/g, 5.5-9.5 million/g, 5.5-10 hundred million/g, 6-6.5 hundred million/g, 6-7 hundred million/g, 6-7.5 hundred million/g, 6-8.5 hundred million/g, 6-6.5 hundred million/g, 6-9.5 million/g, 6-9 hundred million/g, 6.5 hundred million/g 6-10 hundred million/g, 6.5-7 hundred million/g, 6.5-7.5 hundred million/g, 6.5-8 hundred million/g, 6.5-8.5 hundred million/g, 6.5-9.5 hundred million/g, 6.5-10 hundred million/g, 7-7.5-8 hundred million/g, 7-8.5 million/g, 7-9 hundred million/g, 7-9.5 million/g, 7-10 hundred million/g, 7.5-8.5 million/g, 7.5-9.5 million/g, 7.5-10 million/g, 8-8.5 million/g, 8-9 hundred million/g, 8-9.5 million/g, 8-10.5 hundred million/g, 8-10 hundred million/g, 8.5-9.5-9 hundred million/g, 8.5-9.5 million/g, 8-5 hundred million-9.5 million/g, 8.5-5 hundred million/g, 9.5-9.5 million/g, 6.5-9.5 million/g, 9 to 10 hundred million/g or 9.5 to 10 hundred million/g, etc.
In a particular embodiment, the pro-microbial agent is a solid, wherein the effective viable count of Bacillus licheniformis is 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 billion/g, and the like.
In a seventh aspect, the invention provides the use of a bacillus licheniformis in the first aspect, a fermentation broth in the third aspect, a bacterial suspension in the fourth aspect or a growth-promoting microbial agent in the sixth aspect in the preparation of a microbial fertilizer.
In the application, the growth-promoting microbial agent is mixed with a conventional fertilizer for use, so that a synergistic effect is generated. The conventional fertilizer contains abundant nitrogen, phosphorus and potassium elements, but lacks biological growth promoting substances, and the absorption efficiency of the phosphorus and potassium elements is not high, so that the fertilizer has no obvious effect of promoting the growth of crops. After being mixed with the growth-promoting microbial agent, the bacillus licheniformis in the microbial agent can synthesize and secrete biological growth-promoting substances such as IAA, siderophores, protease and the like, and simultaneously can convert phosphorus elements and potassium elements which are difficult to absorb in the fertilizer into forms which are easier to absorb, so that the utilization efficiency of the fertilizer is improved, and the growth of crops is remarkably promoted.
In an eighth aspect, the invention provides a microbial fertilizer, which adopts the following technical scheme:
a microbial fertilizer comprising the bacillus licheniformis of the first aspect, the fermentation broth of the third aspect, the bacterial suspension of the fourth aspect, or the growth-promoting microbial agent of the sixth aspect.
In a ninth aspect, the present application provides use of the bacillus licheniformis of the first aspect, the fermentation broth of the third aspect, the bacterial suspension of the fourth aspect, the growth-promoting microbial inoculant of the sixth aspect or the microbial fertilizer of the eighth aspect in crop cultivation.
In summary, the present application has the following beneficial effects:
1. the bacillus licheniformis in the application has good promotion effect on the growth of crops: the IAA synthesis capacity can reach 53.26 mu g/mL, the growth of roots is promoted, and the transport capacity of nutrient substances is improved; it can also secrete siderophores and proteases, improves the absorption and utilization of iron elements and protein substances, and has certain disease prevention and control effects; the bacillus licheniformis also has the functions of phosphate and potassium dissolution, and improves the utilization efficiency of the crops on the phosphorus element and the potassium element. Through the mutual cooperation of the functions, the crop plants are more robust, and the yield and the fruit quality are also improved.
2. The bacillus licheniformis in the application also has good environmental tolerance: the growth in the pH value range of 4-11 is basically not influenced, and the acid and alkali resistance is good; can normally grow under the concentration of 5 to 17.5 percent of NaCl, can survive under the concentration of 20.0 percent of NaCl, and has stronger salt tolerance; normal physiological metabolism can be carried out at 25-40 ℃. The characteristics make the crops survive and propagate in soil more easily, thereby better playing the functions of the crops and creating conditions for the application of the crops in different crop growing environments. In addition, the bacillus licheniformis has good compatibility with other strains, and provides a foundation for preparing a composite product with other functional bacteria.
3. The bacillus licheniformis in the application belongs to the first-level strain of the agricultural rural part strain safety classification catalogue, is safe in strain, simple in production process, short in production period and low in raw material cost, is suitable for industrial production, and has great application potential in high-yield and healthy planting of crops.
4. The bacillus licheniformis can be mixed with a conventional fertilizer to prepare a microbial fertilizer, the microbial fertilizer contains inorganic nutrient elements such as rich nitrogen, phosphorus and potassium, and biological growth promoting substances such as IAA, siderophores, protease and the like, and the phosphorus and potassium elements which are not easy to absorb in the fertilizer are converted into a form which is easy to absorb by matching with the phosphorus and potassium dissolving effects of the bacillus licheniformis, so that the utilization efficiency of the fertilizer is improved, the synergistic gain is realized, and the promotion effect on the growth of crops is very obvious.
Drawings
FIG. 1 is a photograph showing the colony morphology of the strain having IAA synthesizing ability in example 2.
