CN115960177B

CN115960177B - Adeno-associated virus mutant and application thereof

Info

Publication number: CN115960177B
Application number: CN202211231055.4A
Authority: CN
Inventors: 李华鹏; 卜晔; 钟育健; 代志勇; 张有为; 陈君霖
Original assignee: Guangzhou Packgene Biotech Co ltd
Current assignee: Guangzhou Packgene Biotech Co ltd
Priority date: 2022-10-09
Filing date: 2022-10-09
Publication date: 2023-07-07
Anticipated expiration: 2042-10-09
Also published as: CN115960177A; WO2024077815A1

Abstract

The invention belongs to the technical field of biological medicines, and discloses an adeno-associated virus mutant with unactivated T cell targeting and application thereof. The amino acid sequence of the heterologous peptide with the non-activated T cell targeting is shown as any one of SEQ ID No. 9-12. The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant obtained by screening has high efficiency of targeting the unactivated T cells, has the advantages of low dosage, strong infectivity and good safety, and has great clinical value and commercial application scene.

Description

Adeno-associated virus mutant and application thereof

Technical Field

The invention relates to the technical field of biological medicine, in particular to an adeno-associated virus mutant with unactivated T cell targeting and application thereof.

Background

Adeno-associated virus (AAV) is a non-enveloped small virus which encapsulates a linear single-stranded DNA genome, belonging to the family of parvoviridaeParvoviridae) Dependent on the genus VirusDependovirus) Helper virus (usually adenovirus) is required to participate in replication. AAV genomes are single-stranded DNA fragments contained in non-enveloped viral capsids and can be divided into three functional regions: two open reading frames (Rep gene, cap gene) and an Inverted Terminal Repeat (ITR). Recombinant adeno-associated virus (rAAV) is derived from non-pathogenic wild adeno-associated virus, and has wide host range, non-pathogenic, low immunogenicity, long-term stable expression of exogenous gene,Good diffusion performance and stable physical property, and the like, and can be widely applied to gene therapy and vaccine research as a gene transfer vector. In medical research, rAAV is used in research (including in vivo and in vitro experiments) for gene therapy of various diseases, such as gene function research, construction of disease models, preparation of gene knockout mice, and the like.

Tumor immunotherapy is a treatment method which utilizes the specific ability of the immune system to identify and kill tumor cells, and is one of the application prospects in the current tumor treatment field. With the intensive research of tumor immunotherapy in recent years, various types of therapies have emerged as excellent therapeutic effects in refractory recurrent tumors, such as antibody-coupled drugs, dual targeting antibodies, CAR-T therapies, TCR-T therapies, and the like. T cells play an important role in destroying whole body diseased cells. Related studies of immune checkpoint inhibitors and tumor infiltrating lymphocytes indicate the potential of T cells to treat cancer. However, T cells require adequate tumor specificity, are in sufficient numbers, and overcome any local immunosuppressive factors to be effective. Both CAR-T and TCR-T therapies are T cell engineering-based methods, and although currently in clinical use, there are still problems such as the integration of T cell genome using lentiviruses involved in T cell engineering, requiring long in vitro cell culture and cumbersome quality control procedures, and long term in vitro operation is not only costly but also affects T cell activity.

Therefore, the development of a virosome which has high targeting efficiency on non-activated T cells and does not affect the activity of T cells has great clinical value and commercial significance.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide an adeno-associated virus mutant with the targeting of unactivated T cells and application thereof, and the adeno-associated virus mutant has better infection capability on the unactivated T cells and has the advantages of low dosage, strong infection capability and good safety.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

in a first aspect, the invention provides a heterologous peptide with non-activated T cell targeting, wherein the amino acid sequence of the heterologous peptide is shown in any one of SEQ ID No. 9-12.

The recombinant adeno-associated virus vector constructed by screening the AAV capsid protein mutant containing the heterologous peptide has high efficiency of targeting unactivated T cells.

