CN116023513A - Mutant applicable to specificity infection of rat liver cells and adeno-associated virus - Google Patents

Abstract

The invention relates to packaging and screening of virus vectors, in particular to packaging and screening of AAV mutants, and specifically relates to a mutant of a virus which is applicable to specificity infection of rat liver cells and is related to adeno; through constructing a peptide mutation library of AAV9, screening and verifying to obtain a novel AAV9 mutant inserted with 7 amino acids, the mutant can effectively infect BRL cells under the condition of MOI=1E+5, achieves a higher infection effect than that of natural AAV9 serotypes MOI=1E+5, and the AAV9-BRL04 obtained through screening has the best effect, obviously improves the infection positive rate relative to a control AAV9 serotypes under the same MOI condition, and statistics of multiple of the detection by luciferase (RLU) values is 8 times, so that the use amount of AAV infected cells is effectively reduced, the experimental cost is saved, and meanwhile, the research on gene therapy related mechanisms of rat liver cells becomes feasible.

Description

Mutant applicable to specificity infection of rat liver cells and adeno-associated virus

Technical Field

The invention relates to packaging and screening of virus vectors, in particular to packaging and screening of AAV mutants, and in particular relates to a mutant of a virus which is applicable to specificity infection of rat liver cells and is related to adeno.

Background

Adeno-associated virus (AAV) is a tiny, envelope-free virus of the type having an icosahedral structure, a most structurally simple single-stranded DNA-deficient virus currently found, and requires helper virus (usually adenovirus or herpes virus) to complete the viral packaging. The gene transfer vector is regarded as one of the most promising gene transfer vectors because of the characteristics of good safety, wide host cell range (dividing and non-dividing cells), low immunogenicity, long time for expressing exogenous genes in vivo, and the like, and is widely applied to gene therapy and vaccine research in the world. Adeno-associated viruses of different serotypes have different affinities in cells.

In general, the adenovirus can only detect the in-vivo expression condition after 3-4 weeks after injection, the experimental period is longer, and the rat cost and the feeding space cost are higher; therefore, rat liver cells can be selected as an in vitro model for relevant functional research during screening and early mechanism testing, the expression time can be shortened to 3 days from 3-4 weeks in vivo, the cost is greatly reduced, and a powerful tool can be provided for the mechanism research of liver change development and the development of liver gene therapy medicaments.

However, the existing AAV viruses have low efficiency in infecting the cell line, such as AAV9 type infection to rat hepatocytes (BRL) and high MOI (multiplicity of infection), and when moi=1e+5, only a small number of cells can be infected, which limits the use of AAV viruses when performing in vitro tests, resulting in a large amount of AAV for in vitro detection. Therefore, a peptide fragment mutation library of AAV9 is designed and constructed, AAV mutants capable of efficiently infecting BRL cell lines are obtained through library screening, and the infection efficiency of the existing AAV serotypes is improved, so that the application of the AAV in BRL cells is satisfied.

Disclosure of Invention

Aiming at the defects in the prior art, the invention designs and constructs a peptide fragment mutation library of AAV9, and AAV serotype mutants capable of efficiently infecting BRL cell lines are obtained through library screening so as to meet the requirement of the BRL cell lines as in-vitro research application.

The invention discloses an AAV9 serotype capsid protein mutant inserted with heterologous peptide;

the heterologous peptide is as follows: the amino acid sequence is polypeptide composed of LRLNTAV (SEQ ID NO: 12);

the AAV9 serotype capsid protein amino acids 588-589 are inserted by the heterologous peptide.

The invention discloses nucleic acid molecules encoding the AAV9 serotype capsid protein mutants described above.

Nucleic acid vectors operably linked to the above nucleic acid molecules are disclosed.

The invention discloses a host cell containing the nucleic acid vector.

The invention discloses a composition or a kit, which contains the AAV9 serotype capsid protein mutant, a nucleic acid molecule or a nucleic acid vector.

The invention discloses the use of the AAV9 serotype capsid protein mutant, nucleic acid molecule or nucleic acid vector described above for infecting BRL cells, said use being of non-diagnostic and therapeutic interest.

Compared with the prior art, the invention has the following beneficial effects:

according to the technical scheme, a peptide fragment mutation library of AAV9 is constructed, screening verification shows that a novel AAV9 mutant inserted with 7 amino acids is obtained, the mutant can effectively infect BRL cells under the condition of MOI=1E+5, a higher infection effect than that of natural AAV9 serotypes MOI=1E+5 is achieved, the effect of AAV9-BRL04 obtained through screening is best, under the same MOI condition, the infection positive rate is obviously improved relative to that of a control AAV9 serotypes, the factor of the detection statistics is 8 times through luciferase (RLU) value detection, the use amount of AAV infected cells is effectively reduced, the experimental cost is saved, and meanwhile, the research on gene therapy related mechanisms of rat cells becomes feasible.