FIG. 2 is a photograph showing the cell morphology of the IAA-synthesizing strain of example 2 (magnification =1000 times).
FIG. 3 is a photograph showing the construction results of a phylogenetic tree of the IAA-synthesizing strain of example 2.
FIG. 4 is a photograph showing the results of measurement of siderophore synthesis ability of Bacillus licheniformis S05 in example 3.
FIG. 5 is a graph showing the results of measurement of the protease synthesizing ability of Bacillus licheniformis S05 in example 3.
FIG. 6 is a graph showing the results of measurement of the phosphate-solubilizing ability of Bacillus licheniformis S05 in example 3.
FIG. 7 is a graph showing the results of measurement of potassium-solubilizing ability of Bacillus licheniformis S05 in example 3.
FIG. 8 is a photograph showing the results of the strain compatibility measurement of Bacillus licheniformis S05 in example 4.
FIG. 9 is a photograph showing the results of culturing pepper plants of different groups in example 7.
Fig. 10 is a picture of different groups of pepper fruits in example 8.
Detailed Description
The application provides Bacillus licheniformis, which is named as Bacillus licheniformis S05, wherein the Bacillus licheniformis is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.24738 and the preservation date of 2022 years, 4 months and 21 days.
The application also provides a culture method of the bacillus licheniformis, which specifically comprises the following steps:
inoculating the bacillus licheniformis into a culture medium, and culturing for 18-50 h at 25-50 ℃.
Specifically, the culture medium comprises an LB culture medium, a beef extract peptone culture medium or a fermentation culture medium.
Specifically, the LB medium comprises 10g/L of peptone, 5g/L of yeast powder and 10g/L of NaCl.
Specifically, the beef extract peptone medium comprises 3.0g/L beef extract, 10.0g/L peptone, 5.0g/L NaCl and 15g/L agar, and the pH value is 7.2-7.5.
Specifically, the fermentation medium comprises 12g/L of glucose, 8g/L of tryptone, 8g/L of yeast powder, 1g/L of monopotassium phosphate, 0.5g/L of magnesium sulfate, 0.5g/L of manganese sulfate and 2g/L of calcium carbonate.
The application also provides a fermentation liquid, wherein the fermentation liquid is obtained by fermenting the bacillus licheniformis.
The application also provides a bacterial suspension prepared by using the bacillus licheniformis.
The invention also provides a growth-promoting microbial agent which comprises the bacillus licheniformis, fermentation liquor or bacterial suspension.
Specifically, the growth-promoting microbial agent is liquid, wherein the effective viable count of the bacillus licheniformis is not less than 1 hundred million/mL.
Specifically, the growth-promoting microbial agent is solid, wherein the effective viable count of the bacillus licheniformis is not less than 5 hundred million/g.
The application also provides a microbial fertilizer, which comprises the bacillus licheniformis, fermentation liquor, bacterial suspension or growth-promoting microbial agent.
The technical solution of the present application will be further described below with reference to examples 1 to 9 and accompanying drawings 1 to 10.
Example 1
This example provides a method for isolating a strain having IAA synthesizing ability. The strain with IAA synthesis capacity is separated from rhizosphere soil of crops, and the separation steps are as follows:
(1) Strain separation:
preparation of LB solid medium:
weighing 10g of peptone, 5g of yeast powder, 10g of NaCl and 15g of agar, adding water to a constant volume of 1000mL, and carrying out autoclaving at 121 ℃ for 30min. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.
Preparation of LB liquid Medium:
weighing 10g of peptone, 5g of yeast powder and 10g of NaCl, adding water to a constant volume of 1000mL, carrying out autoclaving at 121 ℃ for 30min, and cooling for later use.
Weighing 10g of the collected rhizosphere soil, adding the rhizosphere soil into an erlenmeyer flask filled with 90mL of sterile water, shaking at 150rpm for 30min, and standing for 2h.
Taking the supernatant and standing according to 10 -2 ～10 -5 Is diluted by a concentration gradient of (a). After dilution, 100. Mu.L of each concentration gradient was pipetted and spread on the surface of LB solid medium and cultured at 28 ℃ for 24 hours.
After single bacteria grow on the surface of the culture medium, selecting according to the colony morphology, color and size, purifying and storing on a solid culture medium, and co-separating to obtain 15 strains of bacteria which are respectively named as S01, S02, S03, 8230, 8230and S15.
(2) Primary screening:
preparation of Salkowski developing solution:
1 mL of 0.5mol/L FeCl is taken 3 The solution was added to 500mL of 35% perchloric acid and mixed well for use.
Inoculating the separated and purified strain into LB liquid culture medium containing L-tryptophan with the mass concentration of 100mg/L, performing shake culture at 37 ℃ and 200rpm for 24h, dripping 50 mu L of strain suspension on the surface of the LB solid culture medium, and simultaneously adding an equivalent amount of Salkowski developing solution for developing reaction.
As a positive control, 50. Mu.L of IAA (50 mg/L) was added dropwise to LB solid medium. The solid culture medium is observed after being placed for 30min at room temperature in a dark condition, and the IAA can be synthesized when the color turns red.