As a preferred embodiment of the heterologous peptide according to the present invention, the nucleotide sequence of the heterologous peptide is as shown in any one of SEQ ID Nos. 13 to 16.

In a second aspect, the invention provides an AAV capsid protein mutant with non-activated T cell targeting, comprising the heterologous peptide.

The AAV capsid protein mutant obtained by screening does not need to integrate genome, and the constructed recombinant adeno-associated virus can infect unactivated T cells to realize quick infection and reinfusion, reduce unnecessary quality inspection and in-vitro residence time, and has the advantages of low dosage, strong infection and good safety.

In a preferred embodiment of the AAV capsid protein mutant of the present invention, the heterologous peptide is inserted into or substituted for 5 to 20 amino acids of the AAV capsid protein.

As a preferred embodiment of the AAV capsid protein mutants of the invention, the insertion site of the heterologous peptide is located between AAV capsid protein amino acids 588 and 589.

As a preferred embodiment of the AAV capsid protein mutant of the present invention, the amino acid sequence thereof is as shown in any one of SEQ ID No.1 to SEQ ID No. 4.

As a preferred embodiment of the AAV capsid protein mutant of the present invention, the nucleotide sequence thereof is as shown in any one of SEQ ID No.5 to SEQ ID No. 8.

In a third aspect, the invention provides a recombinant adeno-associated virus having non-activated T cell targeting, comprising the AAV capsid protein mutants.

The recombinant adeno-associated virus vector has better infection capability to unactivated T cells, and has the advantages of low dosage, strong infection and good safety. The unactivated T cell infection can realize the advantages of the current day infection of the collected cells and the current day reinfusion, greatly reduces the preparation cost and can reduce the influence on the activity of the T cells.

As a preferred embodiment of the recombinant adeno-associated virus of the invention, a heterologous gene of interest is also included.

As a preferred embodiment of the recombinant adeno-associated virus of the invention, the heterologous gene of interest encodes any one of the gene products interference RNA, aptamer, endonuclease, guide RNA.

In a fourth aspect, the present invention provides the use of said heterologous peptide, said AAV capsid protein mutant, said recombinant adeno-associated virus in the manufacture of a medicament for delivering a gene product to a cell of a subject.

As a preferred embodiment of the use according to the invention, the cells are immune cells.

In a fifth aspect, the present invention provides the use of said heterologous peptide, said AAV capsid protein mutant, said recombinant adeno-associated virus in infecting non-activated T cells.

In a sixth aspect, the present invention provides use of the heterologous peptide, the AAV capsid protein mutant, and the recombinant adeno-associated virus in the preparation of a tumor immunotherapeutic agent.

As a preferred embodiment of the use according to the invention, the immunotherapy comprises CAR-T therapy or TCR-T therapy.

Compared with the prior art, the invention has the beneficial effects that:

the recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant obtained by screening has the advantages of high efficiency of targeting unactivated T cells, low dosage, strong infection and good safety. Compared with the prior art that the T cells are infected after being stimulated by using the stimulating factors (48 h), the inactivated T cell infection can realize the advantages of the current day of cell collection and the current day of reinfusion, and the preparation cost is greatly reduced. And the unactivated T cells reduce in vitro culture and treatment time, and can reduce the influence on the activity of the T cells. Compared with slow virus related genome integration and low efficiency of infection of unactivated T cells, AAV capsid protein mutants obtained by screening of the invention do not need to integrate genome, and can realize rapid infection and reinfusion, and reduce unnecessary quality inspection and in vitro residence time. The invention provides a method for delivering gene products to non-activated T cells, which has the advantages that in view of the fact that the activated T cells are rapidly expanded in vitro to reduce anticancer activity, the effect is not as good as that of the non-activated T cells, and the AAV capsid protein mutant obtained by screening has great clinical value and commercial application scene when the non-activated T cells are infected.

Drawings

FIG. 1 shows fluorescence intensity of EGFP (72 h) of T cells infected with different rAAV virions by fluorescence microscopy; a and B are control rAAV6 viruses, and C-F are AAV6 capsid protein mutant viruses 1-4.

