CN115960177A

CN115960177A - Adeno-associated virus mutant and application thereof

Info

Publication number: CN115960177A
Application number: CN202211231055.4A
Authority: CN
Inventors: 李华鹏; 卜晔; 钟育健; 代志勇; 张有为; 陈君霖
Original assignee: Guangzhou Packgene Biotech Co ltd
Current assignee: Guangzhou Packgene Biotech Co ltd
Priority date: 2022-10-09
Filing date: 2022-10-09
Publication date: 2023-04-14
Anticipated expiration: 2042-10-09
Also published as: CN115960177B; WO2024077815A1

Abstract

The invention belongs to the technical field of biological medicines, and discloses an adeno-associated virus mutant with inactivated T cell targeting and application thereof. The amino acid sequence of the heterologous peptide with the T cell inactivated targeting function is shown in any one of SEQ ID No. 9-12. The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant screened by the invention has high efficiency of targeting inactivated T cells, has the advantages of low dosage, strong infectivity and good safety, and has huge clinical value and commercial application scene.

Description

Adeno-associated virus mutant and application thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to an adeno-associated virus mutant with inactivated T cell targeting and application thereof.

Background

Adeno-associated virus (AAV) is a small non-enveloped virus that encapsulates a linear single-stranded DNA genome, belonging to the genus Dependovirus (dependenvovirus) of the family Parvoviridae (paraviridae), and requires a helper virus (usually an adenovirus) to participate in replication. The AAV genome is a single-stranded DNA fragment, contained in the non-enveloped virus capsid, that can be divided into three functional regions: two open reading frames (Rep gene, cap gene) and Inverted Terminal Repeats (ITRs). The recombinant adeno-associated virus (rAAV) is derived from non-pathogenic wild adeno-associated virus, and has the advantages of wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance, stable physical properties and the like, so that the rAAV is widely applied to gene therapy and vaccine research as a gene transfer vector. In medical research, rAAV is used in gene therapy research (including in vivo and in vitro experiments) of various diseases, such as gene function research, construction of disease models, preparation of gene knock-out mice, and the like.

Tumor immunotherapy is a treatment method which utilizes the specific ability of the immune system to identify and kill tumor cells and has application prospect in the current tumor treatment field. With the intensive research on tumor immunotherapy in recent years, various types of therapies, such as antibody-conjugated drugs, dual-targeted antibodies, CAR-T therapy, TCR-T therapy, and the like, have shown excellent efficacy in refractory relapsed tumors. T cells play an important role in the destruction of diseased cells throughout the body. Relevant studies of immune checkpoint inhibitors and tumor infiltrating lymphocytes indicate the potential of T cells for the treatment of cancer. However, T cells need to be appropriately tumor specific, in sufficient numbers, and to overcome any local immunosuppressive factors to be effective. Both CAR-T and TCR-T therapies are based on T cell engineering and, although currently in clinical use, have some problems, such as the integration of T cell genome involved in T cell engineering using lentiviruses, the need for long in vitro cell culture and tedious quality control process, and long in vitro operation is not only costly, but also affects T cell activity.

Therefore, the development of a virosome which has high targeting effect on inactivated T cells and does not affect the activity of T cells has great clinical value and commercial significance.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide the adeno-associated virus mutant with the targeting property of the inactivated T cells and the application thereof.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

in a first aspect, the invention screens a heterologous peptide with inactivated T cell targeting, wherein the amino acid sequence of the heterologous peptide is a sequence shown in any one of SEQ ID Nos. 9-12.

The efficiency of the recombinant adeno-associated virus vector target inactivated T cells constructed by screening the AAV capsid protein mutant containing the heterologous peptide is high.

As a preferred embodiment of the heterologous peptide of the present invention, the nucleotide sequence of the heterologous peptide is a sequence as shown in any one of SEQ ID Nos. 13 to 16.

In a second aspect, the invention provides an AVV capsid protein mutant with inactivated T cell targeting comprising said heterologous peptide.

The AAV capsid protein mutant obtained by screening does not need to integrate genome, and the constructed recombinant adeno-associated virus infected inactivated T cell can realize rapid infection and feedback, reduce unnecessary quality inspection and in vitro retention time, and has the advantages of low dosage, strong infectivity and good safety.

