CN114891779A - Detection method for cloned TCR sequence and application thereof - Google Patents

Detection method for cloned TCR sequence and application thereof Download PDF

Info

Publication number
CN114891779A
CN114891779A CN202210355999.6A CN202210355999A CN114891779A CN 114891779 A CN114891779 A CN 114891779A CN 202210355999 A CN202210355999 A CN 202210355999A CN 114891779 A CN114891779 A CN 114891779A
Authority
CN
China
Prior art keywords
tcr
cancer
cell
carcinoma
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
CN202210355999.6A
Other languages
Chinese (zh)
Inventor
王文博
冯爱华
王鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Liling Biopharmaceutical Suzhou Co ltd
Original Assignee
Liling Biopharmaceutical Suzhou Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Liling Biopharmaceutical Suzhou Co ltd filed Critical Liling Biopharmaceutical Suzhou Co ltd
Publication of CN114891779A publication Critical patent/CN114891779A/en
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001111—Immunoglobulin superfamily
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5091—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing the pathological state of an organism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5156—Animal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5158—Antigen-pulsed cells, e.g. T-cells

Abstract

The invention relates to the technical field of medicines, in particular to a method for rapidly cloning a paired TCR sequence and application thereof. A method for rapidly cloning paired TCR sequences, said method comprising the steps of: sorting and capturing single tumor reactive T cells from tumor tissues, extracting and marking mRNA of the single cells, carrying out reverse transcription and constructing full-length cDNA, carrying out cDNA specificity PCR amplification to obtain a cDNA full-length transcription group, carrying out first cyclization after enrichment, carrying out TCR sequence specificity amplification, carrying out second cyclization after enrichment and carrying out enrichment again, connecting an enrichment product to an expression vector to obtain TCR full-length clone, and carrying out library sequence comparison to obtain a paired TCR sequence. The invention has the advantages that: paired TCR cloning of hundreds of cells is realized in a reverse transcription system, and the paired TCR can be quickly obtained with low cost and high flux.