(3) Re-screening:
inoculating the screened strain into LB liquid culture medium, shake culturing at 37 deg.C and 200rpm for 24h, taking out, centrifuging at 4000rpm for 15min, mixing 4mL of supernatant with equal volume of Salkowski color developing agent, reacting at 25 deg.C in dark place for 30min, and determining OD 530 And (5) calculating the IAA content in the bacteria liquid according to an IAA standard curve regression equation at the nm position.
The method for making the IAA standard curve comprises the following steps: the preparation mass concentrations are respectively 0, 10 mu g/mL, 20 mu g/mL, 30 mu g/mL and 40 mu g/mL50. Mu.g/mL and 60. Mu.g/mL IAA standard solutions, and mixed with Salkowski developer at a volume ratio of 1 530 The same operation was performed with a mixture of distilled water and Salkowski developer at a volume ratio of 1.
The screening results of the strains are shown in Table 1.
TABLE 1 screening results of the strains
As can be seen from Table 1, 8 of the 15 isolated strains have color reaction, which indicates that the 8 strains can metabolize and synthesize IAA, wherein the IAA synthesis amount of S05 is the highest and can reach 53.26 mu g/mL, which is obviously higher than that of other strains, and the strain has great growth promotion potential.
Example 2
This example provides a procedure for identifying the above-described strains having IAA-synthesizing ability.
The strain S05 having IAA synthesis ability isolated in example 1 was subjected to morphological identification, molecular biological identification and phylogenetic identification, respectively.
Morphological identification
Preparation of beef extract peptone culture medium:
weighing 3.0g of beef extract, 10.0g of peptone, 5.0g of NaCl and 15g of agar, adding water to dissolve, adjusting the pH to 7.2-7.5, adding water to fix the volume to 1000mL, and sterilizing at 121 ℃ under high pressure for 30min. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.
Inoculating the strain S05 with IAA synthesis capacity to the surface of a beef extract peptone culture medium by adopting a four-zone streaking method, culturing at 30 ℃ for 48 hours, observing the colony morphology, and observing the thallus morphology by gram staining.
The colony morphology of the strain with IAA synthesizing ability is shown in FIG. 1. After 48h culture, the colony of the strain S05 is milky white, irregular in edge but close to circular, and small as seen in FIG. 1.
FIG. 2 shows the morphological pattern of the cells of a strain having IAA-synthesizing ability. When the strain S05 is observed under a microscope after gram staining, as can be seen from figure 2, the strain S05 is a gram-positive bacterium and is rod-shaped, and can appear singly or in pairs.
Molecular biological identification
The species of the microorganism is identified by 16S rDNA sequencing technology and colony PCR technology.
Inoculating the separated and screened S05 strain on the surface of an LB solid medium, culturing overnight, selecting different fresh single colonies, respectively placing the different fresh single colonies into 1.5mL centrifuge tubes, adding 10 mul of | S2 lysate (purchased from Beijing engine biotechnology, inc.), shaking and uniformly mixing, standing at room temperature for 20min, then diluting by 20 times, shaking and uniformly mixing, centrifuging at 12000rpm for 2min, taking the supernatant as a template, and carrying out PCR amplification.
The amplification primers were as follows:
27F(SEQ ID No.1)：AGAGTTTGATCCTGGCTCAG；
1492R(SEQ ID No.2)：TACGGCTACCTTGTTACGACTT。
amplification reagents: 2 × EasyTaq SuperMix (available from Biotechnology Ltd. Of Kyoengine, beijing).
The amplification procedure was as follows:
94℃ 5min；
30s at 94 ℃; 30s at 55 ℃; 90s at 72 ℃; circulating for 35 times;
storing at 72 deg.C for 7min and 4 deg.C.
The reaction system for colony PCR is shown in Table 2.
TABLE 2 reaction System for colony PCR
| Reagent | Amount of use (mu L) |
| 2×EasyTaq SuperMix | 15 |
| 27F(10μM) | 1.5 |
| 1492R(10μM) | 1.5 |
| Form panel | 5 |
| ddH 2 O | 7 |
| Total volume | 30 |
The formulation of the agarose gel is shown in table 3.
TABLE 3 agarose gel formulation
And (4) carrying out agarose gel electrophoresis on the PCR amplification product, and recovering and purifying the gel block. And performing Sanger sequencing on the purified product to obtain a forward and reverse sequencing result, wherein the 16S rDNA sequence of the forward and reverse sequencing result is shown in SEQ ID No. 3.
Phylogenetic identification
The data obtained are spliced by DNAMAN software, 16S rDNA sequences are compared in a www.ezbiochoud.net database, the repetitive times are estimated for 1000 times by Mega 5.0 software by adopting a Neighbor-Joining method and Bootstrap confidence value, a phylogenetic evolutionary tree is constructed, the position of a strain S05 in the phylogenetic tree is determined, and the construction result of the phylogenetic tree is shown in figure 3. According to FIG. 3, the identification alignment shows that the S05 strain is Bacillus licheniformis (Bacillus licheniformis).
The Bacillus licheniformis S05 is preserved in China general microbiological culture Collection center (CGMCC) in 2022 for 4 and 21 months, wherein the preservation address is No.3 of Xilu No. 1 of Beijing facing Yang district, the postal code is 100101, and the preservation number is CGMCC No.24738.