The preferred embodiment of the AVV capsid protein mutant of the present invention is obtained by inserting or substituting 5 to 20 amino acids of the AAV capsid protein with the heterologous peptide.

As a preferred embodiment of the AVV capsid protein mutant of the invention, the insertion site of the heterologous peptide is located between AAV capsid protein amino acids 588 and 589.

As a preferred embodiment of the AVV capsid protein mutant according to the present invention, the amino acid sequence thereof is the sequence as shown in any one of SEQ ID No.1 to SEQ ID No. 4.

As a preferred embodiment of the AVV capsid protein mutant of the invention, the nucleotide sequence is as shown in any one of SEQ ID No. 5-SEQ ID No. 8.

In a third aspect, the invention provides a recombinant adeno-associated virus with inactivated T cell targeting, which comprises the AVV capsid protein mutant.

The recombinant adeno-associated virus vector has better infection capacity on inactivated T cells, and has the advantages of low dosage, strong infectivity and good safety. The inactivated T cell infection can realize the advantages of the infection of the cells collected on the same day and the reinfusion on the same day, greatly reduces the preparation cost and can reduce the influence on the activity of the T cells.

As a preferred embodiment of the recombinant adeno-associated virus according to the present invention, a heterologous gene of interest is also included.

As a preferred embodiment of the recombinant adeno-associated virus according to the present invention, the heterologous gene of interest encodes any one of the gene products of interfering RNA, aptamer, endonuclease, and guide RNA.

In a fourth aspect, the invention provides the use of the heterologous peptide, the AVV capsid protein mutant, and the recombinant adeno-associated virus in the manufacture of a medicament for delivering a gene product to a cell of a subject.

As a preferred embodiment of the use according to the invention, the cell is an immune cell.

In a fifth aspect, the invention applies the heterologous peptide, the AVV capsid protein mutant and the recombinant adeno-associated virus to infect inactivated T cells.

In a sixth aspect, the invention applies the heterologous peptide, the AVV capsid protein mutant and the recombinant adeno-associated virus in preparing tumor immunotherapy medicaments.

As a preferred embodiment of the use according to the invention, the immunotherapy comprises CAR-T therapy or TCR-T therapy.

Compared with the prior art, the invention has the beneficial effects that:

the recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant screened by the invention has high efficiency of targeting inactivated T cells, and has the advantages of low dosage, strong infectivity and good safety. Compared with the prior art in which the cells are infected after stimulation by a stimulating factor (48 h), the inactivated T cell infection can realize the advantages of infection in the same day when the cells are collected and transfusion in the same day, and the preparation cost is greatly reduced. And the inactivated T cells reduce the in vitro culture and treatment time and reduce the influence on the activity of the T cells. Compared with the slow virus which is related to genome integration and has lower efficiency of infecting inactivated T cells, the AAV capsid protein mutant screened by the invention does not need to integrate the genome, can realize rapid infection and feedback, and reduces unnecessary quality control and in vitro retention time. The invention provides a method for delivering gene products to inactivated T cells, and the AAV capsid protein mutant obtained by screening to infect the inactivated T cells has huge clinical value and commercial application scene, because the activated T cells are rapidly amplified in vitro to reduce the anti-cancer activity and the effect is not good as compared with the inactivated T cells.

Drawings

FIG. 1 shows fluorescence microscopy on EGFP fluorescence intensity (72 h) of different rAAV virions infected T cells; a and B are control rAAV6 viruses, and C-F are AAV6 capsid protein mutant viruses 1-4.

FIG. 2 shows fluorescence microscopy of EGFP fluorescence intensity (96 h) from different rAAV virions infected T cells; a and B are control rAAV6 viruses, and C-F are AAV6 capsid protein mutant viruses 1-4.

FIG. 3 is a graph of RT-qPCR assay of the relative strength of EGFP mRNA in T cells for AAV6 capsid protein mutant virus 1 (72 h).

FIG. 4 shows the detection of EGFP fluorescence intensity of AAV6 capsid protein mutant virus 1 in T cells by flow cytometry (96 h).