Drawings

FIG. 1 is a block diagram showing pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA expression in example 1;

FIG. 2 is a pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA-WPRE map of example 1;

FIG. 3 is a flowchart of AAV9 library construction and screening;

FIG. 4 is a fluorescence plot of BRL infected cells of different serotypes in example 2;

FIG. 5 is a graph of firefly luciferin values (RLU) for BRL cells infected with different serotypes in example 2.

Detailed Description

The invention is further illustrated by means of the following examples, which are not intended to limit the scope of the invention. The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.

Example 1, AAV97-mer random peptide insertion library construction:

the library consisted of the following vectors:

library shuttle vector pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA, as shown in FIGS. 1-2.

Example 2, AAV9 library construction and screening procedure:

by constructing a library of random mutations of peptide fragments of AAV9, novel AAV9 mutants having 7 amino acids inserted therein were screened, as shown in FIG. 3.

1. Mutant library preparation

1.1 chemical Synthesis of AAV9-7mer-NNS two fragments:

5'CCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSNNSGCACAGGCGCAG 3'(S EQ ID NO:1)；

5'CGGTCTGCGCCTGTGCSNNSNNSNNSNNSNNSNNSNNTTGGGCACTCTG 3'(SE Q ID NO:2)；

wherein NNS represents a random coding sequence.

1.2 annealing of the synthesized AAV9-7mer-NNS plus 10. Mu.L of each of the forward and reverse primers (final primer concentration 10 mM) to obtain AAV9-7mer-NNS template. The annealing procedure is as follows: 95 ℃ for 5min;95 ℃ for 1min;92min,1min;4 ℃ for 60min. Wherein, in the second step and the third step, each cycle is reduced by 3 ℃ for 25 cycles.

1.3 plasmid pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA (structure and insertion site are shown in FIG. 2) was subjected to single cleavage with BsmBI, and cleavage system (50 uL) is shown in Table 1.

TABLE 1

After digestion for 4h at 55℃1% agarose gel electrophoresis was performed, and the large fragment was excised with a knife under an ultraviolet lamp and recovered for purification.

1.4 the purified cleavage product obtained in step 1.3 and the AAV9-7mer-NNS nucleotide sequence obtained in step 1.2 were ligated using T4 DNA library. Ligation T4 DNA ligase using Takara, 10. Mu.L of the reaction system is shown in Table 2, and the ligation is performed overnight at 4 ℃.

TABLE 2

1.5 adding 10. Mu.L of the enzyme-linked product into 50. Mu.L of library-specific electrotransformation competent cells (purchased from Lucigen corporation), mixing, placing, transferring into a precooled electrode cup, performing electrotransformation by using an electrotransformation instrument of Berle corporation, adding 1mL of SOC liquid culture medium preheated at 37 ℃ to the inside after electrotransformation, recovering at 37 ℃ for 1 hour, and performing centrifugal coating.

1.6 repeating steps 1.4-1.5 until the number of clones reaches 5X 10 ¹¹ 。

2. Library virus packaging and screening

2.1AAV mutant library viral packaging: 1.5X10 per dish ⁷ 2 piecesThe 93AAV packaging cells are inoculated into a 15cm cell culture dish and cultured for 18-24 hours, and transfection can be started after the cells are attached. pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA-insertion expression vector library containing AAV9-7mer-NNS inserts was transfected with PEI transfection reagent, plasmids were packaged, helper plasmids were transferred into 293AAV cells, and after 72h transfection, the proportion of vector library cells in AAV-293 cells was counted under a fluorescence microscope to determine virus packaging efficiency. After the virus is packaged, repeatedly blowing the cells by using a gun head, so that all the cells are completely separated from the culture dish, and collecting all the cell samples.

2.2 purification of virus: repeatedly freezing and thawing the collected cell sample at-80 ℃ and 37 ℃, centrifuging, collecting cell supernatant, removing cell fragments by using a PVDF filter with the thickness of 0.45 mu m, and purifying the collected recombinant AAV by using an AAV purification kit to obtain the recombinant AAV.

2.3 determination of recombinant AAV viral titers: taking 20 mu L of concentrated virus liquid, adding 1 mu L of RNase-free DNase, mixing uniformly, incubating for 30min at 37 ℃, centrifuging at 10000rpm for 10min, taking 20 mu L of supernatant, adding 80 mu L of dilution Buffer into another sterile tube, mixing uniformly, and reacting for 10min in a metal bath at 100 ℃. Naturally cooling to room temperature, adding 3 mu L of proteinase K, incubating at 37 ℃ for 60min, reacting in a metal bath at 100 ℃ for 10min, and cooling to room temperature. The sample is diluted and used as a template, and the recombinant AAV titer is determined by adopting a real-time quantitative PCR detection method. The qPCR reaction system and the reaction conditions are as follows: 95 ℃ for 10min;95 ℃ for 30s;60 ℃,30s,35 cycles.