Example 3
This example provides methods for measuring the siderophore synthesis ability, protease synthesis ability, phosphate solubilizing ability and potassium solubilizing ability of the Bacillus licheniformis S05 described above.
Determination of the Synthesis Capacity of siderophores
The preparation method of 0.1mol/L phosphate buffer solution comprises the following steps:
5.91g of sodium dihydrogen phosphate, 24.27g of disodium hydrogen phosphate, 2.50g of ammonium chloride, 0.75g of potassium dihydrogen phosphate and 1.25g of sodium chloride are weighed, and deionized water is added to the mixture to reach the volume of 1L.
Preparation method of culture medium containing iron carrier CAS:
60.5mg of CAS (available from Shanghai Michelin Biochemical technology Co., ltd.), 72.9mg of hexadecyltrimethylammonium bromide (HDTMA), and 1mmol/L of FeCl were weighed 3 ·6H 2 10mL of O (prepared by 10mmol/L HCl), 50mL of 0.1mol/L phosphate buffer solution and 9.0g of agar, adding deionized water to the volume of 1000mL, and sterilizing the mixture for 30min at 121 ℃. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.
The method for measuring the synthetic capacity of the siderophore comprises the following steps:
the activated Bacillus licheniformis S05 is inoculated in blue culture medium containing iron carrier CAS and cultured for 48h at 28 ℃. If the bacteria synthesize siderophores, chelating iron (ferric iron) in the medium, a reddish halo is produced around the colony.
FIG. 4 is a graph showing the results of measurement of siderophore synthesis ability of Bacillus licheniformis S05. As shown in FIG. 4, bacillus licheniformis S05 can synthesize siderophore with halo diameter up to 28.5mm, which indicates that Bacillus licheniformis S05 can promote the absorption and utilization of iron by plants via siderophore synthesis, and further promote the growth of crops.
Determination of protease Synthesis Capacity
The preparation method of the protease detection culture medium comprises the following steps:
weighing 5.00g of tryptone, 3.00g of yeast extract, 1.00g of glucose and 15.00g of agar, adding distilled water to dissolve, adjusting the pH to 7.0, adding distilled water to a constant volume of 1000mL, and sterilizing at 121 ℃ under high pressure for 30min. And cooling the sterilized culture medium to 50 ℃, adding the skim milk into the culture medium according to the volume ratio of 10%, uniformly mixing, pouring into a culture dish, and cooling for later use.
Inoculating activated Bacillus licheniformis S05 on the surface of a protease detection culture medium, culturing at 28 ℃ for 48h, and observing whether a lysis ring appears.
FIG. 5 is a graph showing the results of measurement of the protease synthesizing ability of Bacillus licheniformis S05. As shown in FIG. 5, bacillus licheniformis S05 has good protein dissolving capacity and high protease yield, and the dissolving ring diameter can reach 21.1mm.
Determination of phosphate solubilizing ability
The preparation method of the phosphate solubilizing culture medium comprises the following steps:
weighing 10g of glucose, 5g of calcium phosphate, 0.1g of ammonium sulfate, 0.2g of potassium chloride, 0.25g of magnesium sulfate, 5g of magnesium chloride heptahydrate and 15g of agar, adding distilled water to dissolve, adjusting the pH to 6.8-7.0, adding distilled water to constant volume of 1L, and sterilizing at 121 ℃ for 30min under high pressure. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.
Inoculating activated Bacillus licheniformis S05 on the surface of a phosphate solubilizing culture medium, culturing at 28 ℃ for 48h, and observing whether a lysis ring appears.
FIG. 6 is a graph showing the measurement results of the phosphate-solubilizing ability of Bacillus licheniformis S05. As shown in figure 6, the Bacillus licheniformis S05 has the phosphate-solubilizing capability, and the diameter of a dissolving ring for dissolving the organic phosphorus can reach 29.8mm.
Determination of Potassium-resolving Capacity
The preparation method of the potassium dissolving culture medium comprises the following steps:
weighing 10g of sucrose, 0.5g of yeast powder, 0.5g of magnesium sulfate heptahydrate, 1g of ammonium sulfate, 2g of disodium hydrogen phosphate, 1g of calcium carbonate, 1g of potassium feldspar powder and 15g of agar, adding deionized water to dissolve, adjusting the pH value to 7.0, adding deionized water to a constant volume of 1L, and sterilizing at 121 ℃ for 30min under high pressure. And cooling the sterilized culture medium to 50 ℃, uniformly mixing, pouring into a culture dish, and cooling for later use.
Inoculating activated Bacillus licheniformis S05 on the surface of a potassium-dissolving culture medium, culturing at 28 ℃ for 48h, and observing the appearance of an oil-drop-shaped dissolving ring.
FIG. 7 is a graph showing the results of measurement of potassium-solubilizing ability of Bacillus licheniformis S05. As shown in figure 7, the Bacillus licheniformis S05 has potassium-dissolving capacity, and the diameter of the oil drop-shaped dissolving ring can reach 11.8mm.
Example 4
This example provides methods for determining acid-base tolerance, salt concentration tolerance and strain compatibility of Bacillus licheniformis S05 described above.
Acid-base tolerance determination
Inoculating activated Bacillus licheniformis S05 into LB liquid culture medium with pH values of 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0, respectively, shake culturing at 37 deg.C and 180rpm for 24 hr, and measuring OD of culture medium with different pH values 600 The numerical values and results are shown in Table 4.