FIG. 5 is RT-qPCR to determine the relative strength of EGFP mRNA in T cells of AAV6 capsid protein mutant virus 2 (72 h).

FIG. 6 shows the EGFP fluorescence intensity of AAV6 capsid protein mutant virus 2 in T cells detected by flow cytometry (96 h).

FIG. 7 shows RT-qPCR assay of the relative strength of EGFP mRNA in T cells for AAV6 capsid protein mutant virus 3 (72 h).

FIG. 8 shows the EGFP fluorescence intensity of AAV6 capsid protein mutant virus 3 in T cells detected by flow cytometry (96 h).

FIG. 9 shows RT-qPCR assay of the relative strength of EGFP mRNA in T cells for AAV6 capsid mutant virus 4 (72 h).

FIG. 10 shows the detection of EGFP fluorescence intensity of AAV6 capsid protein mutant virus 4 in T cells by flow cytometry (96 h).

Detailed Description

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the following examples. It will be understood by those skilled in the art that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available unless otherwise specified. The GenBank accession number of AAV6 VP1 is AF028704.1.

Example 1: screening for AAV6 mutants that efficiently infect inactivated T cells

(1) Construction of AAV6 library scaffold vectors

The AAV6 library skeleton vector contains CAG promoter, intron, mutated AAV6CAP sequence with the post T589 sequence eliminated and the T583 and the pre-polyA sequence constituting the site BsrG I (TGTACA)) for subsequent cutting skeleton and polyA. The sequences are synthesized by means of gene synthesis and inserted between ITRs of rAAV vectors to form AAV6 library backbone vectors.

(2) Construction of mutant Rep-CAP vectors

The Rep-CAP vector can express Rep protein but can not express VP1, VP2 and VP3 protein of CAP by introducing a stop codon in the first 20bp of VP1, VP2 and VP3 initiation codon of CAP sequence in AAV6, thereby avoiding the pollution of CAP sequence in parental AAV 6. The sequences are synthesized by means of gene synthesis, and are inserted into a CAP sequence replacing a Rep-CAP vector.

(3) Construction of random 7 peptide vector library

2 primers are designed (the insertion site is positioned between S588 and T589 of AAV6, the upstream primer targets the rear nucleic acid sequence of a template T589, the downstream primer targets a CAP terminal sequence), and the 5' ends of the upstream primer and the downstream primer both have homologous arm sequences which are consistent with the framework and are more than 15 bp. In addition, the upstream primer introduced a 21bp nucleic acid sequence (7 × nnk) between the homology arm sequence and the targeting sequence to introduce random 7 peptides into the CAP sequence.

The base sequences of the 2 primers (5 '- > 3') are as follows:

V6-7P-F：

GGGACTGTGGCAGTCAATCTCCAGAGCAGCAGCNNKNNKNNKNNKNNKNNKNNKACAGACCCTGCGACCGGAGAT；

V6-Stop-R：

CGGTTTATTGATTAACAATCGATTACAGGGGACGGGTGAGGTAAC。

using the carrier containing AAV6CAP as a template, and utilizing the primer to carry out PCR amplification to obtain a segment containing a random sequence. Carrying out gel electrophoresis and gel recovery on the fragments to obtain nucleic acid fragments of the purified random 7 peptide library; connecting the nucleic acid fragment into AAV6 library skeleton vector by Gibson homologous recombination connection (BsrG I enzyme digestion and gel recovery and purification); the ligated vector was purified by PCR product purification kit and digested with Plasmid-Safe DNase to remove non-ligated fragments; and finally, purifying by using a PCR product purification kit to obtain the constructed AAV6 vector library.

(4) Construction of AAV6 mutant virus libraries

Co-transferring the mutated Rep-Cap plasmid, AAV6 vector library and pHelper plasmid into HEK-293T cell, purifying adeno-associated virus by iodixanol gradient ultra-high speed centrifugation, and measuring the virus titer at 1 × 10 ¹² GC/mL～1×10 ¹³ GC/mL is the appropriate titer, an AAV6 mutant virus library is obtained, and the virus library is placed at-80 ℃ for standby.