2.4AAV infection of BRL (rat hepatocytes) cells:

2.4.1 cell plating: BRL cells were seeded at 40% confluency into 10cm cell dishes at 5X 10 per dish ⁶ Cells were plated and multiple cell culture dishes were plated.

2.4.2 viral infection: BRL cells are infected with pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA-insertion expression vector library virus.

2.5 collecting the infected cells, performing fluorescence sorting by using a flow cytometry, and selecting the cells with the red fluorescence brightness of 5% at the front as the screened target cells for collection. The cells after sorting and collection are paved into a cell dish, and the cells are collected after being amplified.

2.6 extracting the genome from the collected cells, performing PCR amplification, and sequencing the PCR products in high throughput.

Amplification primers:

AAV9-F: AACTACTAACCCGGTAGCAACGG (SEQ ID NO: 3) (forward primer on vector)

AAV9-R: CGTCCGTGTGAGGAATTTTGG (SEQ ID NO: 4) (reverse primer on vector) high throughput sequencing with addition of adaptor and index sequences primers were used as follows:

NGS-AAV9-F：

TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCT AGAAACTACTAACCCGGTAGCAACGG(SEQ ID NO:5)

NGS-R1：

GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCT AGCGAGTAATCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:6)

NGS-R2：

GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCT AGTCTCCGGACGTCCGTGTGAGGAATTTTGG(SEQ ID NO:7)

NGS-R3：

GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCT AGAATGAGCGCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:8)

NGS-R4：

GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCT AGGGAATCTCCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:9)

NGS-R5：

GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCT AGTTCTGAATTTCCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:10)

the expected sequencing sequences obtained are:

AACTACTAACCCGGTAGCAACGGAGTCCTATGGACAAGTGGCCACAAACCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSNNSGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGACAGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACG(SEQ ID NO:11)

analyzing the high-throughput sequencing result, and respectively naming mutants with high occurrence frequency as AAV9-BRLxx; if the peptide fragment 01 is: AAV9-BRL01.

3. Screening and validation of AAV9 mutants

Construction of 3.1AAV9 mutant

The AAV9 of the natural serotype is taken as a vector, fragments such as AAV9-BRLxx of candidate mutants are inserted at 588-589 as amino acids, so that new AAV9-BRLxx of the serotype vector is obtained, and more than 30 mutants are constructed according to the result of high-throughput sequencing.

3.2 AAV viruses of various mutant serotypes were obtained by packaging with AAV9-BRLxx et al as a serotype vector using the shuttle vector pAAV-CBh-mScarlet-P2A-Luc 2.

3.3 viral titer assays were performed on the above viruses using WPRE primers, and expression of viruses VP1, VP2, VP3 was confirmed using cowling.

3.4 AAV9-BRLxx et al virus, pAAV-CBh-mScarlet-P2A-Luc2, was expressed as MOI=1X10 ⁵ Respectively infecting BRL cells, wherein the infection results of 4 different mutant serotype peptide fragments are selected, the fluorescence diagram of the infection results and 72h of control AAV9 is shown as figure 4, the infection efficiency of AAV9-BRL04 mutant serotype viruses is obviously higher than that of control AAV9, meanwhile, the infection efficiency of AAV9-BRL04 is higher than that of control AAV9 by using luciferase (RLU) values of firefly luciferase detection cells, as shown in figure 5, and the RLU value is improved by 8 times compared with that of control AAV 9. The AAV9-BRL04 obtained by screening has the best effect, and under the same MOI condition, the infection positive rate is obviously improved relative to the control AAV9 serotype, and the detection statistics of the value of luciferase (RLU) shows that the multiple of the infection positive rate is 8 times.

Claims (6)

1. An AAV9 serotype capsid protein mutant inserted with a heterologous peptide, characterized in that,

the heterologous peptide is as follows: the amino acid sequence is polypeptide composed of LRLNTAV;

the AAV9 serotype capsid protein amino acids 588-589 are inserted by the heterologous peptide.

2. A nucleic acid molecule encoding the AAV9 serotype capsid protein mutant of claim 1.

3. A nucleic acid vector operably linked to the nucleic acid molecule of claim 2.

4. A host cell comprising the nucleic acid vector of claim 3.

5. A composition or kit comprising the AAV9 serotype capsid protein mutant of claim 1, the nucleic acid molecule of claim 2 or the nucleic acid vector of claim 3.

6. Use of an AAV9 serotype capsid protein mutant according to claim 1, a nucleic acid molecule according to claim 2 or a nucleic acid vector according to claim 3 for infecting BRL cells, said use being of non-diagnostic and therapeutic interest.

Images