TABLE 4 determination of the acid-base tolerance of Bacillus licheniformis S05
As can be seen from Table 4, the growth of Bacillus licheniformis S05 in the pH range of 4-11 is not affected basically, which shows that the Bacillus licheniformis S05 has very strong acid and alkali resistance and creates conditions for the application in different crop production environments.
Salt concentration tolerance determination
After activationRespectively inoculating Bacillus licheniformis S05 into LB liquid culture medium with NaCl concentration of 5.0%, 10.0%, 12.5%, 15.0%, 17.5% and 20.0%, shaking and culturing at 37 deg.C and 180rpm for 24 hr, and measuring OD of culture medium with different NaCl concentrations 600 The numerical values and results are shown in Table 5.
TABLE 5 determination of tolerance to Bacillus licheniformis S05 salt concentration
As can be seen from Table 5, bacillus licheniformis S05 grew normally at NaCl concentrations of 5% to 17.5%, and at 20.0% NaCl, it was still viable, indicating that Bacillus licheniformis S05 had high salt tolerance.
Strain compatibility assay
The strain compatibility test is carried out on the Bacillus licheniformis S05 and representative functional bacteria of Bacillus subtilis KC-06, bacillus amyloliquefaciens JDF-03 and Bacillus beleisis DPT-03 (the preservation number is CGMCC No. 20317) screened and separated and stored in the laboratory.
The strains are respectively activated and are subjected to streak culture on the surface of an LB solid medium in a mutual contact manner. The results are shown in table 6 and fig. 8.
TABLE 6 compatibility assay results for Bacillus licheniformis S05
In a strain compatibility assay, "+" indicates no antagonism between strains, "o" indicates that strains are micro-antagonistic but do not inhibit mutual growth, and "-" indicates that strains are antagonistic and inhibit mutual growth.
FIG. 8 is a photograph showing the results of strain compatibility measurement of Bacillus licheniformis S05.
As can be seen from Table 6 and FIG. 8, bacillus licheniformis S05 was compatible with Bacillus subtilis, bacillus amyloliquefaciens and Bacillus belgii and did not produce antagonism. The compatibility of the strain determines the functional expression of the strain and other functional strains under the compounding condition, and the good compatibility of the strain is more beneficial to the survival and the propagation of the strain in soil and is also beneficial to the industrialized research of strain compounding.
Example 5
The liquid microbial inoculum of the bacillus licheniformis S05 is prepared by the following steps:
preparation of a fermentation medium:
weighing 12g of glucose, 8g of tryptone, 8g of yeast powder, 1g of monopotassium phosphate, 0.5g of magnesium sulfate, 0.5g of manganese sulfate and 2g of calcium carbonate, adding water to a constant volume of 1000mL, carrying out autoclaving at 121 ℃ for 30min, and cooling for later use.
(1) Activating strains: inoculating the preserved bacillus licheniformis S05 on the surface of an LB solid culture medium through streaking, and culturing for 22-28 h at 37 ℃; and selecting a single colony, streaking and transferring the single colony to the surface of an LB solid culture medium again, and culturing the single colony for 22 to 28 hours at 37 ℃.
(2) Preparing a first-level seed solution: scraping the activated bacillus licheniformis S05 in the two-ring step (1), inoculating the bacillus licheniformis S05 in an LB liquid culture medium, and performing shake culture at 37 ℃ and 120-150 rpm for 18-24 h to obtain a first-stage seed solution.
(3) Preparing a secondary seed liquid: inoculating the primary seed liquid into a fermentation tank filled with LB liquid culture medium according to the proportion of 5-8% (v: v) for fermentation culture under the conditions of the rotation speed of 150-180 rpm, the temperature of 37 ℃, the air permeability of 1 (0.8-1.2) and the filling pressure of 0.04-0.06 MPa for 12-18 h to obtain the secondary seed liquid.
(4) And (3) fermentation liquor culture: inoculating the secondary seed liquid into a fermentation tank filled with a fermentation culture medium according to the proportion of 5-10% (v: v) for fermentation culture under the conditions of the rotation speed of 150-180 rpm, the temperature of 37 ℃, the air permeability of 1 (0.8-1.2) and the filling pressure of 0.04-0.06 MPa for 20-30 h to obtain the liquid microbial inoculum of the bacillus licheniformis S05.
Example 6
The solid microbial inoculum of the bacillus licheniformis S05 is prepared by the embodiment by the following steps:
filtering the liquid microbial inoculum of the bacillus licheniformis S05 prepared in the embodiment 5 by a ceramic membrane to remove supernatant, then slowly adding diatomite or zeolite powder into the precipitate as a carrier matrix, uniformly stirring, carrying out spray drying, dispersing by an atomizer (about 65 ℃) and quickly evaporating to dryness by high-temperature air (180 ℃), and collecting solid substances in the feed liquid by a cyclone separator to obtain the solid microbial inoculum of the bacillus licheniformis S05.
Example 7
This example demonstrates the growth promoting ability of the liquid microbial inoculum of bacillus licheniformis S05 prepared in example 5 on pepper, and the steps are as follows:
a special plastic pot with the inner diameter of 15cm and the height of 20cm is adopted, 2kg of soil is filled in each pot, pepper seedlings with good growth vigor are transplanted into the pot, the seedlings are revived for 10 days, and the test is carried out after the seedlings recover to the healthy growth vigor.