(5) Screening of AAV6 mutants by T cells

1) Resuscitation of T cells and AAV infection

RPMI 1640 medium was preheated at 37 ℃; freezing and storing CD3 ⁺ T cells, rapid thawing; sucking the resuscitated cells into a 50mL centrifuge tube, adding 12mL RPMI 1640 medium containing 1% FBS, and centrifuging at 300g for 10-15 min; resuspending the cells in 1mL of 1% FBS-containing RPMI 1640 medium, cell counting (trypan blue staining, total cell count and dead cell count); add 1X 10 per well to cell culture plate ⁶ A suspension of cells; at a rate of 3X 10 per hole ¹⁰ The dose of GC was added to the AAV6 mutant virus pool to infect non-activated T cells for 6h. And (4) replacing the liquid to remove uninfected adeno-associated virus. Aspirating the cells into a 15mL centrifuge tube, adding dropwise 12mL of RPMI 1640 medium containing 1% FBS, centrifuging at 300g for 8min, aspirating off the medium, and repeating the procedure once; resuspending the cells in 1000. Mu.L of medium (10% FBS,25uL/mL CD3/CD 28T cell activator,50U/mL rhIL 2), culturing for 72h (37 ℃,5% CO) in a cell culture incubator ₂ )。

2) Total RNA extraction and RT-PCR

The cells were aspirated into a 1.5mL centrifuge tube, centrifuged at 300g for 15min to collect the cells, and the liquid was aspirated off. RNA extraction method according to the TransZol Up Plus RNA Kit (all-purpose gold, ER 501) instructions. PrimeScript was used for RNA sample extraction ^TM IV 1st strand cDNA Synthesis Mix (Takara, 6215A) first strand cDNA Synthesis was performed. Then carrying out 2 rounds of PCR amplification by using NEB Q5, wherein the first round of PCR amplification is carried out by using an outer primer, the second round of PCR amplification is carried out by using a first round product recovered by using glue as a template and an NGS primer, and the PCR product recovered by using the glue and corresponding to the size of a strip is sent to a company for NGS sequencing; and (3) after sequencing, analyzing sequencing data, selecting a sequence with a front appearance frequency row to construct an AAV mutant sublibrary, then performing a round of screening process on the sublibrary, and performing the processes of constructing, virus inclusion, screening and the like on the sublibrary library according to the construction process. Screening AAV capsid protein mutants 1-4, wherein the amino acid sequence of VP1 is respectively shown as SEQ ID No. 1-SEQ ID No.4, and the nucleotide sequence is respectively shown as SEQ ID No. 5-SEQ ID No. 8; the amino acid sequences of the targeting peptides in VP1 are respectively shown as SEQ ID No. 9-SEQ ID No.12,The nucleotide sequences are respectively shown as SEQ ID No. 13-SEQ ID No. 16.

Example 2: construction of AAV capsid protein mutants and production of viruses

Using r AAV6 as a control to construct AAV capsid protein mutants 1-4, which are specifically as follows:

(1) Construction of mutant serotype vector and plasmid extraction

Carrying out double enzyme digestion on the Rep-CAP plasmid by using Smi I and BshT I, carrying out gel electrophoresis, cutting a fragment band of about 5000bp, and carrying out gel recovery to obtain an enzyme-digested framework fragment. And respectively designing primers according to the Cap sequences of the screened target mutants 1-4 to construct plasmids of the AAV of the target mutants. Using the Rep-CAP plasmid of AAV6 as template and F1+ R1 primer to make PCR amplification to obtain target product 1, and using the Rep-CAP plasmid of AAV6 as template and F2+ R2 primer to make PCR amplification to obtain target product 2. The framework and the fragments have homologous arm sequences, and the fragments can be assembled into a complete vector through multiple fragments by Gisbon.