FIG. 2 shows fluorescence intensity of EGFP (96 h) of T cells infected with different rAAV virions by fluorescence microscopy; a and B are control rAAV6 viruses, and C-F are AAV6 capsid protein mutant viruses 1-4.

FIG. 3 shows the relative intensity of EGFP mRNA in T cells (72 h) of AAV6 capsid protein mutant virus 1 detected by RT-qPCR.

FIG. 4 shows the flow cytometer detection of EGFP fluorescence intensity in T cells (96 h) for AAV6 capsid protein mutant virus 1.

FIG. 5 shows the relative intensity of EGFP mRNA in T cells (72 h) of RT-qPCR assay for AAV6 capsid protein mutant virus 2.

FIG. 6 shows the fluorescence intensity (96 h) of EGFP in T cells from a flow cytometer detecting AAV6 capsid protein mutant virus 2.

FIG. 7 shows the relative intensity of EGFP mRNA in T cells (72 h) of AAV6 capsid protein mutant virus 3 detected by RT-qPCR.

FIG. 8 shows the flow cytometer detection of EGFP fluorescence intensity in T cells (96 h) for AAV6 capsid protein mutant virus 3.

FIG. 9 shows the relative intensity of EGFP mRNA in T cells (72 h) of AAV6 capsid protein mutant virus 4 detected by RT-qPCR.

FIG. 10 shows the flow cytometer detection of EGFP fluorescence intensity in T cells (96 h) for AAV6 capsid protein mutant virus 4.

Detailed Description

For a better description of the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to the following specific examples. It will be appreciated by persons skilled in the art that the specific embodiments described herein are for purposes of illustration only and are not intended to be limiting.

The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are all commercially available. The GenBank accession number of AAV6 VP1 is AF028704.1.

Example 1: screening for AAV6 mutants effective in infecting unactivated T cells

(1) Construction of AAV6 library backbone vector

AAV6 library backbone vectors comprise CAG promoter, intron, mutated AAV6 CAP sequence [ the sequence after T589 of AAV6 CAP sequence is removed, the T of N583 and the sequence of polyA front section form the site for subsequent cleavage of the backboneBsrGI（TGTACA）)]And polyA. The sequences are synthesized by a gene synthesis mode and inserted between ITRs of the rAAV vector to form the AAV6 library skeleton vector.

(2) Construction of mutant Rep-CAP vectors

The Rep-CAP vector expresses Rep protein by introducing a stop codon within the first 20bp of the VP1, VP2 and VP3 initiation codes of the CAP sequence in AAV6, and can not express VP1, VP2 and VP3 proteins of CAP, so that the pollution of the CAP sequence in the parent AAV6 is avoided. The above sequences were synthesized by means of gene synthesis and CAP sequences were inserted in place of the Rep-CAP vector.

(3) Construction of a random 7 peptide vector library

2 primers (the insertion site is positioned between S588 and T589 of AAV6, the upstream primer targets the nucleic acid sequence after the template T589, the downstream primer targets the CAP end sequence), and the 5' -ends of the upstream primer and the downstream primer both have homologous arm sequences which are more than 15bp and consistent with the skeleton. Furthermore, the upstream primer introduced a 21bp nucleic acid sequence (7 x nnk) between the homology arm sequence and the targeting sequence to introduce the random 7 peptide into the CAP sequence.

The base sequence of the 2 primers (5 '- > 3') is as follows:

V6-7P-F：

GGGACTGTGGCAGTCAATCTCCAGAGCAGCAGCNNKNNKNNKNNKNNKNNKNNKACAGACCCTGCGACCGGAGAT；

V6-Stop-R：

CGGTTTATTGATTAACAATCGATTACAGGGGACGGGTGAGGTAAC。

the AAV6 CAP-containing vector was used as a template and PCR amplification was performed using the primers described above to obtain fragments containing random sequences. Gel electrophoresis and gel recovery are carried out on the fragments to obtain purified nucleic acid fragments of the random 7 peptide library; ligating the nucleic acid fragment into AAV6 library backbone vector by means of Gibson homologous recombination ligation (viaBsrGI, enzyme digestion and glue recovery and purification); after the connected vector is purified by a PCR product purification kit, the connected vector is digested by Plasmid-Safe DNase enzyme to remove fragments which are not connected; finally purifying by a PCR product purification kit to obtain the constructed AAV6 vector library.

(4) Construction of AAV6 mutant Virus library

Co-transferring mutant Rep-Cap plasmid, AAV6 vector library and pHelper plasmid into HEK-293T cells, purifying adeno-associated virus by iodixanol gradient ultra-high speed centrifugation, and measuring virus titer at 1×10 ¹² GC/mL～1×10 ¹³ GC/mL is proper titer, and the AAV6 mutant virus library is obtained and placed at the temperature of minus 80 ℃ for standby.

(5) T cell screening AAV6 mutants

1) Resuscitation of T cells and AAV infection

RPMI 1640 culture was pre-warmed based on 37 ℃; taking and freezing CD3 ⁺ T cells, rapidly thawed; sucking the resuscitated cells into a 50mL centrifuge tube, adding 12mL of RPMI 1640 medium containing 1% FBS, and centrifuging 300g for 10-15 min; cells were resuspended in 1mL of RPMI 1640 medium containing 1% FBS, counted (trypan blue staining, total count and dead cells count) and 1X 10 cells were added to each well of the cell culture plate ⁶ A cell suspension; 3X 10 per well ¹⁰ The GC dose was added to AAV6 mutant virus libraries to infect non-activated T cells for 6h. The uninfected adeno-associated virus was removed by pipetting. Cells were aspirated into 15mL centrifuge tubes and added dropwise12mL of RPMI 1640 medium containing 1% FBS, 300g was centrifuged for 8min, the medium was aspirated, and the procedure was repeated once; the cells were resuspended in 1000. Mu.L of medium (10% FBS, 25. Mu.L/mL CD3/CD 28T cell activator, 50U/mL rhIL 2) and cultured in a cell culture incubator for 72h (37 ℃,5% CO) ₂ ）。

2) Total RNA extraction and RT-PCR

Cells were aspirated into a 1.5mL centrifuge tube, and the cells were collected by centrifugation at 300g for 15min and the liquid was aspirated. The RNA extraction procedure was as per TransZol Up Plus RNA Kit (full gold, ER 501). RNA sample extraction Using PrimeScript ^TM IV 1st strand cDNA Synthesis Mix (Takara, 6215A) first strand cDNA was synthesized. Then using NEB Q5 to carry out 2 rounds of PCR amplification, wherein the first round of amplification uses an outer primer, the second round of amplification uses a first round of product recovered by gel as a template, uses NGS primers to carry out amplification, and uses gel to recover PCR products with corresponding strip sizes to carry out NGS sequencing; sequencing, analyzing sequencing data, constructing AAV mutant sub-libraries by selecting sequences with the top frequency of occurrence, constructing sub-libraries, performing a round of screening process, and constructing sub-vector libraries, packaging toxin, screening and the like according to the construction process. Screening AAV capsid protein mutants 1-4, wherein the VP1 amino acid sequence is shown as SEQ ID No. 1-SEQ ID No.4, and the nucleotide sequence is shown as SEQ ID No. 5-SEQ ID No. 8; the amino acid sequences of the targeting peptides in VP1 are shown as SEQ ID No. 9-SEQ ID No.12, and the nucleotide sequences are shown as SEQ ID No. 13-SEQ ID No. 16.

Example 2: construction of AAV capsid protein mutants and production of viruses

The r AAV6 is used as a control to construct AAV capsid protein mutants 1-4, which are specifically as follows:

(1) Construction of mutant serotype vectors and plasmid extraction

The Rep-CAP plasmid was usedSmiI andBshTi, double enzyme digestion, gel electrophoresis and gel recovery are carried out by cutting off a fragment band of about 5000bp, and the enzyme-digested skeleton fragment is obtained. And designing primers according to Cap sequences of the target mutants 1-4 obtained by screening to construct plasmids of the target mutant AAV. F was used with the Rep-CAP plasmid of AAV6 as a templateThe 1+R1 primer is subjected to PCR amplification to obtain a target product 1, and the target product 2 is obtained by using the Rep-CAP plasmid of AAV6 as a template and using the F2+R2 primer. The skeleton and the fragments have homologous arm sequences, and the fragments can be assembled into a complete vector through Gisbon in a multi-fragment manner.

The primer of the PCR product 1 in the construction of the AAV capsid protein mutant 1 vector is Cap-f+YJ191-R, and the primer of the PCR product 2 is YJ191-F+cap-R. The primer sequences (5 '- > 3') involved are:

YJ191-F：

ACTGAGGCGTCTCGTCGGCTGACAGACCCTGCGACCGGAGA；

YJ191-R：

CAGCCGACGAGACGCCTCAGTGCTGCTGCTCTGGAGATTGAC。

the primer of the PCR product 1 in the construction of the AAV capsid protein mutant 2 vector is Cap-f+YJ192-R, and the primer of the PCR product 2 is YJ192-F+cap-R. The primer sequences (5 '- > 3') involved are:

YJ192-F：

AGTGGGGGGCAGTCGCGTGGGACAGACCCTGCGACCGGAGA；

YJ192-R：

CCCACGCGACTGCCCCCCACTGCTGCTGCTCTGGAGATTGAC。

the primer of the PCR product 1 in the construction of the AAV capsid protein mutant 3 vector is Cap-f+YJ193-R, and the primer of the PCR product 2 is YJ193-F+cap-R. The primer sequence (5 '- > 3') involved is

YJ193-F：

GAGAGGGGGGGGCCGCGTGGTACAGACCCTGCGACCGGAGA；

YJ193-R：

ACCACGCGGCCCCCCCCTCTCGCTGCTGCTCTGGAGATTGAC。

The primer of the PCR product 1 in the construction of the AAV capsid protein mutant 4 vector is Cap-f+YJ194-R, and the primer of the PCR product 2 is YJ194-F+cap-R. The primer sequence (5 '- > 3') involved is

YJ194-F：

AGTGGGGCTGGTCGGTTGGCGACAGACCCTGCGACCGGAGA；

YJ194-R：

CGCCAACCGACCAGCCCCACTGCTGCTGCTCTGGAGATTGAC。

The sequences of the primers Cap-f and Cap-r involved in the construction of the AAV capsid protein mutants 1-4 are as follows:

Cap-f：CATCTTTGAACAATAAATGATTTAAATCAGGTATG；

Cap-r：TCAACTGAAACGAATCAACCGGTTT。

taking 1 clean 200uLPCR tube as a mark and placing on an ice box, and cutting the enzyme-cleaved framework, the target fragment 1 and the target fragment 2 according to the framework: preparing a reaction solution with the fragment molar ratio of 1:3, and carrying out recombination connection in a PCR instrument at 50 ℃ for 30 min. Thawing 50 mu L of competent cells on ice, mixing 10 mu L of the connection product with DH5 alpha competent cells, and standing on ice for 20-30 min; heat shock at 42 ℃ for 45 seconds; rapidly placing on ice for 2 minutes, adding 400 mu L of recovery SOC culture medium (without antibiotics), and culturing at 37 ℃ and 200rpm for 1 hour; the mixture was spread on Amp-resistant plates (50. Mu.g/ml) and incubated at 37℃for 14 hours. Monoclonal bacteria were selected and grown in 4ml of liquid LB medium (Amp+ resistant) for 14 hours at 37 ℃.

Centrifuging the bacterial liquid for 1 minute at 12000rpm, and pouring out the supernatant culture medium; adding 250 mu L of bufferP1/RNaseA mixed solution, and high-speed vortex to re-suspend bacteria; adding 250 mu L of bufferP2, and reversing the mixture for 8 to 10 times; adding 350 mu L of bufferP3, immediately reversing and uniformly mixing for 8-10 times to thoroughly neutralize the solution; centrifuging at 13000rpm for 10min, and collecting supernatant; centrifuging 12000 for 1 minute, pouring out the waste liquid, adding 500 mu L PW1, centrifuging 12000 for 1 minute, and pouring out the waste liquid; 600 μl of PW2 was added, 12000 centrifuged for 1min, and the supernatant was decanted; 600 μl of PW2 was added, 12000 centrifuged for 1min, and the supernatant was decanted; idle at 12000rpm for 2 minutes; 30-50 mu L of the preheated eluent at 55 ℃ is added, and the mixture is kept stand for 2 minutes and centrifuged at 12000rpm for 1 minute. Concentration detection was performed using a micro nucleic acid quantitative instrument.

The obtained plasmid is subjected to concentration detection, 10 mu L of positive plasmid identified by enzyme digestion is taken and sequenced, and the positive plasmid is stored at-20 ℃. Sequencing results showed that the obtained plasmid was able to encode the variant capsid protein VP1. Finally, relevant Helper plasmids were extracted according to the amount of virus required for the post-test, and each group of Rep-Cap plasmids (AAV 6, AAV6 mutants 1-4) plasmids and GOI plasmids (comprising scAAV, CAG, EGFP, WPREs, SV pA).

(2) Packaging and purification of mutant serotype viruses

The obtained Rep-Cap plasmids of each group (rAAV 6 and AAV capsid protein mutant), plasmids Expressing Green Fluorescent Protein (EGFP) and pHelper plasmids are co-transferred into HEK-293T cells in proper amounts, AAV viruses are purified by iodixanol gradient ultra-high speed centrifugation, and the virus titer is measured to be 1X 10 ¹² GC/mL～1×10 ¹³ GC/mL is proper titer, and the AAV6 virus and AAV6 capsid protein mutant virus 1-4 are obtained and placed at-80 ℃ for standby.

Example 3: comparative detection of various indexes of mutant serotypes

(1) AAV-infected T cells and cell culture

Setting groups: controls AAV6 virus and AAV6 capsid mutant viruses 1-4.

RPMI 1640 culture was based on pre-heating at 37 ℃. Taking and freezing CD3 ⁺ T cells, rapidly thawed; sucking the recovered cells into 50mL centrifuge tubes, adding 12mL RPMI 1640 culture medium containing 1% FBS, and centrifuging 300g for 10-15 min; the cells were resuspended in 1mL of RPMI 1640 medium containing 1% FBS, counted (trypan blue staining, total number of cells counted and dead cells counted) and the cell density was adjusted to 1X 10 based on the result of the cell counting ⁶ cells/mL, groups according to experiments, 100. Mu.L of cell suspension (cell number 1X 10) was added to 96-well cell culture plate wells ⁵ cells/holes); each group was infected with T cells in groups of MOI 1E5 (AAV 6 high dose group MOI 1E 6) for 3h. Thereafter, a liquid change was performed to remove uninfected AAV. Cells were aspirated into 1.5mL centrifuge tubes, 1mL of RPMI 1640 medium containing 1% fbs was added dropwise, centrifuged at 300g for 8min, the medium was aspirated, and the procedure was repeated once; the cells were resuspended in 100uL medium (10% FBS,25uL/mL CD3/CD 28T cell activator, 50U/mL rhIL 2), and cultured in a cell culture incubator for 72h (37 ℃,5% CO) ₂ ）。

(2) Fluorescent observation

Fluorescent photographs (consistent photographic parameters and exposure time) were taken of each group of T cells at 72h, 96h, respectively, using a fluorescent microscope.

(3) Detection of mRNA expression level of interest

1) Total RNA extraction:

each group of cells was aspirated into a 1.5mL centrifuge tube, 300g, and the cells were collected by centrifugation for 15min, followed by pipetting off the liquid. The RNA extraction procedure was as per TransZol Up Plus RNA Kit (full gold, ER 501). 200ul of tranZol up is added into each tube of cells, 40 mu L of chloroform is added, and the cells are vigorously shaken for 30s and applied for 3min at room temperature; centrifuge at 12,000g at 4℃for 10 min. Transferring colorless aqueous phase into new 1.5ml RNase-free EP tube, adding equal volume of absolute ethanol, and mixing by gently reversing; adding the obtained solution and the precipitate into a centrifugal column, centrifuging at room temperature for 30s at 12,000g, and discarding the filtrate; adding 500 mu L of CB9 and 12,000g of the mixture, centrifuging for 30s at room temperature, and discarding the filtrate; repeating the process once; adding 500 mu L of WB9, centrifuging at 12,000g for 30s at room temperature, and discarding the filtrate; repeating the process once; centrifuging at room temperature for 2min at 12,000g to thoroughly remove residual ethanol; the column was placed in a 1.5ml RNase-free EP tube, 50. Mu.L RNase-free Water was added to the center of the column, and the column was allowed to stand at room temperature for 1min; centrifuging at room temperature for 1min at 12,000g, eluting RNA; the RNA concentration of the sample was measured using a micro nucleic acid quantitative analyzer, and the RNA concentration, OD260/280, and OD260/230 were measured, and the extracted RNA was stored at-80 ℃. First strand cDNA synthesis was performed using HiScript III RT SuperMix for qPCR (+gDNA wind) (Northenan, R323) for each set of RNA samples.

2) Quantitative PCR (qPCR) experiment

The qPCR system configuration was performed using each set of cDNAs as templates according to the instructions of 2X SYBR Green qPCR Master Mix (Bimake, B212203) as shown in Table 1:

TABLE 1 qPCR System

The primer sequence (5 '- > 3') is as follows:

EGFP-Tf：GCTGGAGTACAACTACAAC；

EGFP-Tr：TGGCGGATCTTGAAGTTC；

GAPDH101-F：CTGGGCTACACTGAGCACC；

GAPDH101-R：AAGTGGTCGTTGAGGGCAATG。

qPCR program settings are shown in table 2:

TABLE 2 qPCR procedure

And calculating the relative expression according to the Ct value of each group and the formula 2-delta Ct.

3) Flow cytometer detection

Each group of T cells cultured for 96h as described above was collected: cells and supernatant from each well were collected in a 1.5mL EP tube, 1mL of 2% FBS in PBS was added dropwise, the supernatant was removed after centrifugation for 8min at 300g, washing was repeated once, 100. Mu.L of 2% FBS was added after removal of supernatant to resuspend, and the suspension was blown off with a gun head to form a single cell suspension, and the single cell suspension was placed on ice for up-flow detection.

The infection results of the AAV capsid protein mutants 1-4 on the unactivated T cells are shown in figures 1 and 2, and compared with the rAAV6 control group with different MOI, the AAV capsid protein mutant has better infection effect on the unactivated T cells in terms of fluorescence intensity and fluorescence cell proportion in the flow analysis and relative mRNA expression amount in spite of EGFP fluorescence intensity at different time points (72 h and 96 h).

For AAV capsid mutant 1, the relative expression of mRNA (FIG. 3) shows that AAV capsid mutant (MOI: 1E 5) is about 45-fold stronger than rAAV6 (MOI: 1E 5) control, and also much stronger than rAAV6 (MOI: 1E 6) control. Flow cytometry showed (FIG. 4) that the AAV capsid protein mutant (MOI: 1E 5) had a fluorescent cell fraction of over 90%, whereas the rAAV6 (MOI: 1E 5) control group was less than 40% and the fluorescence intensity of the master cell population (about 1E 3) was about 100-fold lower than that of the AAV capsid protein mutant (MOI: 1E 5) (about 1E 5) for the master cell population.

Relative mRNA expression was shown (FIG. 5) for AAV capsid mutant 2, which was approximately 3.37-fold stronger (MOI: 1E 5) than for the rAAV6 (MOI: 1E 5) control group. Flow cytometry detection showed (FIG. 6) that AAV capsid protein mutant (MOI: 1E 5) had a 96h fluorescent cell fraction of 85.5%, higher than 37.6% for rAAV6 (MOI: 1E 5) and 51.1% for rAAV6 (MOI: 1E 6), and the fluorescence intensity of the master cell population was also higher than for rAAV6 (MOI: 1E5 and 1E 6).

Relative mRNA expression was shown for AAV capsid mutant 3 (FIG. 7), which was approximately 4.41-fold stronger for AAV capsid mutant (MOI: 1E 5) than for rAAV6 (MOI: 1E 5) control. Flow cytometry detection showed (FIG. 8) that AAV capsid protein mutant (MOI: 1E 5) had a 96h fluorescent cell fraction of 85.9%, higher than 37.6% of rAAV6 (MOI: 1E 5) and 51.1% of rAAV6 (MOI: 1E 6), and the fluorescence intensity of the master cell population was also higher than rAAV6 (MOI: 1E5 and 1E 6).

Relative mRNA expression was shown for AAV capsid mutant 4 (FIG. 9), which was approximately 5.62-fold stronger for AAV capsid mutant (MOI: 1E 5) than for rAAV6 (MOI: 1E 5) control. Flow cytometry detection showed (FIG. 10) that AAV capsid protein mutant (MOI: 1E 5) had a 96h fluorescent cell fraction of 59.8%, higher than 37.6% for rAAV6 (MOI: 1E 5) and 51.1% for rAAV6 (MOI: 1E 6), and the fluorescence intensity of the master cell population was also higher than for rAAV6 (MOI: 1E5 and 1E 6).

On the other hand, for rAAV6 with strong infection ability on immune cells, the infection ability on unactivated T cells is still low, and even if the MOI of rAAV6 is increased to 1E6 in the control group, no obvious infection effect increase is seen relative to MOI 1E5, which indicates that rAAV6 cannot infect unactivated T cells very effectively.

Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present invention may be modified or substituted equally without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. An AAV capsid protein mutant having non-activated T cell targeting, comprising a heterologous peptide; the insertion site of the heterologous peptide is located between AAV capsid protein amino acids 588 and 589; the amino acid sequence of the heterologous peptide is shown as any one of SEQ ID No. 9-12.

2. The AAV capsid protein mutant according to claim 1, wherein the nucleotide sequence of the heterologous peptide is as shown in any one of SEQ ID nos. 13 to 16.

3. The AAV capsid protein mutant according to claim 1, wherein the amino acid sequence is as shown in any one of SEQ ID nos. 1 to 4.

4. The AAV capsid protein mutant according to claim 1, wherein the nucleotide sequence is as shown in any one of SEQ ID nos. 5 to 8.

5. A recombinant adeno-associated virus having non-activated T cell targeting comprising an AAV capsid protein mutant according to any one of claims 1-4.

6. The recombinant adeno-associated virus of claim 5, further comprising a heterologous gene of interest.

7. The recombinant adeno-associated virus according to claim 6, wherein the heterologous gene of interest encodes any one of interfering RNA, aptamer, endonuclease, guide RNA gene product.

8. Use of an AAV capsid protein mutant according to any one of claims 1 to 4, a recombinant adeno-associated virus according to any one of claims 5 to 7, in the manufacture of a medicament for delivering a gene product to a cell of a subject.

9. The use according to claim 8, wherein the cells are immune cells.

10. Use of the AAV capsid protein mutant according to any one of claims 1 to 4, the recombinant adeno-associated virus according to any one of claims 5 to 7 for non-disease diagnosis and treatment purposes in infection of non-activated T cells.

11. Use of the AAV capsid protein mutant of any one of claims 1-4, the recombinant adeno-associated virus of any one of claims 5-7 in the preparation of a tumor immunotherapeutic.

12. The use of claim 11, wherein the immunotherapy comprises CAR-T therapy or TCR-T therapy.