The experiment was divided into 3 treatment groups, treatment 1: adding 10mL of liquid microbial inoculum of Bacillus licheniformis S05 (the effective viable count is more than or equal to 1.0 hundred million/mL) into the pot culture, and watering for 30mL; and (3) treatment 2: adding 10mL of fermentation medium (without bacteria) into the pot culture, and watering for 30mL; treatment 3 (control): only equal amounts of clear water were added and 5 replicates were set for each treatment group.
After 30 days, the plants were removed and washed clean with water, and the pictures of the culture results of the pepper plants of different groups are shown in fig. 9.
The plant is divided into an overground part and an underground part. The root length, stem height, stem thickness, dry weight of the aerial parts and dry weight of the underground parts were measured, and the measurement results are shown in Table 7.
TABLE 7 measurement results of growth promoting ability of liquid inoculum of Bacillus licheniformis S05 on Capsicum annuum L
| Treatment group | Plant height (cm) | Stem diameter (mm) | Root length (mm) | Ground dry weight (g) | Underground dry weight (g) |
| |
56.21 | 3.65 | 15.98 | 5.36 | 1.51 |
| Treatment 2 | 51.65 | 3.12 | 14.39 | 4.26 | 1.28 |
| Treatment 3 | 47.52 | 2.93 | 13.32 | 4.13 | 1.22 |
By combining the data in fig. 9 and table 7, it can be seen that the growth promoting effect of the liquid microbial inoculum of bacillus licheniformis S05 on pepper seedlings is very significant, and the plant height of treatment 1 is increased by 8.83% compared with treatment 2 and by 18.29% compared with treatment 3; the stem thickness is improved by 16.99 percent compared with that of the treatment 2 and is improved by 24.57 percent compared with that of the treatment 3; the root length is improved by 11.05 percent compared with that of the treatment 2 and is improved by 19.97 percent compared with that of the treatment 3; the dry weight on the ground is improved by 25.82 percent compared with the treatment 2 and is improved by 29.78 percent compared with the treatment 3; the underground dry weight is improved by 17.97 percent compared with the treatment 2 and 23.77 percent compared with the treatment 3. The results show that the liquid microbial inoculum of the bacillus licheniformis S05 can obviously promote the growth of the pepper, the plant height, the stem thickness, the root length, the ground dry weight and the ground dry weight are obviously increased, and the plant grows vigorously.
Example 8
In this embodiment, the solid microbial inoculum of bacillus licheniformis S05 prepared in example 6 is mixed with a fertilizer to prepare a microbial fertilizer, and the growth promoting ability of the microbial fertilizer is verified, the steps are as follows:
the test address is arranged in the Beijing valley, and the land area of each treatment area is 30m 2 . The test is totally provided with 3 treatment groups, each treatment group is repeated for 3 times, treatment areas are randomly selected, and the treatment groups are respectively as follows:
treatment 1: compound fertilizer (15-15, N + P) 2 O 5 +K 2 O, total nutrient is more than or equal to 45%), 40kg +40kg of solid microbial inoculum of bacillus licheniformis S05 (the number of effective viable bacteria is more than or equal to 5.0 hundred million/g, the name of effective strain: bacillus licheniformis);
and (3) treatment 2: compound fertilizer (15-15, N + P 2 O 5 +K 2 O, total nutrient is more than or equal to 45%), 40kg +40kg of commercial microbial agent (the number of effective viable bacteria is more than or equal to 5.0 hundred million/g, the name of effective strain: bacillus licheniformis);
and (3) treatment: compound fertilizer (15-15, N + P) 2 O 5 +K 2 O, total nutrient is more than or equal to 45 percent) of 40kg.
And respectively applying the fertilizer groups to the land of the corresponding treatment area, transplanting the pepper seedlings with good growth vigor into the land, planting 6 plants in each area, recovering the seedlings for 10 days, and carrying out a test after the seedlings recover to the healthy growth vigor. The plant height and stem thickness at the seedling stage, the plant height and stem thickness at the flowering and fruiting stage, and the individual fruit weight and yield at the harvest stage were measured for each group of capsicums, respectively, and the measurement results are shown in table 8.
TABLE 8 evaluation results of growth promoting effect of different groups of fertilizers on pepper
A picture of the fruit of different groups of peppers is shown in FIG. 10.
In combination with the data in fig. 10 and table 8, it can be seen that the plant height and stem thickness of the pepper of treatment 1 are significantly better than those of treatment 2 and treatment 3 during the seedling stage, indicating that the microbial fertilizer using the solid microbial inoculum containing bacillus licheniformis S05 has significant advantages in promoting the growth of the pepper during the seedling stage. In the flowering and fruiting period, the pepper stem thickness of the treatment 1 is obviously superior to that of the treatment 2 and the treatment 3, but the difference of the plant height among 3 treatment groups is not large, which shows that the microbial fertilizer containing the solid microbial inoculum of the bacillus licheniformis S05 can obviously improve the thickening degree of pepper stems. In the harvest period, the weight and yield of single fruits of the hot peppers which are applied with the microbial fertilizer containing the solid microbial inoculum of the bacillus licheniformis S05 have remarkable advantages, wherein the weight of the single fruits is 7.12 percent higher than that of the single fruits processed by 2 percent and 15.34 percent higher than that of the single fruits processed by 3 percent; the yield was 9.16% higher than treatment 2 and 18.75% higher than treatment 3. In conclusion, the microbial fertilizer containing the solid microbial inoculum of the bacillus licheniformis S05 has obvious advantages in promoting the growth of pepper seedlings, increasing the stout degree of plants in the flowering and fruiting period and increasing the pepper yield in the later period, and can obviously increase the planting benefit of crops.