Description

Detection method for cloned TCR sequence and application thereof
Technical Field
The invention relates to the technical field of medicines, in particular to a detection method for cloning a TCR sequence and application thereof.
Background
The T Cell Receptor (TCR) is a characteristic marker of the surface of all T cells, and it specifically recognizes the antigenic peptide-MHC complex on antigen presenting cells, thereby triggering a T cell immune response. Since TCR molecule determines antigen recognition specificity of T cell, if TCR specific to tumor antigen is transferred into common T cell, recognition ability of tumor antigen of the T cell can be strengthened, and after in vitro activation and proliferation, the T cell can be infused into patient body to exert anti-tumor effect. Therefore, a large number of T cells for identifying specific antigens can be conveniently obtained by utilizing a TCR gene introduction method, the T cells modified by the TCR gene are called TCR-T, and the TCR-T becomes a research hotspot in tumor immunotherapy in recent years and shows good treatment effect in clinical experiments. TCR-T Cell therapy (T Cell Receptor-Gene Engineered T Cells) screens and identifies a TCR sequence capable of specifically binding a target antigen, transfers the TCR sequence into T Cells (or heterogenous T Cells) from peripheral blood of a patient by adopting a genetic engineering means, and then transfuses the modified T Cells into the body of the patient so as to ensure that the T Cells specifically identify and kill tumor Cells expressing the antigen, thereby achieving the purpose of treating tumors.
The TCR is a heterodimer formed by two peptide chains of alpha and beta, and each peptide chain is divided into a variable region (V region), a constant region (C region), a transmembrane region, a cytoplasmic region and the like; the cytoplasmic domain is short and signaling is mainly through the CD3 molecule, which is bound to it non-covalently. The TCR molecule belongs to the immunoglobulin superfamily, and the antigen specificity exists in the V region; the V regions each have three hypervariable regions CDR1, CDR2, and CDR3, of which the greatest variation in CDR3 directly determines the antigen-binding specificity of the TCR. When the TCR recognizes the MHC-antigen peptide complex, CDR3 is directly bound to the antigen peptide.
The TCR screening technology is the most central part of TCR-related drug development. However, the existing TCR screening has high cost, long time consumption and low efficiency, and particularly, the acquisition of the paired TCR full-length gene is a rate-limiting step in the whole process, thereby seriously influencing the research and development of TCR related medicaments.
The main methods for cloning TCR genes currently exist as follows:
1. and (3) carrying out single cell sorting on the T cell group, then carrying out cracking and reverse transcription on the single cell, and finally carrying out single cell horizontal PCR by using a multiple degenerate primer targeting the TCR variable region and a primer targeting the TCR constant region to amplify the TCR variable region. The method is a method for rapidly acquiring the TCR variable region at low cost, but the method uses the degenerate primer in the TCR variable region, so the amplified region is only a partial region, is not the whole length of the TCR, and cannot be directly applied to downstream molecular construction and protein expression. Database sequence alignments are generally required and full-length sequences are taken From the database and then subjected to gene synthesis to obtain full-length TCR sequences (Rapid Identification and Evaluation of Neoantigen-reactive T-Cell Receptors From Single cells. J Immunother.2021 Jan; 44(1): 1-8.).
2. Single cell sorting of T cell populations followed by activation and expansion of individual T cells with activators typically takes about two weeks to convert individual T cells into a clonal population of T cells, up to hundreds or thousands of cells. Then, the method of 5' RACE (rapid amplification of cDNA ends) is used for carrying out TCR variable region full-length amplification, the TCR full-length gene can be obtained after amplification, and the TCR full-length gene can be obtained by subsequent direct amplification. However, this method is very time-consuming, many single cells cannot successfully form a polyclonal clone, the cost of the kit is very high, and the TCR gene cannot be amplified in large quantities (Development of a CD8co-receptor independent T-cell receptor specific for molecular-associated antigen MAGE-A4 for next generation T-cell-based immunological therapy. J immunological cancer. 2021; 9 (3)).
3. The third method is to sort the T cell group by single cell, then directly carry out 5' RACE amplification on the whole length of TCR variable region at the single cell level, and then carry out PCR amplification to obtain the whole length gene of TCR. This method is simple, but also because each cell needs a separate reaction system, reagent consumption is large, kit cost is high, and it is impossible to amplify TCR gene in large quantity (An immunogenic NP 105-113-B07: 02 cytoxic T cell response control and is associated with free segment CODV-19 disease. Nat. Immunol. 2022; 01; 23(1): 50-61.).
4. The fourth method is to label each T cell in the T cell population with single cell DNA barcode and then obtain paired TCR full length sequence information using high throughput sequencing methods. And (4) carrying out gene synthesis on the paired TCR determined by screening to obtain the full-length TCR gene. Although this method can obtain a large amount of paired TCR sequences at low cost, it can only obtain sequence information, and cannot directly obtain full-length gene fragments of TCR variable regions, and the cost of subsequent gene synthesis is high, and it cannot carry out TCR synthesis in large amounts (Direct identification of neo anti genetic TCRs from either plasmid high-throughput single-cell sequencing. journal for ImmunoTherapy of Cancer 2021; 9: e 002595.).
Therefore, the current methods for obtaining the full-length TCR sequences have some defects.
Tumor-reactive T cells in tumors function via T cell receptors, but are generally depleted and difficult to use directly. How to clone the TCR sequences of the tumor reactive T cells quickly and cheaply and then transduce the T cells into primary T cells to prepare the T cells with better state is a technology expected to break through in the field of tumor treatment at present.
Disclosure of Invention
The invention aims to provide a rapid low-cost detection method for cloning and pairing a TCR full-length sequence and application thereof in the field of treatment, particularly personalized treatment.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a method of cloning a paired TCR sequence, said method comprising the steps of: sorting and capturing single tumor reactive T cells from tumor tissues, extracting and marking mRNA of the single cells, carrying out reverse transcription and constructing full-length cDNA, carrying out cDNA specificity PCR amplification to obtain a cDNA full-length transcription group, carrying out first cyclization after enrichment, carrying out TCR sequence specificity amplification, carrying out second cyclization after enrichment and carrying out enrichment again, connecting an enrichment product to an expression vector to obtain TCR full-length clone, and carrying out library sequence comparison to obtain a paired TCR sequence.
In one embodiment, the pairing method comprises adding TSO to the reverse transcription system during reverse transcription of mRNA, and amplifying to complete enrichment of the cDNA full-length transcription set.
In one embodiment, the method comprises amplifying the full-length transcriptome by using a constant region sequence at the 5' end of the single-cell labeled magnetic bead and a TSO sequence added in the reverse transcription process.
In one embodiment, the first cyclization in the method is to perform cyclization on the obtained amplification product, and perform specific amplification of TCR sequence by using constant sequence on single cell labeled magnetic beads and TCR specific primers (constant region ends) to complete TCR enrichment.
In a specific embodiment, in the second cyclization in the method, after the obtained amplification product is subjected to second cyclization treatment, TCR enrichment is performed by using forward and reverse primers designed according to a constant sequence of a single-cell labeled magnetic bead, and the enriched cell barcode is connected with a TCR constant region and is located at the 3' end of the enriched product.
In one embodiment, the paired TCR sequences comprise the TCR-alpha and TCR-beta series.
In one embodiment, the method of sorting individual tumor-reactive T cells is: the tumor tissue is digested into single cells, and the single cells are prepared into single cell suspension and then injected into a microfluidic chip to obtain single tumor reactive T cells.
In one embodiment, the method for extracting and marking single-cell mRNA comprises the following steps: after the single tumor reactive T cells are separated, single cell labeled magnetic beads are added into the micropores to complete the capture and labeling of mRNA of the single cells.
In one embodiment, the single-cell labeled magnetic bead has a single-stranded DNA oligo carrying 2 constant sequences, specific barcode sequence and poly dT on its surface.
In one embodiment, the single cell labeled magnetic beads carry different barcodes for labeling individual T cells and poly dT for capturing total mRNA and serving as reverse transcription primers.
In one embodiment, the library sequence alignment is: after TCR-alpha and TCR-beta full length cloning, selecting single clone to compare with cell barcode, and taking TCR-alpha and TCR-beta sequence with same cell barcode as pairing TCR.
In one embodiment, the method of sorting individual tumor-reactive T cells is: the single cell suspension is subjected to staining labeling by using an antibody with a fluorescent label and then is subjected to sorting by a flow sorter.
In one embodiment, the method of sorting individual tumor-reactive T cells is: tumor tissues are digested into single cells, the single cell suspension is stained and marked by using an antibody CXCL13-APC with a fluorescent label, and the single cells are sorted by a flow sorter to obtain CXCL13 positive T cells in the tumor single cell suspension, namely tumor reactive T cells.
Further, in one embodiment, the paired TCR sequences of the invention are obtained by:
s01, injecting a certain amount of tissue cells into a customized microfluidic chip, wherein the surface of the chip is provided with micropores capable of accommodating single cells, and the single cells are separated according to the Poisson distribution principle.
And S02, adding single cell labeled magnetic beads into the micropores, and capturing and labeling mRNA of the single cells by using the single cell labeled magnetic beads. The single-stranded DNA oligo carrying 2 constant sequences, specific barcode sequence and poly dT is on the surface of the single-cell labeled magnetic bead. Each magnetic bead carries a different barcode for labeling individual T cells and polydT for capturing total mRNA and as a reverse transcription primer.
S03, after single T cells are marked, reverse transcription of mRNA is started, and cDNA is obtained.
S04, adding TSO (template switch oligo) into the reverse transcription system as the primer binding region for the subsequent PCR. The enrichment of the full-length transcription set is completed by amplifying the constant region sequence at the 5' end of the single-cell labeled magnetic bead and the TSO sequence added in the reverse transcription process.
S05, carrying out cyclization treatment on the obtained amplification product, and carrying out TCR sequence specific amplification by using a constant sequence on the single cell labeled magnetic bead and a TCR specific primer (constant region end) to complete TCR enrichment.
S06, carrying out second cyclization treatment on the obtained amplification product, and then carrying out TCR enrichment by using forward and reverse primers designed according to a constant sequence of a single cell labeled magnetic bead, wherein the enriched cell barcode is connected with a TCR constant region and is positioned at the 3' end of the enriched product. Finally, connecting the enriched product of the TCR to an expression vector to complete the full-length cloning of the TCR.
S07, after TCR-alpha and TCR-beta full length cloning is carried out according to the steps, a single clone is selected to carry out cell barcode comparison, and TCR-alpha and TCR-beta sequences with the same cell barcode are paired TCRs.
In a second aspect, the invention provides a TCR-T cell.
The invention provides a TCR-T cell, which is obtained by injecting a paired TCR sequence obtained by the method into a corresponding T cell through a biological engineering technology.
Further, the corresponding T cell refers to an individual's own T cell or a heterologous T cell.
Further, the allogeneic T cells are T cells of different individuals of the same species and/or T cells of different species.
Further, the allogeneic T cells may be T cells from different individuals of a human or from other animal bodies.
In a third aspect, the present invention provides a pharmaceutical composition.
A pharmaceutical composition comprising TCR-T cells obtainable according to the second aspect of the invention.
Further, the pharmaceutical composition contains a pharmaceutically acceptable carrier.
Further, the pharmaceutical composition contains a pharmaceutically acceptable carrier.
Further, the carrier is any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents and the like, which are compatible with pharmaceutical administration. Preferred examples of carriers or diluents for the dispersion medium include, but are not limited to, water, saline, ringer's solution, dextrose solution, and human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the compositions is contemplated. Supplementary active compounds may also be incorporated into the composition.
Further, the pharmaceutical composition is prepared into corresponding pharmaceutical preparations including, but not limited to, intravenous, intradermal, subcutaneous, oral, transdermal, transmucosal and rectal administration and injection.
In another embodiment, the pharmaceutical composition comprises a second active agent different from TCR-T cells, the second active agent comprising an anti-tumor agent, an agent that enhances patient resistance and/or an agent that increases patient tolerance, and the like.
The third aspect of the present invention provides a pharmaceutical composition for treating diseases associated with T cells, including infectious diseases, tumors, autoimmune diseases, and organ transplantation.
In a fourth aspect, the invention provides a diagnostic and/or assessment agent.
A diagnostic and/or assessment agent comprising TCR-T cells obtained according to the second aspect of the invention.
Further, the preparation comprises an auxiliary material, and the auxiliary material comprises a carrier or a diluent;
the carrier or diluent is: any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents compatible with TCR-T cells.
Further, the preparation is prepared into a preparation box.
In another embodiment, the diagnostic and/or assessment agent is used to diagnose or assess a T cell associated disease or event;
such diseases or events include infectious diseases, tumors, autoimmune diseases, and organ transplantation, among others.
In a fifth aspect, the present invention further provides the use of a pharmaceutical composition according to the third aspect of the present invention.
The pharmaceutical composition provided by the second aspect of the invention is used for treating diseases related to T cells, including cancer, infectious diseases and autoimmune diseases.
Further, the TCR-T cells contained in the pharmaceutical composition are T cells derived from the patient himself.
Further, the TCR sequence in the TCR-T cell is TCR full-length sequence information obtained after mRNA is obtained from the patient's own T cells.
Further, the pharmaceutical composition is used for individual precise treatment of patients with autoimmune diseases, tumors or immunological diseases.
In another embodiment, the cancer is selected from the group consisting of acute lymphocytic leukemia, acute myelogenous leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendiceal cancer, astrocytoma, neuroblastoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, bone cancer, brain tumor, breast cancer, bronchial adenoma, Burkitt's lymphoma, primary unknown carcinoma, central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disease, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma, germ cell tumor, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, glioma, colon cancer, cervical cancer, Ewing's sarcoma, germ cell tumor, bladder cancer, gastric cancer, gastrointestinal stromal tumor, colon cancer, bladder cancer, colon cancer, lung cancer, colon cancer, lung, Hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular carcinoma, Hodgkin lymphoma, hypopharyngeal carcinoma, intraocular melanoma, islet cell carcinoma, Kaposi's sarcoma, kidney cancer, larynx cancer, lip and oral cancer, liposarcoma, liver cancer, lung cancer, lymphoma, leukemia, macroglobulinemia, malignant fibrous histiocytoma of bone/osteosarcoma, medulloblastoma, melanoma, mesothelioma, metastatic squamous neck cancer with hidden primary foci, oral cancer, multiple endocrine tumor syndrome, myelodysplastic syndrome, myelogenous leukemia, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma/malignant fibrous histiocytoma of bone, ovarian cancer, epithelial ovarian cancer, ovarian germ cell tumor, pancreatic cancer, pancreatic islet cell carcinoma, Paranasal sinus and nasal cavity cancer, parathyroid gland cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumor, pituitary adenoma, pleuropulmonary blastoma, plasmacytoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, renal pelvis and ureteral transitional cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland carcinoma, sarcoma, skin cancer, merkel cell skin cancer, small bowel cancer, soft tissue sarcoma, squamous cell carcinoma, gastric cancer, T-cell lymphoma, pharyngeal cancer, thymoma, thymus cancer, thyroid cancer, trophoblastic cell tumor, unknown carcinoma of primary site, urinary tract cancer, uterine sarcoma, vaginal cancer, vulval cancer, waldenstrom's macroglobulinemia, and wilms's tumor.
In another embodiment, the autoimmune disease is selected from the group consisting of arthritis, chronic obstructive pulmonary disease, ankylosing spondylitis, Crohn's disease, dermatomyositis, type I diabetes, endometriosis, Goodpasture's syndrome, Graves 'disease, Guillain-Barre syndrome, Hashimoto's disease, hidradenitis suppurativa, Kawasaki disease, IgA nephropathy, idiopathic thrombocytopenic purpura, interstitial cystitis, lupus erythematosus, mixed connective tissue disease, hard spot disease, myasthenia gravis, lethargy, neuromuscular rigidity, pemphigus vulgaris, pernicious anemia, psoriasis, psoriatic arthritis, polymyositis, primary biliary cirrhosis, relapsing polychondritis, rheumatoid arthritis, schizophrenia, scleroderma, sjogren's syndrome, stiff person's syndrome, temporal arteritis, ulcerative colitis, vasculitis, vitiligo and Wegener's granulomatosis.
In a sixth aspect, the present invention further provides the use of a diagnostic and/or assessment preparation as provided in the fourth aspect of the present invention.
The diagnostic and/or assessment formulations provided by the fourth aspect of the invention are useful for biomarkers, antibody development, drug and vaccine assessment, immune cell differentiation tracing, immune rejection and tolerance, minimal residual disease detection, food or other allergen detection.
In another embodiment, the expression vector is a viral vector or a non-viral vector.
In another embodiment, the vector comprises a nucleic acid encoding a TCR and a nucleic acid encoding CD8 α β or CD8 α.
Drawings
FIG. 1 is a schematic diagram of single-cell labeled magnetic beads in example 2;
FIG. 2 is a flow chart of the construction technique of the TCR plasmid library of example 2;
FIG. 3 is a diagram of the electrophoretic detection of TCR alpha and TCR beta gene fragments amplified by PCR in example 2;
FIG. 4 shows the electrophoretic detection of the TCR alpha constant region and TCR beta constant region gene fragments amplified by PCR in example 2;
FIG. 5 shows the electrophoretic detection of the TCR alpha full-length fragment and TCR beta full-length fragment amplified by PCR in example 2;
FIG. 6 is a TCR-pMax map of the vector expressing the TCR of example 2;
FIG. 7 shows the electrophoretic detection of positive clones with TCR alpha and TCR beta full-length fragments linked to an expression vector in example 3;
FIG. 8 is a flow assay of TCR knockout Jurkat cells of example 4;
FIG. 9 shows the transfer of paired TCR expression plasmids into cells for flow assay expression in example 4.
Detailed Description
In order to make those skilled in the art better understand the technical solution of the present invention, the following examples further describe the present invention in detail, and the following examples are only used for illustrating the present invention, but not for limiting the scope of the present invention.
Example 1
Enrichment of tumor-reactive T cells
Tumor tissue is first surgically removed and then digested into single cells. After single cell treatment, single cell suspension was stained and labeled with fluorescent-labeled antibody: CD3-FITC, CD45-PE and CXCL 13-APC. The single cells were sorted by flow sorter (Sony; SH800S) for CXCL13 positive T cells in tumor single cell suspension. The portion of T cells carrying CXCL13 may be tumor-reactive T cells. Other tumor-reactive T cell signatures include: CD39(ENTPD-1), CD200, and the like.
Example 2
Magnetic beads were used to label paired TCR alpha and TCR beta chains and to construct a TCR plasmid library. The magnetic beads carry DNA oligos (FIG. 1) including: constant sequence 1, Barcode, constant sequence 2 and oligo dT sequence. Barcode is used to label individual cells. Oligo dT was used to capture mRNA. Constant sequence 1 and constant sequence 2 were used for circularization and PCR processes. The whole technical process of the invention is shown in figure 2.
1. Single cell sorting
1.1 Activity measurement and cell counting of the sorted cells, ensuring the cell viability to be above 85%, and counting the cells with PBSDensity is adjusted to 2 x 10 5 /ml～1×10 6 And/ml, preparing single cell suspension.
1.2 treatment of microfluidic chips
The surface of the customized microfluidic chip is provided with micropores for accommodating single cells, and the number of the micropores is 2 ten thousand (preferably 1-15 ten thousand holes). And placing the microfluidic chip on a clean culture dish, sucking 200 microliter of 100% absolute ethyl alcohol by using a 200 microliter pipette, injecting the 100% absolute ethyl alcohol into the chip from the sample inlet, sucking 100% absolute ethyl alcohol back and forth in the chip by using the pipette until no bubble appears in the chip any more, and removing the liquid in the sample outlet in time. And (3) repeatedly washing for 2-3 times, sucking 200 mu l of 0.02% PBST (0.02% Tween-20 in PBS) from the inlet to inject into the chip after removing the liquid at the sample outlet, and removing the liquid at the sample outlet in time within 10 s. And (4) reserving a small amount of liquid at the sample outlet, finally covering the culture dish cover, and standing at room temperature for later use.
1.3 injection of cells
Removing the excessive liquid from the sample inlet and outlet, adding 200 μ l PBS to rinse the chip, removing the excessive liquid from the sample outlet and sample inlet, and rinsing repeatedly for 1 time. Sucking 100 μ l of the resuspended cells (about 300-500 cells, preferably 50-2000 cells), slowly injecting into the chip at a constant speed, and immediately removing the excess liquid at the sample outlet. Standing for 5min to make the cells fall into the micropores, and observing the condition that the cells fall into the micropores under a microscope during standing. After the cells fall into the micropores, 200 mul of PBS is sucked and slowly injected into the chip at a constant speed to wash off the redundant cells, and the liquid in and out of the sample inlet and outlet is immediately removed. Repeat 1 time with PBS and wash out the cells that remained on the surface and did not fall into the wells.
1.4 injection of Single-cell labeled magnetic beads
60 mul of the resuspended single-cell labeled magnetic beads are sucked and slowly added into the sample inlet of the chip at a constant speed. And sucking 100 mu l of PBS for multiple times, slowly adding the PBS into the sample inlet at a constant speed to enable the single cell labeled magnetic beads to slowly flow, sucking the single cell labeled magnetic beads from the sample outlet in time until the single cell labeled magnetic beads reach the other end of the chip, and collecting redundant single cell labeled magnetic beads from the sample inlet and the sample outlet in the period. And (3) sucking 200 mul of PBS, slowly injecting the PBS into the chip at a constant speed, and sucking the redundant liquid from the sample inlet and outlet. Repeat 1 time with PBS until the excess single-cell labeled beads are washed away. Observing the condition that the single cell marked magnetic beads fall into the holes under a microscope, if the vacancy of the single cell marked magnetic beads at the inlet end of the chip is more, placing the recovered single cell marked magnetic beads on a magnetic frame, sucking supernatant liquid to improve the density of the single cell marked magnetic beads, injecting the mixture into the vacancy again, standing for 10s, and then washing. Similarly, if the vacancy of the single cell labeled magnetic bead at the outlet end of the chip is more, the recovered single cell labeled magnetic bead can be injected into the outlet groove, a liquid transfer device is used for sucking the single cell labeled magnetic bead into the vacancy from the inlet end, and the single cell labeled magnetic bead is washed after standing for 10 s.
2. Cell lysis and mRNA Capture
2.1 injection of lysine Buffer
Pipette 100. mu.l of lysine Buffer from the inlet and slowly inject the sample into the chip for about 15s, and immediately remove the excess liquid from the inlet and outlet. Standing at room temperature for 20min for cell lysis and mRNA release, which allows single cell labeled magnetic beads to capture mRNA.
2.2 Single-cell labeled magnetic beads were removed
2.2.1A 1.5mL centrifuge tube was labeled and placed on a 1.5mL magnetic rack.
2.2.2 keeping the magnetic frame at the bottom of the chip, adding 200 mul of Wash Buffer into the groove of the sample outlet, quickly rinsing the concave surface of the sample outlet, immediately removing the liquid after rinsing, and repeatedly rinsing for 3 times.
2.2.3 Add 200. mu.l wash buffer into the sample outlet, transfer the magnetic frame to the top of the chip, let stand for 1min, keep the magnetic frame on the top of the chip, insert 200. mu.l pipette tip into the sample inlet, suck 200. mu.l liquid, collect the liquid containing the single-cell labeled magnetic beads and transfer the liquid into a precooled 1.5mL centrifuge tube. This step was repeated 1 time and all single cell labeled magnetic beads that captured mRNA were collected.
3. Reverse transcription and amplification
3.1 placing the centrifuge tube with the single cell labeled magnetic beads on a 1.5ml magnetic frame after the centrifuge tube is centrifuged for a short time, and carefully absorbing the supernatant after the solution is clarified. And (3) taking the centrifuge tube off the magnetic frame, adding 1mL of Wash Buffer, gently blowing and sucking the mixture by using a pipettor, centrifuging the mixture for a short time, placing the mixture on the magnetic frame, and carefully removing the supernatant after the solution is clarified.
3.2 remove the tube from the rack, add 500. mu.l of 1 × Wash Buffer, mix gently by pipette, centrifuge briefly on the rack, remove the supernatant carefully after the solution is clarified.
3.3 remove the centrifuge tube, place on the magnetic rack after brief centrifugation, aspirate the remaining liquid with a 20. mu.l pipette. Only the single cell labeled magnetic beads at the bottom of the centrifuge tube were left.
3.4 preparation of RT Mix-1 on ice according to the following Table, mixing and brief centrifugation
Components Volume of
RT Master Mix 120μl
100mM DTT 20μl
TS primer 10μl
Reverse Transcriptase 10μl
RNase Inhibitor 5μl
ddH2O 35μl
Total 200μl
Add 200. mu.l of prepared RT Mix to the TCR Barcode Beads in step 3.3 and Mix well by pipetting. Placing in a metal bath set in advance, rotating at 42 ℃ and 1300rpm, and reacting for 90min (preheating in advance).
3.5 cDNA amplification
3.5.1 PCR Mix-2 was prepared on ice according to the following Table, mixed and centrifuged briefly
Components Volume of
Amplification Master Mix 172μl
G Primer Mix 3.2μl
Amplification Enzyme 8μl
ddH2O 216.8μl
Total 400μl
3.5.2 the reverse transcription product from the previous step was centrifuged, placed on a 1.5ml magnetic stand and the supernatant carefully removed after the solution cleared.
3.5.3 the centrifuge tube was removed from the magnetic stand, and 400. mu.l of the prepared PCR Mix was added to the tube and the tube was divided into 8 rows of tubes each containing 50. mu.l of the mixture while blowing and mixing the mixture.
3.5.4 cover the 8-row tube cover, and put it in PCR instrument for amplification. The PCR reaction program is:
Figure BDA0003582921810000151
cDNA product purification
4.1 Ampure XP purified magnetic beads were removed from 4 ℃ to room temperature 30min in advance. Fully shaking and mixing evenly before use.
4.2 PCR amplification products were collected in 1.5m centrifuge tubes and centrifuged briefly. Adding 0.6 multiplied purified magnetic beads, uniformly mixing by vortex, incubating for 5min at room temperature, centrifuging briefly, placing on a 1.5mL magnetic frame, standing for 5min until the liquid is transparent and clear, and carefully sucking the supernatant into a new 1.5mL centrifuge tube.
4.3 keep the centrifuge tube on the magnetic frame all the time, add 800. mu.l of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30s and carefully remove the supernatant.
4.4 repeat step 4.3 once.
4.5 taking down the centrifuge tube for short centrifugation, placing on the magnetic frame again, sucking off excessive alcohol, opening the cover and drying for about 2 min.
4.6 taking down the centrifuge tube, adding 100 mul Buffer EB, blowing and mixing evenly by a pipette, incubating for 5min at room temperature, centrifuging for a short time, and standing on a magnetic frame until the liquid is transparent and clear.
4.7 aspirate supernatant and transfer to a new EP tube, add 80. mu.l magnetic beads (0.8 × product volume), shake and mix well, incubate for 5min at room temperature for brief centrifugation, place on magnetic stand and stand for 5min until the liquid is clear and clear, carefully remove supernatant to a new 1.5mL centrifuge tube.
4.8 keep the PCR tube on the magnetic frame all the time, add 800. mu.l of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30s and carefully remove the supernatant.
4.9 repeat step 4.8 once.
4.10 taking down the centrifuge tube for short centrifugation, placing on the magnetic frame again, sucking off excessive alcohol, opening the cover and drying for about 2 min.
4.11 taking off the centrifuge tube, adding 20 mul Buffer EB, blowing and mixing evenly by a pipette, incubating for 5min at room temperature, centrifuging for a short time, and standing on a magnetic frame until the liquid is transparent and clear.
4.12 the supernatant was aspirated and transferred to a new EP tube as purified product.
5. First cyclization
5.1 purification of cDNA products the reaction system was prepared according to the following Table
Components Volume of
GA master mix 10μl
Purification of cDNA products 500ng
ddH2O To 20μl
Mix gently and thoroughly using a pipette, centrifuge briefly and place the reaction tube in a PCR instrument. PCR instrument hot lid 85 ℃: reacting at 50 ℃ for 1 hour; reacting at 75 ℃ for 10 min; storing at 4 ℃.
5.2 enzyme digestion
And (4) performing enzyme digestion on the cyclized product without purifying the product. The PCR tube was placed on ice to prepare an enzyme digestion system according to the following table.
Components Volume of
The product of the previous step of cyclization 20μl
Cyclicase 0.5μl
ddH2O To 25μl
Using a pipettor to mix the mixture gently and fully, placing the reaction tube in a PCR instrument after short-time centrifugation: reacting at 37 ℃ for 30 min; storing at 4 ℃.
5.3 purification of the cyclization product
5.3.1 purification of magnetic beads 30min earlier, from 4 ℃ take out, return to room temperature. The magnetic beads need to be well mixed before use.
5.3.2 the volume was calculated by snap-off of the liquid in the PCR tube. Adding magnetic beads with the volume of 1.3 times that of the product, blowing, mixing uniformly, incubating at room temperature for 5min, centrifuging for a short time, placing on a magnetic frame, standing for 5min until the liquid is transparent and clear, and carefully removing the supernatant to a new PCR tube.
5.3.3 keep the PCR tube on the magnetic frame all the time, add 200. mu.l of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30s and carefully remove the supernatant. The procedure was repeated twice.
5.3.4 taking down the PCR tube, centrifuging for a short time, putting the PCR tube on a magnetic frame again, absorbing excess alcohol, and drying in the air.
5.3.5 taking off the PCR tube, adding 20 μ l of nucleic-free Water, blowing and sucking the mixed magnetic beads, incubating at room temperature for 5min, centrifuging for a short time, and standing on a magnetic frame until the liquid is transparent and clear.
5.3.6 the supernatant was aspirated and transferred to a new EP tube as purified cyclisation product.
TCR first round enrichment
6.1 Place PCR tubes on ice to formulate enriched PCR Mix-3 according to the following Table
Figure BDA0003582921810000171
Figure BDA0003582921810000181
Components Volume of
Amplification Buffer 10μl
10mM dNTP mix 1.5ul
TCR R1 primer 1.5μl
TCR alpha/TCR beta primer 1.5μl
Amplification Enzyme 1ul
Cyclized product About 20ng
ddH2O Variable
Total 50μl
Components Volume of
Amplification Buffer 10μl
10mM dNTP mix 1.5ul
TCR R1 primer 1.5μl
TCR alpha/TCR beta primer 1.5μl
Amplification Enzyme 1ul
Cyclized product About 20ng
ddH2O Variable
Total 50μl
Wherein the TCR R1 primer sequence: GCGTCAGATGTGTATAAGAG, respectively;
TCR alpha-F-1 primer sequence: AGTCTCTCAGCTGGTACACG, respectively;
TCR beta-F-1 primer sequence: TCTGATGGCTCAAACACAGC are provided.
6.2 the prepared PCR mix is mixed gently and fully, the reaction tube is placed in a PCR instrument, and the PCR reaction procedure is as follows:
Figure BDA0003582921810000191
the enriched product was detected by agarose gel electrophoresis and the results are shown in FIG. 3. As can be seen from the electrophoresis results, the TCR alpha and TCR beta variable regions comprise a single band formed after amplification of a portion of the constant region.
6.3 first round enrichment product purification
6.3.1 purification of magnetic beads 30min before the 4 ℃ from recovery of room temperature. Shaking thoroughly and mixing well before use.
6.3.2 the liquid in the PCR tube was transiently separated and the volume calculated. Add 30. mu.l of magnetic beads (0.6 Xproduct volume), blow and mix well, incubate at room temperature for 5min, place on magnetic rack after brief centrifugation for 5min until the liquid is clear, carefully remove the supernatant into a new PCR tube.
6.3.3 keep the PCR tube on the magnetic frame all the time, add 200. mu.l of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30s and carefully remove the supernatant.
6.3.4 repeat step 3 for a total of 2 rinses.
6.3.5 remove the PCR tube and centrifuge briefly, place again on the magnetic frame, suck off the excess alcohol and dry.
6.3.6 remove the PCR tube and add 20. mu.l of Buffer EB, suck and mix the magnetic beads evenly and incubate for 5min at room temperature, centrifuge briefly, then place on the magnetic frame statically until the liquid is transparent and clear.
6.3.7 the supernatant was aspirated and transferred to a new EP tube as purified product, labeled TCR alpha-1 and TCR beta-1. The purified product carries the 5' barcode sequence and other elements, the full length of the TCR variable region and part of the TCR constant region sequence.
7. Second cyclization
7.1 PCR amplification of partial constant regions: PCR primers were designed to amplify the remaining constant region sequence TCR alpha-2 of TCR alpha-1 from the TCR-TRAC-pMax vector, and homologous sequences of TCR alpha-1 fragments, TCR alpha-2, were added to the 5' ends of the forward and reverse primers (nucleic acid sequence see Seq ID No.1, amino acid sequence see Seq ID No. 2). PCR primers were designed in the same way to amplify the remaining constant region sequence TCR beta-2 of TCR beta-1 from the TCR-TRBC-pMax vector and to add homologous sequences of TCR beta-1 fragment, constant region sequence TCR beta-2, at the 5' end of the forward and reverse primers (nucleic acid sequence see Seq ID No.3, amino acid sequence see Seq ID No. 4).
PCR amplification System:
Taq mix 2X 25μl
ddH 2 O 22μl
TCR-TRAC-pMax/TCR-TRBC-pMax 1μl
TCR alpha-2-F/TCR beta-2-F 1μl
TCR alpha-2-R/TCR beta-2-R 1μl
wherein the primer sequence is as follows:
TCR alpha-2-F：catatccagaaccctgaccc；
TCR alpha-2-R：ctgtctcttatacacatctgacgcttagctggaccacagccgcagcg；
TCR beta-2-F：gaggacctgaacaaggtgtt；
TCR beta-2-R：ctgtctcttatacacatctgacgcttagaaatcctttctcttgaccatg。
PCR amplification conditions:
Figure BDA0003582921810000201
the PCR products were detected by agarose gel electrophoresis, and the results are shown in FIG. 4. As can be seen from the electrophoresis results, a single band is formed after the amplification of TCR alpha and TCR beta constant regions, and the gene segment is successfully amplified.
7.2 PCR product purification, according to the kit provided standard operation flow (Tiangen Biochemical technology Co., Ltd., DP219-03) operation.
7.2.1 Single DNA bands were cut from the agarose gel (excess was removed as much as possible) and placed in a clean centrifuge tube and weighed.
7.2.2 Add 3 volumes of sol solution PE to the gel block (if the gel weighs 0.1g, the volume can be considered as 100. mu.l, then 300. mu.l of sol solution PE is added). And (3) sol is carried out for 5-10 min at the room temperature of 15-25 ℃, and the centrifugal tube is continuously and gently turned up and down in the process so as to ensure that the gel blocks are fully dissolved.
7.2.3 adding the solution obtained in the previous step into an adsorption column CA5 (the adsorption column is placed into a collecting pipe), standing for 2min at room temperature, centrifuging at 12000rpm for 30-60 s, pouring the waste liquid in the collecting pipe, and placing an adsorption column CA5 into the collecting pipe.
7.2.4 adding 600 μ l rinsing liquid PW into adsorption column CA5, centrifuging at 12000rpm for 30-60 s, pouring off the waste liquid in the collection tube, and placing adsorption column CA5 into the collection tube.
7.2.5 repeat operation 7.2.4.
7.2.6 the adsorption column CA5 was returned to the collection tube and centrifuged at 12000rpm for 2min to remove the rinse as much as possible. The adsorption column CA5 was left at room temperature for several minutes and thoroughly dried to prevent the residual rinse from affecting the next experiment.
7.2.7 the adsorption column CA5 is put into a clean centrifuge tube, ddH2O preheated in advance is hung and dripped in the middle of the adsorption film, and the mixture is placed for 2min at room temperature. The DNA solution was collected by centrifugation at 12000rpm for 2 min. The products after purification and recovery are TCR alpha-2 and TCR beta-2 respectively.
7.3 second cyclization
The purified product was formulated into the reaction system according to the following table:
components Volume of
10X buffer 2μl
TCR alpha-1/TCR beta-1 5μl
TCR alpha-2/TCR beta-2 5μl
Cyclases 1μl
ddH2O 7μl
The cyclization reaction was carried out at 50 ℃ for 1 hour.
7.4 purification of the cyclization product
7.4.1 taking out the DNA Clean Beads half an hour in advance, placing the DNA Clean Beads at room temperature, and fully shaking and mixing the DNA Clean Beads uniformly before use.
7.4.2 pipette DNA Clean Beads (0.5 × product volume) into the product of step 7.3, gently pipette and mix well, incubate for 10min at room temperature.
7.4.3 after the incubation is finished, the mixture is centrifuged instantaneously, the 1.5mLEP tube is placed on a magnetic frame, the mixture is kept still for 5min until the liquid is clear, and the supernatant is carefully sucked up by a pipette and discarded.
7.4.4 keep 1.5ml of EP tube on magnetic stand, add 500. mu.l of freshly prepared 80% ethanol to rinse the magnetic beads and tube walls, carefully aspirate and discard the supernatant. This step was repeated once.
7.4.5 holding the 1.5ml EP tube fixed on the magnetic frame, the 1.5ml EP tube cap was opened and dried at room temperature.
7.4.6 remove 1.5ml of EP tube from the magnetic frame, add 22. mu.l of TE Buffer for DNA elution, gently blow to mix well with a pipette, and stand at room temperature for 10 min.
7.4.7 transient centrifugation, 1.5ml of the EP tube was placed on a magnetic rack, left for 5min until the liquid was clear, and 20. mu.l of the supernatant was transferred to a new 1.5ml EP tube.
TCR second round enrichment
8.1 PCR amplification of TCR alpha and TCR beta cyclization products respectively for enrichment of TCR.
PCR amplification System:
Taq mix 2X 25μl
ddH 2 O 22μl
TCR alpha/TCR beta cyclization product 1μl
TCR-F 1μl
TCR-R 1μl
Wherein the primer sequence is
TCR-F：ttgcctttctctccacaggggtacctggtatcaacgcagagtacttggg；
TCR-R：cattctagttgtggtttgtccaaacctgcttggaacggtacatacttgct。
The PCR reaction program is:
Figure BDA0003582921810000231
the second round of enriched product was detected by agarose gel electrophoresis as FIG. 5. From the electrophoresis results, it can be seen that the full-length TCR alpha and TCR beta fragments are successfully amplified after the second cyclization.
8.2 second round enrichment product purification
8.2.1 purification of magnetic beads 30min earlier from 4 ℃ and recovery to room temperature, before use, fully shaking and mixing.
8.2.2 transient volume calculation of the liquid in the PCR tube. Add 30. mu.l of magnetic beads (0.5 Xproduct volume), blow and mix well, incubate at room temperature for 5min, place on magnetic rack after brief centrifugation for 5min until the liquid is clear, carefully remove the supernatant into a new PCR tube.
8.2.3 the PCR tube was kept on the magnetic stand and 200. mu.l of freshly prepared 80% ethanol was added to rinse the beads. Incubate at room temperature for 30s and carefully remove the supernatant.
8.2.4 repeat step 3 for a total of 2 rinses.
8.2.5 remove the PCR tube and centrifuge briefly, place again on the magnetic frame, suck off excess alcohol, dry in the air.
8.2.6 the PCR tube is removed, 20 μ l Buffer EB is added, the magnetic beads are mixed by blowing and sucking, the incubation is carried out for 5min at room temperature, the mixture is centrifuged for a short time and then placed on a magnetic frame statically until the liquid is transparent and clear.
8.2.7 the supernatant was aspirated and transferred to a new EP tube as purified product.
9. Ligation of TCR expression vectors
The vector carries the CMV promoter and the polyA site, and the specific map is shown in FIG. 6. The purified TCR-alpha and TCR-beta are cloned to TCR-pMax carrier in full length by recombination method, and have complete TCR expression frame, which can express TCR subunit efficiently. The method comprises the following specific steps:
9.1 preparation of linearized TCR-pMax vectors: the TCR-pMax was linearized and purified using XhoI (NEB: R0146S) and KpnI (NEB: R3142S).
9.2 recombination reaction:
Figure BDA0003582921810000241
the reaction was carried out at 50 ℃ for 20min.
10. Transformation of Escherichia coli
2.1 thawing of competent cells DH5 alpha (Shanghai Weidi Biotech Co., Ltd.) on ice, the typical transformation product volume cannot exceed the competent volume 1/10.
2.2 Add 10. mu.l of recombinant product to 100. mu.l of competent cells, mix gently and let stand on ice for 20min.
Heat shocking at 2.342 deg.C for 90s, standing on ice for 2min, adding 700 μ l of LB medium without double antibody (Shanghai Biotech), recovering at 37 deg.C with shaking table at 220rpm for 40min, and centrifuging at 5000rpm for 3 min. Aspirate 700. mu.l of the supernatant, mix the remaining liquid pipette well and then spread all over the Amp-containing plate, incubate overnight at 37 ℃.
Example 3
Comparing the TCR library sequences to obtain a paired TCR sequence
1. 192 single colonies were picked from the plates transformed with TCR-alpha and TCR-beta gene fragments the next day and shaken in 200. mu.l of Amp resistant LB medium for 2h at 37 ℃ and 2. mu.l of bacterial solution was taken for PCR primary identification of positive clones.
PCR sample system: 20 μ l
2X Taq mix 10μl
ddH2O 7μl
Bacterial liquid 2μl
TCR-F-JJ 0.5μl
TCR-R-JJ 0.5μl
Wherein the sequence of the TCR-F-JJ primer is as follows: taggcacctattggtcttac, respectively;
the TCR-R-JJ primer sequence is as follows: tcactgcattctagttgtgg are provided.
PCR bacteria detection conditions:
Figure BDA0003582921810000251
the results of the bacterial tests were checked by agarose gel electrophoresis as shown in FIG. 7. The positive clone is the strip with the length of the inserted sequence about 1000bp, and the identified positive clone is sent to the corresponding bacterium liquid sanger sequencing verification. Wherein the sequencing primer is as follows:
TCR-seq-F：acctattggtcttactga；
TCR-seq-R:cattctagttgtggtttgtc。
2. sequence alignment and TCR pairing
TCR alpha and TCR beta complete sequences obtained by sanger sequencing and single cell barcode, TCR alpha and TCR beta full-length sequences obtained by analyzing the complete sequences through DNA sequence analysis software, and TCR alpha and TCR beta clones with the same barcode sequences are judged to be a pair of TCRs, namely paired TCRs. In this way, 86 pairs of paired TCRs were found out in the selected clones. I.e., to obtain the full-length sequence of the paired TCR.
Table 1 shows the variable region nucleotide sequences of 24 pairs of paired TCR sequences.
TABLE 124 nucleotide sequences of the variable regions for paired TCR sequences
Figure BDA0003582921810000271
Figure BDA0003582921810000281
Figure BDA0003582921810000291
Figure BDA0003582921810000301
Figure BDA0003582921810000311
Figure BDA0003582921810000321
Figure BDA0003582921810000331
Figure BDA0003582921810000341
Figure BDA0003582921810000351
Figure BDA0003582921810000361
Figure BDA0003582921810000371
Example 4
High throughput TCR expression assay
1. Effector cell construction and testing
Jurkat cells (cell bank of Chinese academy of sciences) were infected with a lentivirus harboring NFAT-luciferase, and single clones were picked and cultured to obtain Jurkat-NFAT-luciferase reporter cell lines (TCR recention in Jurkat reporter cells characteristics of the identification of novel promoter by cDNA expression. int J cancer.2002May 1; 99(1): 7-13). CRISPR/Cas9 electrotransfer was used to knock out the TCR gene simultaneously, and non-knocked out cells were selected as negative controls. The method comprises the following specific steps:
1.1 taking a certain amount of Jurkat-NFAT-luciferase cells, centrifuging for 5min at 1200rpm, and washing for 2 times by using a culture medium opti-MEM for later use. Each 1 × 10 6 The cells were resuspended in 25. mu.l of opti-MEM and then kept ready for use.
1.2 preparation of Cas9 and sgRNA on ice: mu.l Cas9(500 ng/. mu.l) protein (Nanjing Kinserin), 2.5. mu.l TRAC-sgRNA and 2.5. mu.l TRBC-sgRNA (400 ng/. mu.l Nanjing Kinserin) were added to each 1X 106 cells, and the cells were incubated at room temperature for 10min, and electroporation was started by adding cells prepared in advance.
1.3 electrotransfer conditions: 1mm electric cup of BTX-ECM830, voltage 250V, pulse time 1 ms.
1.4 after the electrotransfer is finished, 1ml of culture medium is quickly added into the electric shock cup, and then the cells are transferred into the culture hole for culture.
1.5 electroporation and knock-out for 48h, a certain volume of cells was taken, stained with anti-CD3-APC antibody (BD Pharmingen, 555335), and incubated at 4 ℃ for half an hour. After staining was complete, cells were washed with PBS and resuspended, and TCR knockdown was detected using flow cytometry. The results of TCR knockdown in Jurkat cells are shown in fig. 8, and it can be seen from the flow results that the TCR in Jurkat cells has been completely knocked down. The effector cells prepared by this procedure were named: Jurkat-KO-ER.
2. Paired TCR plasmid electrotransfer into effector cells
According to the optimal conditions of electrotransfer, 10 pairs of paired TCRs with complete sequences in 24 pairs of paired TCR plasmids are selected, named as TCRab-1-10 respectively, and electrotransfer is carried out to Jurkat-KO-ER. The electricity conversion process comprises the following steps:
2.1 Jurkat-KO-ER cells were centrifuged at 1200rpm for 5min and washed 2 times with the culture medium opti-MEM for use.
2.2 Add 4ug of paired TCR plasmid (2 ug each of TCRalpha and TCRbeta plasmid) per 1X 106 Jurkat-KO-ER cells and make up to 100. mu.l of medium opti-MEM.
2.3 plasmid and cell mixture 100. mu.l was added to a 96-well electroporation plate (BTX, 45-0450) at a voltage of 260V and a pulse time of 1 ms. After electroporation, the cells were transferred to a new 96-well plate and the cells were cultured.
3. Screening for functional TCRs
3.1 flow assay of TCR expression in cells: after the paired TCR plasmid was electrotransferred into Jurkat-KO-ER cells for 24h, a volume of cells was taken, stained with anti-CD3-APC antibody (BD Pharmingen, 555335), and incubated at 4 ℃ for half an hour. After staining was complete, cells were washed with PBS and resuspended, and TCR cell expression was examined using flow cytometry. Representative results of the expression of the electroporated TCR in Jurkat-KO-ER cells are shown in FIG. 9. As can be seen, CD3 expression was restored after 10 representative paired TCR charges were transferred into the cells.
Example 5
Cloning of paired TCR into transposon vector
The TCR alpha and TCR beta full-length sequences were cloned into transposon vectors using conventional molecular cloning methods.
Example 6
Personalized TCR-T cell therapy
Individualized TCR-T cells are prepared by electrotransport delivery of transposons carrying active TCR sequences into T cells of a patient. These cells can be used for the treatment of patients with tumors.
The preferred embodiments of the present invention have been described in detail, however, the present invention is not limited to the specific details of the above embodiments, and various changes may be made to the technical solution of the present invention within the technical idea of the present invention, and these simple modifications are included in the protective scope of the present invention.
It should be noted that, in the foregoing embodiments, various specific technical features and steps described in the above embodiments can be combined in any suitable manner, and in order to avoid unnecessary repetition, various possible combinations of the features and steps are not described separately.
In addition, any combination of the various embodiments of the present invention is also possible, and the same should be considered as the disclosure of the present invention as long as it does not depart from the spirit of the present invention.

Claims (17)

1. A method of cloning paired TCR sequences, the method comprising the steps of: sorting and capturing single tumor reactive T cells from tumor tissues, extracting, marking mRNA of the single cells by Barcode, carrying out reverse transcription and constructing full-length cDNA, carrying out cDNA specificity PCR amplification to obtain a cDNA full-length transcription group, carrying out first cyclization after enrichment, carrying out TCR sequence specificity amplification, carrying out second cyclization after enrichment and enrichment again, connecting the enrichment product to an expression vector to obtain TCR full-length clone, and carrying out Barcode sequence comparison in a library to obtain paired TCR sequences.
2. A method of clonally pairing TCR sequences according to claim 1, wherein: in the method, TSO is added into a reverse transcription system during reverse transcription of mRNA, and amplification is carried out to complete enrichment of a cDNA full-length transcription group.
3. A method of clonally pairing TCR sequences according to claim 2, wherein: in the method, the enrichment of a full-length transcription group is completed by amplifying a constant region sequence at the 5' end of a single-cell labeled magnetic bead and a TSO sequence added in the reverse transcription process.
4. A method of clonally pairing TCR sequences according to claim 1, wherein: in the method, the first cyclization is that the obtained amplification product is subjected to cyclization treatment, and a constant sequence on a single cell labeled magnetic bead and a TCR specific primer (constant region end) are used for carrying out TCR sequence specific amplification to complete TCR enrichment.
5. A method of clonally pairing TCR sequences according to claim 1, wherein: in the method, the second cyclization is carried out, after the obtained amplification product is subjected to second cyclization treatment, a forward primer and a reverse primer designed according to a constant sequence of the single cell marked magnetic bead are used for enriching TCR, and the enriched cell barcode is connected with a TCR constant region and is positioned at the 3' end of the enriched product.
6. A method of cloning paired TCR sequences according to claim 1 which comprises: the paired TCR sequences comprise TCR-alpha and TCR-beta sequences.
7. A method of rapidly cloning paired TCR sequences according to claim 1 which is characterised in that the sorting of individual tumour reactive T cells is by: the tumor tissue is digested into single cells, and the single cells are prepared into single cell suspension and then injected into a microfluidic chip to obtain single tumor reactive T cells.
8. A TCR-T cell which: the TCR-T cell is obtained by injecting the paired TCR sequence obtained in any one of claims 1-7 into a corresponding T cell by a bioengineering technique.
9. A TCR-T cell according to claim 8, wherein: the corresponding T cell is the self T cell or the heterogenous T cell of the individual.
10. A pharmaceutical composition characterized by: the pharmaceutical composition comprising a TCR-T cell according to claim 8 or 9.
11. The pharmaceutical composition of claim 10 for use in the treatment of T cell-related diseases including infectious diseases, tumors, autoimmune diseases and organ transplants.
12. A diagnostic and/or assessment agent comprising TCR-T cells as claimed in claim 8 or 9.
13. The diagnostic and/or assessment preparation according to claim 12, characterized in that: the preparation is prepared into a preparation box.
14. Use of a diagnostic and/or assessment preparation according to claim 12 or 13 for the preparation of a kit for the diagnosis or assessment of a T cell related disease or event;
the disease or event includes infectious diseases, tumors, autoimmune diseases and organ transplantation.
15. Use of the pharmaceutical composition of claim 10 or 11 for the manufacture of a medicament for the treatment of T cell-related diseases, including cancer, infectious diseases and autoimmune diseases.
16. Use of a pharmaceutical composition according to claim 15, characterized in that: the cancer is selected from the group consisting of acute lymphocytic leukemia, acute myelogenous leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal carcinoma, appendiceal carcinoma, astrocytoma, neuroblastoma, basal cell carcinoma, cholangiocarcinoma, bladder carcinoma, bone carcinoma, brain tumor, breast carcinoma, bronchial adenoma, Burkitt's lymphoma, primary unknown carcinoma, central nervous system lymphoma, cerebellar astrocytoma, cervical carcinoma, childhood cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disease, colon carcinoma, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial carcinoma, ependymoma, esophageal carcinoma, Ewing's sarcoma, germ cell tumor, gallbladder carcinoma, gastric carcinoma, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, glioma, hairy cell leukemia, head and neck cancer, cervical carcinoma, central nervous system lymphoma, small cell tumor, ependymoma, esophageal carcinoma, Ewing's sarcoma, germ cell tumor, gallbladder carcinoma, gastric carcinoma, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, glioma, hairy cell leukemia, head and neck cancer, cervical carcinoma, and bladder carcinoma, and cervical carcinoma, and colorectal carcinoma, and bladder carcinoma, and carcinoma of the like, Cardiac cancer, hepatocellular carcinoma, hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, kaposi's sarcoma, kidney cancer, laryngeal cancer, lip and oral cancer, liposarcoma, liver cancer, lung cancer, lymphoma, leukemia, macroglobulinemia, malignant fibrous histiocytoma/osteosarcoma of bone, medulloblastoma, melanoma, mesothelioma, metastatic squamous neck cancer with hidden primary foci, oral cancer, multiple endocrine tumor syndrome, myelodysplastic syndrome, myeloid leukemia, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-hodgkin's lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma/malignant fibrous histiocytoma of bone, ovarian cancer, epithelial ovarian cancer, ovarian germ cell tumor, pancreatic cancer, pancreatic islet cells, paranasal sinus and nasal cavity cancer, Parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumor, pituitary adenoma, pleural pneumocoblastoma, plasmacytoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, transitional cell carcinoma of renal pelvis and ureter, retinoblastoma, rhabdomyosarcoma, salivary gland carcinoma, sarcoma, skin cancer, merkel cell skin cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, gastric cancer, T-cell lymphoma, throat cancer, thymoma, thymus, thyroid cancer, trophoblastic tumor, unknown carcinoma of primary site, urinary tract cancer, uterine sarcoma, vaginal cancer, vulval cancer, waldenstrom's macroglobulinemia, and wilms' tumor, said autoimmune disease being selected from the group consisting of arthritis, chronic obstructive pulmonary disease, ankylosing spondylitis, Crohn's disease, dermatomyositis, type I diabetes, endometriosis, Goodpasture's syndrome, Graves 'disease, guillain-barre syndrome, hashimoto's disease, hidradenitis suppurativa, kawasaki disease, IgA nephropathy, idiopathic thrombocytopenic purpura, interstitial cystitis, lupus erythematosus, mixed connective tissue disease, scleroderma, myasthenia gravis, narcolepsy, neuromuscular stiffness, pemphigus vulgaris, pernicious anemia, psoriasis, psoriatic arthritis, polymyositis, primary biliary cirrhosis, recurrent polychondritis, rheumatoid arthritis, schizophrenia, scleroderma, sjogren's syndrome, stiff person syndrome, temporal arteritis, ulcerative colitis, vasculitis, vitiligo and wegener's granulomatosis.
17. Use of the formulation according to claim 14, further for biomarkers, antibody development, drug and vaccine evaluation, immune cell differentiation tracing, immune rejection and tolerance, minimal residual disease detection, food or other allergen detection.
CN202210355999.6A 2022-03-31 2022-04-06 Detection method for cloned TCR sequence and application thereof Withdrawn CN114891779A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202210332403 2022-03-31
CN2022103324030 2022-03-31

Publications (1)

Publication Number Publication Date
CN114891779A true CN114891779A (en) 2022-08-12

Family

ID=82715542

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210355999.6A Withdrawn CN114891779A (en) 2022-03-31 2022-04-06 Detection method for cloned TCR sequence and application thereof

Country Status (2)

Country Link
CN (1) CN114891779A (en)
WO (1) WO2023184616A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023179795A1 (en) * 2022-03-25 2023-09-28 立凌生物制药(苏州)有限公司 Method for rapidly, simply and conveniently obtaining correctly paired tcrs, and obtained tcrs

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110114520A (en) * 2016-10-01 2019-08-09 伯克利之光生命科技公司 DNA bar code composition and in microfluidic devices knowledge method for distinguishing in situ
CN112840031A (en) * 2018-08-13 2021-05-25 根路径基因组学公司 High throughput cloning of paired bipartite immunoreceptor polynucleotides and uses thereof
WO2021165546A1 (en) * 2020-02-20 2021-08-26 Institut Curie Method for identifying functional disease-specific regulatory t cells
WO2021188384A1 (en) * 2020-03-14 2021-09-23 Berkeley Lights, Inc. Methods of amplifying paired transcript sequences from single cells
WO2021208035A1 (en) * 2020-04-16 2021-10-21 Singleron (Nanjing) Biotechnologies, Ltd. Methods and reagents for high-throughput detection of nucleic acid sequence of single t cell surface receptor
CN113528617A (en) * 2021-07-28 2021-10-22 新格元(南京)生物科技有限公司 High-throughput single immune cell surface receptor nucleic acid sequence detection method

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190183935A1 (en) * 2016-08-01 2019-06-20 Health Research, Inc. Compositions and methods for rapid cloning of t-cell receptors
WO2019084046A1 (en) * 2017-10-23 2019-05-02 The Broad Institute, Inc. Single cell cellular component enrichment from barcoded sequencing libraries
JP2022544101A (en) * 2019-08-08 2022-10-17 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル RNA-sequencing methods for the analysis of B and T cell transcriptomes in phenotypically defined B and T cell subsets
CN112852936A (en) * 2020-06-24 2021-05-28 广州华银健康医疗集团股份有限公司 Method for analyzing sample lymphocyte or plasma cell by using immune repertoire sequencing method, application and kit thereof
WO2022018055A1 (en) * 2020-07-20 2022-01-27 Westfälische Wilhelms-Universität Münster Circulation method to sequence immune repertoires of individual cells

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110114520A (en) * 2016-10-01 2019-08-09 伯克利之光生命科技公司 DNA bar code composition and in microfluidic devices knowledge method for distinguishing in situ
CN112840031A (en) * 2018-08-13 2021-05-25 根路径基因组学公司 High throughput cloning of paired bipartite immunoreceptor polynucleotides and uses thereof
WO2021165546A1 (en) * 2020-02-20 2021-08-26 Institut Curie Method for identifying functional disease-specific regulatory t cells
WO2021188384A1 (en) * 2020-03-14 2021-09-23 Berkeley Lights, Inc. Methods of amplifying paired transcript sequences from single cells
WO2021208035A1 (en) * 2020-04-16 2021-10-21 Singleron (Nanjing) Biotechnologies, Ltd. Methods and reagents for high-throughput detection of nucleic acid sequence of single t cell surface receptor
CN113528617A (en) * 2021-07-28 2021-10-22 新格元(南京)生物科技有限公司 High-throughput single immune cell surface receptor nucleic acid sequence detection method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ARNOLD HAN ET AL: "Linking T-cell receptor sequence to functional phenotype at the single-cell level", 《NAT BIOTECHNOL》, vol. 32, no. 7, pages 684 - 692, XP055309747, DOI: 10.1038/nbt.2938 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023179795A1 (en) * 2022-03-25 2023-09-28 立凌生物制药(苏州)有限公司 Method for rapidly, simply and conveniently obtaining correctly paired tcrs, and obtained tcrs

Also Published As

Publication number Publication date
WO2023184616A1 (en) 2023-10-05

Similar Documents

Publication Publication Date Title
CN106279434B (en) Engineered CD20 targeted NKT cell and preparation method and application thereof
CN109750035B (en) sgRNA for targeting and guiding Cas9 protein to efficiently cleave TCR and B2M gene locus
CN105950664B (en) A kind of replication defective recombinant slow virus CAR-T transgene carrier targeting CD123 and its construction method and application
TW201130978A (en) Method of isolation of stem cell populations from peripheral blood using sized-based separation (elutriation)
CN111718409B (en) T cell receptor and application thereof
CN114317607A (en) Double-target universal CAR-T cell fusing primary targeting CD7CAR and secondary targeting BCMA and preparation method thereof
CN111647071A (en) T cell receptor recognizing target cell surface antigen and composition thereof
CN114891779A (en) Detection method for cloned TCR sequence and application thereof
CN104892770B (en) It is a kind of that there is efficient infection to T cell and candidate stem cell and promote the slow virus carrier of multiplication capacity
CN115029341A (en) Rapid clone pairing TCR sequence detection method and application thereof
TWI789638B (en) T Cell Receptor of Epitope Peptide and Its Application
WO2020164166A1 (en) General-purpose car-t cell, and preparation method therefor and use thereof
CN102002493B (en) Application of small RNA-326 in preparation of medicament
WO2023179795A1 (en) Method for rapidly, simply and conveniently obtaining correctly paired tcrs, and obtained tcrs
JP2020533981A (en) Mesenchymal stem cells overexpressing CXCR5, their production methods and uses
CN109722435B (en) Islet long-chain non-coding RNA1810019D21Rik and application thereof
CN113122504A (en) Method for purifying UCART cells and application
CN111378621B (en) B lymphoma cell strain stably transfected by EB virus latent membrane protein 1, construction method and application thereof
WO2020164167A1 (en) Recombinant adeno-associated viral vector for use in preparation of general-purpose car-t, and construction method therefor and use thereof
CN114729320A (en) Compositions, methods and uses thereof for reprogramming cells to dendritic cell type 2 capable of presenting antigen
CN111574616B (en) Isolated T cell receptors and uses
CN111647069B (en) Improved TCR and application thereof
CN116836971A (en) Method for quickly and simply obtaining correct pairing TCR and obtained TCR
WO2020133050A1 (en) Ebv epitope high affinity t cell receptor
CN117024605B (en) Chimeric antigen receptor, microglia expressing chimeric antigen receptor and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WW01 Invention patent application withdrawn after publication

Application publication date: 20220812

WW01 Invention patent application withdrawn after publication