The primer of PCR product 1 in the AAV capsid protein mutant 1 vector construction is Cap-F + YJ191-R, and the primer of PCR product 2 is YJ191-F + Cap-R. The primer sequences (5 '- > 3') involved are:

YJ191-F：

ACTGAGGCGTCTCGTCGGCTGACAGACCCTGCGACCGGAGA；

YJ191-R：

CAGCCGACGAGACGCCTCAGTGCTGCTGCTCTGGAGATTGAC。

the primer of PCR product 1 in the AAV capsid protein mutant 2 vector construction is Cap-F + YJ192-R, and the primer of PCR product 2 is YJ192-F + Cap-R. The primer sequences (5 '- > 3') involved are:

YJ192-F：

AGTGGGGGGCAGTCGCGTGGGACAGACCCTGCGACCGGAGA；

YJ192-R：

CCCACGCGACTGCCCCCCACTGCTGCTGCTCTGGAGATTGAC。

the primer of the PCR product 1 in the AAV capsid protein mutant 3 vector construction is Cap-F + YJ193-R, and the primer of the PCR product 2 is YJ193-F + Cap-R. The primer sequence (5 '- > 3') involved is

YJ193-F：

GAGAGGGGGGGGCCGCGTGGTACAGACCCTGCGACCGGAGA；

YJ193-R：

ACCACGCGGCCCCCCCCTCTCGCTGCTGCTCTGGAGATTGAC。

The primer of PCR product 1 in the AAV capsid protein mutant 4 vector construction is Cap-F + YJ194-R, and the primer of PCR product 2 is YJ194-F + Cap-R. The primer sequence (5 '- > 3') involved is

YJ194-F：

AGTGGGGCTGGTCGGTTGGCGACAGACCCTGCGACCGGAGA；

YJ194-R：

CGCCAACCGACCAGCCCCACTGCTGCTGCTCTGGAGATTGAC。

The sequences of primers Cap-f and Cap-r related in the construction of the AAV capsid protein mutant 1-4 vectors are as follows:

Cap-f：CATCTTTGAACAATAAATGATTTAAATCAGGTATG；

Cap-r：TCAACTGAAACGAATCAACCGGTTT。

taking 1 clean 200uL PCR tube as a mark, placing the marked tube on an ice box, and carrying out enzyme digestion on the enzyme digestion skeleton, the target fragment 1 and the target fragment 2 according to the skeleton: preparing a reaction solution with the fragment molar ratio of 1. 50 mu L of competent cells are unfrozen on ice, 10 mu L of ligation products are mixed with DH5 alpha competent cells, and the mixture is placed on ice for 20-30 min; heat shock is carried out for 45 seconds at 42 ℃; rapidly placing on ice bath for 2 minutes, adding 400 μ L recovery SOC culture medium (without antibiotic), culturing at 37 deg.C and 200rpm for 1h; the cells were spread evenly on Amp-resistant plates (50. Mu.g/ml) and incubated at 37 ℃ for 14 hours. The monoclonal bacteria were selected, and the resulting culture was expanded in 4ml of liquid LB medium (Amp + resistant) and cultured at 37 ℃ for 14 hours.

Centrifuging the bacterial liquid at 12000rpm for 1 minute, and pouring out the supernatant culture medium; adding 250 mu L of buffer P1/RNaseA mixed solution, and carrying out high-speed vortex to resuspend bacteria; adding 250 mu L of buffer P2, and reversing the upper part and the lower part for 8 to 10 times; adding 350 mu L of buffer P3, immediately reversing and uniformly mixing for 8-10 times to completely neutralize the solution; centrifuging at 13000rpm for 10 minutes, taking the supernatant and passing through a column; centrifuging for 1 minute at 12000, pouring off waste liquid, adding 500 μ L PW1, centrifuging for 1 minute at 12000, and pouring off waste liquid; adding 600 mu L of PW2, 12000, centrifuging for 1 minute, and pouring off the supernatant; adding 600 mu L of PW2, 12000, centrifuging for 1 minute, and pouring off the supernatant; idling at 12000rpm for 2 minutes; adding preheated eluent of 30-50 μ L at 55 deg.C, standing for 2min, and centrifuging at 12000rpm for 1 min. The concentration was measured using a trace nucleic acid quantitative analyzer.

The concentration of the obtained plasmid is detected, 10 mu L of positive plasmid subjected to enzyme digestion identification is taken and sequenced, and the positive plasmid is stored at-20 ℃. Sequencing results show that the obtained plasmid can encode the variant capsid protein VP1. And finally, extracting related Helper plasmids, rep-Cap plasmids (AAV 6 and AAV6 mutants 1-4) of each group and GOI plasmids (comprising scAAV, CAG, EGFP, WPREs and SV40 pA) according to the virus amount required by later-stage test.

(2) Packaging and purification of mutant serotype viruses

Co-transferring the obtained Rep-Cap plasmids, plasmids Expressing Green Fluorescent Protein (EGFP) and pHelper plasmids of each group (rAAV 6 and AAV capsid protein mutant) into HEK-293T cells in proper amount, purifying AAV by iodixanol gradient ultra-high speed centrifugation, and measuring the virus titer at 1 × 10 ¹² GC/mL～1×10 ¹³ GC/mL is the appropriate titer, and the control AAV6 virus and AAV6 capsid protein mutant virus 1-4 are obtained, and are placed at minus 80 ℃ for standby.

Example 3: comparative detection of various indexes of mutant serotypes

(1) AAV-infected T cells and cell culture

Setting grouping: control AAV6 virus and AAV6 capsid protein mutant virus 1-4.

RPMI 1640 medium was pre-warmed at 37 ℃. Freezing and storing CD3 ⁺ T cells, rapid thawing; respectively sucking the recovered cells into a 50mL centrifuge tube, adding 12mL RPMI 1640 medium containing 1% FBS, and centrifuging for 10-15 min at 300 g; resuspending the cells in 1mL of 1% FBS-containing RPMI 1640 medium per tube, cell count (trypan blue staining, total cell count and dead cell count); based on the cell count results, the cell density was adjusted to 1X 10 ⁶ cells/mL; according to the experimental grouping, 100. Mu.L of cell suspension (cell number 1X 10) was added to the well of a 96-well cell culture plate ⁵ cells/well); each group was at MOI 1E5 (AAV 6 high dose group at MOI of1E6) The T cells were infected in groups for 3h. Then, fluid replacement is performed to remove uninfected AAV. The cells were each aspirated into 1.5mL centrifuge tubes, 1mL of 1% FBS-containing RPMI 1640 medium was added dropwise, centrifuged at 300g for 8min, the medium was aspirated off, and the procedure was repeated once; resuspending the cells in 100uL of medium (10% FBS,25uL/mL CD3/CD 28T cell activator,50U/mL rhIL 2), and culturing for 72h (37 ℃,5% CO) in a cell culture incubator ₂ )。

(2) Fluorescence observation

Fluorescence photographs were taken of each set of T cells using a fluorescence microscope at 72h, 96h, respectively (the photographing parameters and exposure time were kept the same).

(3) Detection of expression level of target mRNA

1) Total RNA extraction:

each group of cells was aspirated into a 1.5mL centrifuge tube, 300g, centrifuged for 15min to collect the cells, and then the liquid was aspirated. RNA extraction method according to the TransZol Up Plus RNA Kit (all-purpose gold, ER 501) instructions. Adding 200ul of TransZol up into each tube of cells, adding 40 μ L of chloroform, shaking vigorously for 30s, and incubating at room temperature for 3min; centrifugation was carried out at 12,000g and 4 ℃ for 10min. Transferring the colorless water phase into a new 1.5ml RNase-free EP tube, adding the same volume of absolute ethyl alcohol, and slightly reversing and mixing uniformly; adding the obtained solution and the precipitate into a centrifugal column, centrifuging at room temperature of 12,000g for 30s, and removing the filtrate; adding 500 μ L CB9, 12,000g, centrifuging at room temperature for 30s, and discarding the filtrate; repeating the steps once; adding 500. Mu.L of WB9, 12,000g, centrifuging at room temperature for 30s, and removing the filtrate; repeating the steps once; centrifuging at room temperature of 12,000g for 2min to completely remove residual ethanol; placing the column in 1.5ml RNase-free EP tube, adding 50 μ L RNase-free Water in the center of the column, standing at room temperature for 1min; centrifuging at room temperature for 1min at 12,000g, and eluting RNA; the RNA concentration of the sample was measured using a trace nucleic acid quantitative analyzer, and the RNA concentration, OD260/280, and OD260/230 were measured, and the extracted RNA was stored at-80 ℃. Use of RNA samples per group

III RT SuperMix for qPCR (+ gDNA wrapper) (Novozan, R323) first strand cDNA synthesis.

2) Quantitative PCR (qPCR) assay

Each set of cDNA was taken as template and qPCR system configuration was performed according to the 2 × SYBR Green qPCR Master Mix (Bimake, B212203) instructions as shown in table 1:

TABLE 1 qPCR System

Reagent	Amount of the composition used
		2×SYBR Green qPCR Master Mix	10μL
Form panel	1μL
		Upstream primer	1μL
Downstream primer	1μL
		ROX Reference Dye	0.4μL
Deionized water	Up to 20μL

The primer sequences (5 '- > 3') are as follows:

EGFP-Tf：GCTGGAGTACAACTACAAC；

EGFP-Tr：TGGCGGATCTTGAAGTTC；

GAPDH101-F：CTGGGCTACACTGAGCACC；

GAPDH101-R：AAGTGGTCGTTGAGGGCAATG。

qPCR program settings are shown in table 2:

TABLE 2 qPCR procedure

And calculating the relative expression quantity according to the Ct value of each group and the formula 2^ -delta Ct.

3) Flow cytometry detection

The above groups of T cells cultured for 96h were collected: each well of cells and supernatant was collected in a 1.5mL EP tube, 1mL of 2% FBS-containing PBS was added dropwise, the supernatant was removed after centrifugation at 300g for 8min, washing was repeated once, 100. Mu.L of 2% FBS was added for resuspension after removal of the supernatant, and the suspension was blown up into a single cell suspension with a pipette tip and placed on ice for detection by the upflow method.

The results of infection of inactivated T cells by the AAV capsid protein mutants 1 to 4 are shown in fig. 1 and 2, and compared with rAAV6 control groups of different MOIs, the AAV capsid protein mutant of the present invention has a better infection effect on inactivated T cells, regardless of EGFP fluorescence intensity at different time points (72 h, 96 h), fluorescence intensity and fluorescence cell ratio in flow analysis, or relative mRNA expression amount.

The relative expression level of 1,mRNA for AAV capsid protein mutant (MOI: 1E 5) was shown to be about 45-fold stronger than that of rAAV6 (MOI: 1E 5) control group and much stronger than that of rAAV6 (MOI: 1E 6) control group (FIG. 3). Flow cytometry results (FIG. 4) showed that the AAV capsid protein mutant (MOI: 1E 5) had a fluorescence cell ratio of over 90%, while the rAAV6 (MOI: 1E 5) control group had a fluorescence intensity of less than 40%, and the fluorescence intensity of the main cell population (about 1E 3) was about 100-fold lower than that of the AAV capsid protein mutant (MOI: 1E 5) (fluorescence intensity of the main cell population about 1E 5).

The relative expression of 2,mRNA for AAV capsid protein mutant showed (FIG. 5), that AAV capsid protein mutant (MOI: 1E 5) was about 3.37-fold stronger than rAAV6 (MOI: 1E 5) control. The flow cytometry results showed (FIG. 6) that the AAV capsid protein mutant (MOI: 1E 5) has a fluorescence cell ratio of 85.5% for 96h, which is higher than 37.6% for rAAV6 (MOI: 1E 5) and 51.1% for rAAV6 (MOI: 1E 6), and the fluorescence intensity of the main cell population is also higher than that of rAAV6 (MOI: 1E5 and 1E 6).

The relative expression level of 3,mRNA for AAV capsid protein mutant (MOI: 1E 5) was shown to be about 4.41-fold stronger than that of rAAV6 (MOI: 1E 5) control (FIG. 7). The flow cytometry results showed (FIG. 8) that the AAV capsid protein mutant (MOI: 1E 5) has a fluorescence cell ratio of 85.9% for 96h, which is higher than 37.6% for rAAV6 (MOI: 1E 5) and 51.1% for rAAV6 (MOI: 1E 6), and the fluorescence intensity of the main cell population is also higher than that of rAAV6 (MOI: 1E5 and 1E 6).

The relative expression level of 4,mRNA for AAV capsid protein mutant (MOI: 1E 5) was shown to be about 5.62-fold stronger than that of rAAV6 (MOI: 1E 5) control (FIG. 9). The flow cytometry results showed (FIG. 10) that the AAV capsid protein mutant (MOI: 1E 5) fluorescence cell ratio of 96h was 59.8%, which was higher than 37.6% of rAAV6 (MOI: 1E 5) and 51.1% of rAAV6 (MOI: 1E 6), and the fluorescence intensity of the main cell population was also higher than that of rAAV6 (MOI: 1E5 and 1E 6).

On the other hand, for rAAV6 with stronger infection capacity of immune cells, the infection capacity of inactivated T cells is still very low, and even if the MOI of the rAAV6 is increased to 1E6 in the control group, no obvious infection effect is increased compared with the MOI:1E5, which indicates that the rAAV6 can not effectively infect the inactivated T cells.

The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant screened by the invention has high efficiency of targeting inactivated T cells, and has the advantages of low dosage, strong infectivity and good safety. Compared with the prior art in which the cells are infected after stimulation by a stimulating factor (48 h), the inactivated T cell infection can realize the advantages of infection in the same day when the cells are collected and transfusion in the same day, and the preparation cost is greatly reduced. And the inactivated T cells reduce the in vitro culture and treatment time and reduce the influence on the activity of the T cells. Compared with lentivirus which relates to genome integration and has lower efficiency of infecting inactivated T cells, the AAV capsid protein mutant screened by the invention does not need to integrate genome, can realize rapid infection and feedback, and reduces unnecessary quality inspection and in vitro retention time. The invention provides a method for delivering gene products to inactivated T cells, and the AAV capsid protein mutant obtained by screening to infect the inactivated T cells has huge clinical value and commercial application scene, because the activated T cells are rapidly amplified in vitro to reduce the anti-cancer activity and the effect is not good as compared with the inactivated T cells.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A heterologous peptide with inactivated T cell targeting property is characterized in that the amino acid sequence of the heterologous peptide is a sequence shown in any one of SEQ ID No. 9-12.

2. The heterologous peptide according to claim 1, wherein the nucleotide sequence of the heterologous peptide is as shown in any of SEQ ID nos. 13 to 16.

3. An AVV capsid protein mutant with unactivated T cell targeting comprising the heterologous peptide of claim 1 or 2.

4. The mutant AVV capsid protein according to claim 3, wherein said heterologous peptide inserts or replaces between 5 and 20 amino acids of the AAV capsid protein.

5. The AVV capsid protein mutant of claim 3 or 4, wherein the insertion site of the heterologous peptide is between AAV capsid protein amino acids 588 and 589.

6. The AVV capsid protein mutant of claim 5, wherein the amino acid sequence is as shown in any one of SEQ ID No. 1-SEQ ID No. 4.

7. The mutant AVV capsid protein according to claim 6, wherein the nucleotide sequence is as shown in any one of SEQ ID No.5 to SEQ ID No. 8.

8. A recombinant adeno-associated virus with inactivated T cell targeting comprising the AVV capsid protein mutant of any one of claims 3 to 7.

9. The recombinant adeno-associated virus according to claim 8 further comprising a heterologous gene of interest.

10. The recombinant adeno-associated virus according to claim 9 wherein the heterologous gene of interest encodes the gene product of any one of interfering RNA, aptamers, endonucleases, guide RNA.

11. Use of the heterologous peptide of claim 1 or 2, the AVV capsid protein mutant of any one of claims 3 to 7, the recombinant adeno-associated virus of any one of claims 8 to 9 in the manufacture of a medicament for delivering a gene product to a cell of a subject.

12. The use of claim 11, wherein the cell is an immune cell.

13. Use of the heterologous peptide of claim 1 or 2, the AVV capsid protein mutant of any one of claims 3 to 7 or the recombinant adeno-associated virus of any one of claims 8 to 9 for infecting non-activated T cells.

14. Use of the heterologous peptide according to claim 1 or 2, the AVV capsid protein mutant according to any one of claims 3 to 7, or the recombinant adeno-associated virus according to any one of claims 8 to 9 for the manufacture of a medicament for the immunotherapy of tumors.

15. Use according to claim 11, wherein the immunotherapy comprises CAR-T therapy or TCR-T therapy.