Example 9
In this example, IAA synthesis ability, siderophore synthesis ability, protease synthesis ability, phosphate solubilizing ability, and potassium solubilizing ability of Bacillus licheniformis S05, bacillus belvedere DPT-03 (CGMCC No. 20317), bacillus licheniformis XW02 (CCTCC NO: M2020872), and Bacillus licheniformis LLH-6 (CCTCC NO: M2020162) in the present application were compared, and the specific steps are as shown above and the results are shown in Table 9.
TABLE 9 results of examining physiological metabolic characteristics of various strains
As can be seen from Table 9, bacillus licheniformis S05 was significantly superior in IAA synthesis, and the amount of synthesized bacteria was significantly higher than Bacillus beleisi DPT-03, bacillus licheniformis XW02 and Bacillus licheniformis LLH-6. In terms of siderophore synthesis capacity, the siderophore synthesis capacity of Bacillus licheniformis S05 was higher than Bacillus belgii DPT-03, but slightly lower than Bacillus licheniformis XW02, and Bacillus licheniformis LLH-6 did not have siderophore synthesis capacity. The protease synthesis capacity of Bacillus licheniformis S05 was slightly weaker than that of Bacillus licheniformis XW02 and Bacillus licheniformis LLH-6, and Bacillus belgii DPT-03 did not have protease synthesis capacity. On the basis of phosphate and potassium dissolving capacity, the bacillus licheniformis S05 is obviously superior to the bacillus beleisi DPT-03, the bacillus licheniformis XW02 and the bacillus licheniformis LLH-6.
In conclusion, the bacillus licheniformis S05 has obvious advantages in synthesizing IAA and activating soil nutrients (namely phosphate and potassium dissolution), and has great potential in promoting the growth of crops and improving the utilization rate of fertilizers. It also has the synthetic ability of siderophore and proteinase, and through the mutual cooperation of the above-mentioned actions, it can obviously promote the growth of crops and raise yield.
The acid-base tolerance and salt concentration tolerance of the above-mentioned Bacillus licheniformis S05, bacillus belgii DPT-03, bacillus licheniformis XW02 and Bacillus licheniformis LLH-6 were also tested in this example, pH values were set at 4.0, 7.0 and 11.0, naCl concentrations were set at 5%, 12.5% and 17.5%, and the results are shown in Table 10, see above.
TABLE 10 results of the determination of the acid-base tolerance and the salt concentration tolerance of different strains
As can be seen from Table 10, the OD of Bacillus licheniformis S05 was found to be within the acid-base tolerance under the acidic condition of pH 4 600 The value is higher than that of Bacillus belgii DPT-03, but the difference between the value and Bacillus licheniformis XW02 and Bacillus licheniformis LLH-6 is not great; OD of Bacillus licheniformis S05 at pH 11 under alkaline conditions 600 The values are higher than those of Bacillus belgii DPT-03, bacillus licheniformis XW02 and Bacillus licheniformis LLH-6. At salt concentration tolerance, at NaCl concentrationThe differences between the 4 strains were small at 5% and 12.5%, but the OD of B.licheniformis S05 at 17.5% NaCl 600 The value is higher than that of Bacillus belgii DPT-03, bacillus licheniformis XW02 and Bacillus licheniformis LLH-6, and the salt tolerance is stronger. The results show that the bacillus licheniformis S05 has prominent advantages under the high saline-alkali condition and has good application potential in saline-alkali soil.
The specific embodiments are only for explaining the present application and are not limiting to the present application, and those skilled in the art can make modifications to the embodiments without inventive contribution as required after reading the present specification, but all the embodiments are protected by patent law within the scope of the claims of the present application.
Claims (10)
1. The bacillus licheniformis is characterized in that the bacillus licheniformis is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, the preservation number is CGMCC No.24738, and the preservation date is 2022 years, 4 months and 21 days.
2. The method for culturing Bacillus licheniformis according to claim 1, wherein the method for culturing Bacillus licheniformis comprises:
inoculating the bacillus licheniformis into a culture medium, and culturing at 25-40 ℃ for 12-50 h.
3. A fermentation broth obtained by fermentation with the Bacillus licheniformis strain of claim 1.
4. An bacterial suspension prepared using the bacillus licheniformis of claim 1.
5. Use of the bacillus licheniformis according to claim 1, the fermentation broth according to claim 3 or the bacterial suspension according to claim 4 for producing a growth-promoting microbial agent.
6. A growth-promoting microbial inoculant comprising the bacillus licheniformis of claim 1, the fermentation broth of claim 3 or the bacterial suspension of claim 4.
7. The growth-promoting microbial inoculant according to claim 6, wherein the number of effective live bacteria of bacillus licheniformis in the growth-promoting microbial inoculant is not less than 1 hundred million/mL, or the number of effective live bacteria of bacillus licheniformis in the growth-promoting microbial inoculant is not less than 5 hundred million/g.
8. The use of the Bacillus licheniformis of claim 1, the fermentation broth of claim 3, the bacterial suspension of claim 4 or the growth-promoting microbial inoculant of any one of claims 6 to 7 in the preparation of a microbial fertilizer.
9. A microbial fertilizer, comprising the Bacillus licheniformis of claim 1, the fermentation broth of claim 3, the bacterial suspension of claim 4 or the growth promoting microbial agent of any one of claims 6 to 7.
10. Use of the bacillus licheniformis according to claim 1, the fermentation broth according to claim 3, the bacterial suspension according to claim 4, the growth-promoting microbial agent according to any of claims 6-7 or the microbial fertilizer according to claim 9 in crop cultivation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210864870.8A CN115960744A (en) | 2022-07-21 | 2022-07-21 | Bacillus licheniformis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210864870.8A CN115960744A (en) | 2022-07-21 | 2022-07-21 | Bacillus licheniformis and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115960744A true CN115960744A (en) | 2023-04-14 |
Family
ID=87353742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210864870.8A Pending CN115960744A (en) | 2022-07-21 | 2022-07-21 | Bacillus licheniformis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115960744A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117356221A (en) * | 2023-11-23 | 2024-01-09 | 西藏自治区农牧科学院草业科学研究所 | Method for improving germination of Phaffia scirpa seeds by utilizing soil-promoting bacteria |
| CN117448242A (en) * | 2023-12-20 | 2024-01-26 | 航天神舟生物科技集团有限公司 | Bacillus licheniformis and application thereof in field of planetary protection |
-
2022
- 2022-07-21 CN CN202210864870.8A patent/CN115960744A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117356221A (en) * | 2023-11-23 | 2024-01-09 | 西藏自治区农牧科学院草业科学研究所 | Method for improving germination of Phaffia scirpa seeds by utilizing soil-promoting bacteria |
| CN117356221B (en) * | 2023-11-23 | 2024-04-19 | 西藏自治区农牧科学院草业科学研究所 | Method for improving germination of Phaffia scirpa seeds by utilizing soil-promoting bacteria |
| CN117448242A (en) * | 2023-12-20 | 2024-01-26 | 航天神舟生物科技集团有限公司 | Bacillus licheniformis and application thereof in field of planetary protection |
| CN117448242B (en) * | 2023-12-20 | 2024-04-30 | 航天神舟生物科技集团有限公司 | Bacillus licheniformis and application thereof in field of planetary protection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110438037B (en) | Klebsiella sp 5 with phosphorus dissolving effect and application thereof | |
| CN101497542B (en) | Biological preparation containing plant growth promoting bacteria, as well as preparation and use thereof | |
| CN111117910B (en) | Enterobacter ludwigii PN6 and application thereof | |
| CN106164247A (en) | Inoculation microbial inoculum for stress soil | |
| CN115960744A (en) | Bacillus licheniformis and application thereof | |
| CN106754515B (en) | Screening method of growth promoting strains for improving salt tolerance of crops | |
| CN101481666B (en) | Plant promoting bacteria, microbial preparation containing the same and preparation thereof | |
| CN104263679B (en) | A kind of efficient phosphate-solubilizing bacterium and application thereof | |
| CN109280628B (en) | Enterobacter strain and application thereof in promoting growth of moso bamboos | |
| CN113321547A (en) | Rhizosphere growth promoting water-soluble microbial fertilizer and preparation method thereof | |
| CN113862189A (en) | Corn growth promoting, probiotic and biocontrol bacterial fertilizer integrated preparation and preparation method thereof | |
| CN102391973B (en) | Plant endogenetic bacterium with heavy metal tolerance and application thereof | |
| CN114908014B (en) | Tea-oil tree endophyte capable of promoting dissolution of ferric phosphate and application of tea-oil tree endophyte | |
| CN107162852B (en) | Soil phosphorus activator and preparation method and application thereof | |
| CN109576177B (en) | Chinese micro-rod strain SM8 and application thereof in salt tolerance and growth promotion | |
| CN113528398B (en) | Bacillus subtilis with phosphate and potassium solubilizing effects, microbial agent and application thereof | |
| CN102816719A (en) | Growth-promoting rhizobacteria SXH-2 and application thereof | |
| CN107628894A (en) | Composite bacteria agent increase soil fertility and its preparation method and application | |
| CN102827792A (en) | Plant growth-promoting rhizobacterium SXH-3 and application thereof | |
| CN110791459B (en) | Bacillus subtilis for preventing and controlling continuous cropping lily soil-borne blight and application thereof | |
| CN114921362B (en) | Oil tea endophyte with functions of dissolving insoluble phosphorus and promoting growth and application thereof | |
| CN115975848A (en) | Tropical bacillus and application thereof | |
| CN113604399B (en) | Sphingolipid bacteria with growth promoting function of garden plants and application thereof | |
| CN113913344B (en) | Organic material decomposing agent and preparation method thereof | |
| CN115594549A (en) | Microbial organic fertilizer for improving saline-alkali soil plough layer structure and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |