WO2023184616A1 - Method for detecting cloned tcr sequence and use thereof - Google Patents

Abstract

A method for quickly cloning and pairing a TCR sequence and use thereof. The method for quickly cloning and pairing the TCR sequence is characterized by comprising the following steps: sorting and capturing a single tumor-reactive T cell in a tumor tissue; extracting and labeling mRNA of the single cell, carrying out reverse transcription, and constructing full-length cDNA; carrying out specific PCR amplification on the cDNA to give a cDNA full-length transcriptome; carrying out a first cyclization after enrichment for specific amplification of the TCR sequence; carrying out a second cyclization after the enrichment and carrying out enrichment again; connecting an enrichment product to an expression vector to give a full-length clone of TCR; and carrying out library sequence alignment to give a paired TCR sequence. Paired TCR cloning of hundreds of cells is realized in one reverse transcription system, so that rapid, low-cost, and high-throughput paired TCR acquisition is realized.

Description

A detection method for cloned TCR sequences and its application Technical field

The invention relates to the field of medical technology, and in particular to a detection method for cloning TCR sequences and its application.

Background technique

T cell receptor (TCR) is a characteristic marker on the surface of all T cells. It specifically recognizes the antigen peptide-MHC complex on antigen-presenting cells, thereby triggering a T cell immune response. Since TCR molecules determine the antigen recognition specificity of T cells, if tumor antigen-specific TCRs are transferred into ordinary T cells, the tumor antigen recognition ability of the T cells can be enhanced. After activation and proliferation in vitro, they can be injected into the patient's body. exert anti-tumor effect. Therefore, the method of introducing TCR genes can be used to easily obtain a large number of T cells that recognize specific antigens. T cells modified by TCR genes are called TCR-T. In recent years, TCR-T has become a research hotspot in tumor immunotherapy and is used clinically. Experiments have shown good therapeutic effects. TCR-T cell therapy (T Cell Receptor-Gene Engineered T Cells), by screening and identifying TCR sequences that can specifically bind to target antigens, and using genetic engineering methods to transfer them into T cells derived from the patient's peripheral blood (or Allogeneic T cells), and then the modified T cells are infused back into the patient's body so that they can specifically recognize and kill tumor cells expressing antigens, thereby achieving the purpose of treating tumors.

TCR is a heterodimer composed of two peptide chains, α and β. Each peptide chain is divided into variable region (V region), constant region (C region), transmembrane region and cytoplasmic region; Its cytoplasmic region is very short, and signal transmission is mainly carried out through CD3 molecules that are non-covalently bound to it. TCR molecules belong to the immunoglobulin superfamily, and their antigen specificity exists in the V region; each V region has three hypervariable regions, CDR1, CDR2, and CDR3. Among them, CDR3 has the largest variation, which directly determines the antigen-binding specificity of the TCR. When the TCR recognizes the MHC-antigen peptide complex, CDR3 directly binds to the antigen peptide.

TCR screening technology is the core part of TCR-related drug development. However, current TCR screening is costly, time-consuming, and low-efficiency. In particular, the acquisition of paired TCR full-length genes is the rate-limiting step in the entire process, which seriously affects the research and development of TCR-related drugs.

Currently, the main methods for cloning TCR genes are as follows:

1. Perform single-cell sorting on the T cell population, then lyse and reverse-transcribe the single cells, and finally use multiple degenerate primers targeting the TCR variable region and primers targeting the TCR constant region to perform single-cell level PCR to amplify Increase the TCR variable region. This is a quick and low-cost method to obtain the TCR variable region. However, because the degenerate primer used in this method is inside the TCR variable region, the amplified region is only a partial region, not the full length of the TCR, and cannot be directly applied. Downstream molecular construction and protein expression. Generally, it is necessary to perform database sequence comparison, obtain the full-length sequence from the database and perform gene synthesis to obtain the full-length TCR sequence (Rapid Identification and Evaluation of Neoantigen-reactive T-Cell Receptors From Single Cells.J Immunother.2021 Jan; 44 (1):1-8.).

2. Perform single cell sorting on the T cell population, and then use an activator to activate and amplify a single T cell. It usually takes about two weeks to expand a single T cell into a T cell clone population, with the number of cells reaching several hundred. One or thousands. Then the 5'RACE (rapid amplification of cDNA ends) method is used to amplify the full length of the TCR variable region. After amplification, the full-length TCR gene can be obtained, and the full-length TCR gene can be obtained by subsequent direct amplification. However, this method is time-consuming, many single cells cannot successfully form multi-cell clones, the cost of the kit is very high, and it is impossible to amplify the TCR gene (Development of a CD8 co-receptor independent T-cell receptor specific for tumor-associated antigen) in large quantities. MAGE-A4 for next generation T-cell-based immunotherapy. J Immunother Cancer. 2021; 9(3)).

3. The third method is to perform single cell sorting on the T cell population, and then directly perform 5'RACE to amplify the full length of the TCR variable region at the single cell level, and then perform PCR amplification to obtain the full length of the TCR gene. Although this method is relatively simple, it also requires a separate reaction system for each cell, consumes a lot of reagents, and the cost of the kit is very high, and it cannot amplify TCR genes in large quantities (An immunodominant NP105-113-B*07:02 cytotoxic T cell response controls viral replication and is associated with less severe COVID-19 disease. Nat Immunol. 2022;01;23(1):50–61.).

4. The fourth method is to use single-cell DNA barcode to label each T cell in the T cell population, and then use high-throughput sequencing to obtain paired TCR full-length sequence information. The paired TCRs determined by screening were gene synthesized to obtain full-length TCR genes. Although this method can obtain paired TCR sequences in large quantities at low cost, it can only obtain sequence information and cannot directly obtain the full-length gene fragment of the TCR variable region. The cost of subsequent gene synthesis is high and it is impossible to synthesize TCRs in large quantities (Direct identification of neoantigenspecific TCRs from tumor specimens by high-throughput single-cell sequencing. Journal for ImmunoTherapy of Cancer 2021;9:e002595.).

It can be seen that the current methods for obtaining TCR full-length sequences have some shortcomings.

Tumor-reactive T cells within tumors function through T cell receptors, but they are generally in an exhausted state and are difficult to use directly. How to quickly and cheaply clone the TCR sequences of these tumor-reactive T cells and then transduce them into primary T cells to prepare T cells in better condition is a technology expected to break through in the current field of tumor treatment.

Contents of the invention

The purpose of the present invention is to provide a fast and low-cost method for detecting the full-length sequence of cloned paired TCR and its application in the field of treatment, especially in the field of personalized treatment.

In order to achieve the above objects, the present invention adopts the following technical solutions:

In a first aspect, the present invention provides a method for cloning paired TCR sequences. The method includes the following steps: sorting and capturing single tumor-reactive T cells in tumor tissues, extracting and labeling the mRNA of single cells, reverse transcribing and Construct full-length cDNA, cDNA-specific PCR amplification to obtain the full-length cDNA transcriptome, first circularization after enrichment, specific amplification of TCR sequence, second circularization after enrichment, and enrichment again. The products are ligated into an expression vector to obtain a full-length clone of the TCR, and the library sequence is compared to obtain the paired TCR sequence.

In a specific embodiment, in the pairing method, TSO is added to the reverse transcription system during mRNA reverse transcription, and amplification completes the enrichment of the cDNA full-length transcriptome.

In a specific embodiment, in the method, the enrichment of the full-length transcriptome is completed by amplifying the constant region sequence at the 5' end of the single-cell labeled magnetic beads and the TSO sequence added during the reverse transcription process.

In a specific embodiment, the first circularization in the method is to circularize the obtained amplification product, using the constant sequence on the single-cell labeling magnetic beads and the TCR-specific primer (end of the constant region) ) performs specific amplification of TCR sequences and completes TCR enrichment.

In a specific embodiment, the second circularization in the method is: after the obtained amplification product is subjected to a second circularization process, forward and reverse primers designed according to the constant sequence of single-cell labeling magnetic beads are used Enrich TCR. After enrichment, the cell barcode will be connected to the TCR constant region and located at the 3' end of the enriched product.

In a specific embodiment, the paired TCR sequences include TCR-alpha and TCR-beta series.

In a specific embodiment, the method for sorting single tumor-reactive T cells is as follows: tumor tissue is digested into single cells and prepared into a single cell suspension, and then injected into a microfluidic chip to obtain single tumor-reactive T cells.

In a specific embodiment, the method for extracting and labeling the mRNA of a single cell is: after the single tumor-reactive T cell is separated, single-cell labeling magnetic beads are added to the microwell to complete the capture and labeling of the mRNA of the single cell. .

In a specific embodiment, the surface of the single-cell labeling magnetic beads has single-stranded DNA oligo carrying two constant sequences, a specific barcode sequence and poly dT.

In a specific embodiment, the single cell labeling magnetic beads carry different barcodes for labeling individual T cells, and poly dT is used to capture total mRNA and serve as a reverse transcription primer.

In a specific embodiment, the library sequence comparison is: after cloning the full length of TCR-alpha and TCR-beta respectively, single clones are selected for cell barcode comparison, and TCR-alpha and TCR-beta with the same cell barcode are The TCR-beta sequence is a paired TCR.

In a specific embodiment, a method for sorting single tumor-reactive T cells is to stain and label the single cell suspension with an antibody with a fluorescent label and then perform sorting using a flow cytometry sorter.

In a specific embodiment, the method for sorting single tumor-reactive T cells is: digest the tumor tissue into single cells, use the antibody CXCL13-APC with a fluorescent label to stain and label the single cell suspension, and pass the single cells through The CXCL13-positive T cells in the tumor single cell suspension are sorted by a flow sorter and are tumor-reactive T cells.

Further, in a specific embodiment, the paired TCR sequence of the present invention is obtained by the following method:

S01. Inject a certain number of tissue cells into a customized microfluidic chip. There are micropores on the surface of the chip that can accommodate single cells. The separation of single cells is completed based on the principle of "Poisson distribution".

S02. Add single-cell labeling magnetic beads to the microwell, and use single-cell labeling magnetic beads to capture and label the mRNA of a single cell. The surface of single-cell labeling magnetic beads carries two constant sequences, a specific barcode sequence and poly dT single-stranded DNA oligo. Each magnetic bead carries a different barcode for labeling individual T cells, and polydT is used to capture total mRNA and serve as a reverse transcription primer.

S03. After labeling a single T cell, start reverse transcription of the mRNA and obtain cDNA.

S04. Add TSO (Template switch oligo) to the reverse transcription system as the primer binding region for subsequent PCR. By amplifying the constant region sequence at the 5' end of the single-cell labeling magnetic beads and the TSO sequence added during the reverse transcription process, the full-length transcriptome is enriched.

S05. Circularize the obtained amplification product, and use the constant sequence on the single-cell labeled magnetic beads and the TCR-specific primer (end of the constant region) to perform specific amplification of the TCR sequence to complete the enrichment of TCR.

S06. After the obtained amplification product is circularized for the second time, TCR is enriched using forward and reverse primers designed based on the constant sequence of single-cell labeled magnetic beads. After enrichment, the cell barcode will be connected to the TCR constant region. Located at the 3' end of the enriched product. Finally, the enriched product of TCR was ligated into the expression vector to complete the full-length cloning of TCR.

S07. After following the above steps to clone the full length of TCR-alpha and TCR-beta respectively, select single clones for cell barcode comparison. TCR-alpha and TCR-beta sequences with the same cell barcode are paired TCRs.

In a second aspect, the present invention provides a TCR-T cell.

The invention provides a TCR-T cell, which is obtained by injecting the paired TCR sequence obtained by the method of the invention into the corresponding T cell through bioengineering technology.

Further, the corresponding T cells refer to the individual's own T cells or allogeneic T cells.

Further, the allogeneic T cells are T cells of different individuals of the same species and/or T cells of different species.

Furthermore, the allogeneic T cells may be T cells from different human individuals or T cells from other animal bodies.

In a third aspect, the present invention provides a pharmaceutical composition.

A pharmaceutical composition containing the TCR-T cells obtained in the second aspect of the present invention.

Further, the pharmaceutical composition contains a pharmaceutically acceptable carrier.

Further, the pharmaceutical composition contains a pharmaceutically acceptable carrier.

Further, the carrier includes any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, etc. that are compatible with pharmaceutical administration. Preferred examples of carriers or diluents involved in the dispersion medium include (but are not limited to) water, saline, Ringer's solution, dextrose solution and human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of these media and agents for pharmaceutically active substances is well known in the art. Unless any conventional media or agent is incompatible with the active compound, its use is contemplated in the compositions. Supplementary active compounds can also be incorporated into the compositions.

Further, the pharmaceutical composition is prepared into corresponding pharmaceutical preparations, which include but are not limited to intravenous, intradermal, subcutaneous, oral, transdermal, transmucosal and rectal administration and injection.

In another specific embodiment, the pharmaceutical composition contains a second active agent different from TCR-T cells, and the second active agent includes drugs with anti-tumor effects, drugs that improve the patient's resistance, and/ Or drugs that increase patient tolerance, etc.

The pharmaceutical composition provided by the third aspect of the present invention is used to treat T cell-related diseases, including infectious diseases, tumors, autoimmune diseases, and organ transplantation.

In a fourth aspect, the invention provides a diagnostic and/or assessment preparation.

A diagnostic and/or evaluation preparation containing the TCR-T cells obtained in the second aspect of the present invention.

Further, the preparation includes auxiliary materials, and the auxiliary materials include carriers or diluents;

The carrier or diluent is: any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents that are compatible with TCR-T cells.

Further, the preparation is prepared into a preparation box.

In another specific embodiment, the diagnostic and/or evaluation preparation is used to diagnose or evaluate a disease or event associated with T cells;

The diseases or events include infectious diseases, tumors, autoimmune diseases, organ transplantation, etc.

In a fifth aspect, the present invention further provides the use of the pharmaceutical composition of the third aspect of the present invention.

The pharmaceutical composition provided by the second aspect of the present invention is used to treat T cell-related diseases, including cancer, infectious diseases and autoimmune diseases.

Furthermore, the TCR-T cells contained in the pharmaceutical composition are from the patient's own T cells.

Furthermore, the TCR sequence in the TCR-T cells is the TCR full-length sequence information obtained after obtaining mRNA from the patient's own T cells.

Furthermore, the pharmaceutical composition is used for individual precise treatment of patients' own infectious diseases, tumors or immune diseases.

In another specific embodiment, the cancer is selected from the group consisting of acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical cancer, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendiceal cancer, astrocytoma, neurological Blastoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, bone cancer, brain tumor, breast cancer, bronchial adenoma, Burkitt lymphoma, unknown primary carcinoma, central nervous system lymphoma, cerebellar astrocytoma , cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative diseases, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma , esophageal cancer, Ewing's sarcoma, germ cell tumors, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular carcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, Kaposi's sarcoma, kidney cancer, laryngeal cancer, lip and oral cancer, liposarcoma, liver cancer, lung cancer, lymphoma, leukemia, macroglobulin Proteinemia, malignant fibrous histiocytoma/osteosarcoma of bone, medulloblastoma, melanoma, mesothelioma, metastatic squamous neck carcinoma with occult primary site, oral cancer, multiple endocrine neoplasia syndrome, bone marrow Dysplastic syndromes, myeloid leukemia, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma/malignant fibrous tissue of bone Cell tumors, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumors, pancreatic cancer, pancreatic islet cell cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal star Cytoma, pineal germ cell tumor, pituitary adenoma, pleuropulmonary blastoma, plasmacytoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, transitional cell carcinoma of the renal pelvis and ureter, Retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, skin cancer, Merkel cell skin cancer, small bowel cancer, soft tissue sarcoma, squamous cell carcinoma, gastric cancer, T-cell lymphoma, throat cancer, thymoma, thymus cancer, Group consisting of thyroid cancer, trophoblastic tumors, cancer of unknown primary site, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström's macroglobulinemia, and Wilms' tumor.

In another specific embodiment, the autoimmune disease is selected from the group consisting of arthritis, chronic obstructive pulmonary disease, ankylosing spondylitis, Crohn's disease, dermatomyositis, type I diabetes, endometriosis Goodpasture's syndrome, Graves' disease, Guillain-Balinese syndrome, Hashimoto's disease, hidradenitis suppurativa, Kawasaki disease, IgA nephropathy, idiopathic thrombocytopenic purpura, interstitial cystitis, lupus erythematosus, Mixed connective tissue disease, morphea, myasthenia gravis, narcolepsy, neuromyotonia, pemphigus vulgaris, pernicious anemia, psoriasis, psoriatic arthritis, polymyositis, primary biliary disease cirrhosis, relapsing polychondritis, rheumatoid arthritis, schizophrenia, scleroderma, Sjogren's syndrome, stiff-legged syndrome, temporal arteritis, ulcerative colitis, vasculitis, vitiligo, and Wegg's group composed of granulomas.

In a sixth aspect, the present invention further provides the use of the diagnostic and/or evaluation preparation provided in the fourth aspect of the present invention.

The diagnostic and/or evaluation preparations provided by the fourth aspect of the present invention are used for biomarkers, antibody development, drug and vaccine evaluation, immune cell differentiation tracing, immune rejection and tolerance, minimal residual disease detection, and food or other allergen detection.

In another specific embodiment, the expression vector is a viral vector or a non-viral vector.

In another specific embodiment, the vector contains a nucleic acid encoding TCR and a nucleic acid encoding CD8αβ or CD8α.

Description of drawings

Figure 1 is a schematic diagram of single cell labeling magnetic beads in Example 2;

Figure 2 is a flow chart of the TCR plasmid library construction technology in Example 2;

Figure 3 shows the TCR alpha and TCR beta gene fragments obtained by electrophoresis detection and PCR amplification in Example 2;

Figure 4 shows the TCR alpha constant region and TCR beta constant region gene fragments obtained by electrophoresis detection and PCR amplification in Example 2;

Figure 5 shows the TCR alpha full-length fragment and the TCR beta full-length fragment obtained by PCR amplification by electrophoresis detection in Example 2;

Figure 6 is a map of the TCR-expressing vector TCR-pMax in Example 2;

Figure 7 shows the positive clones where the TCR alpha and TCR beta full-length fragments were connected to the expression vector by electrophoresis in Example 3;

Figure 8 is a flow cytometry analysis of TCR-knocked out Jurkat cells in Example 4;

Figure 9 shows the expression status of the paired TCR expression plasmids electroporated into cells detected by flow cytometry in Example 4.

Detailed ways

In order for those skilled in the art to better understand the technical solutions of the present invention, the following examples further describe the present invention in detail. The following examples are only used to illustrate the invention, but are not used to limit the scope of the present invention.

Example 1

Enrichment of tumor-reactive T cells

First, tumor tissue is removed through surgery, and then the tumor tissue is digested into single cells. After the single cells are processed, the single cell suspension is stained and labeled using antibodies with fluorescent tags: CD3-FITC, CD45-PE and CXCL13-APC. The single cells were sorted by a flow cytometer (Sony; SH800S) to sort CXCL13-positive T cells in the tumor single cell suspension. This part of T cells carrying CXCL13 may be tumor-reactive T cells. Other tumor-reactive T cell signatures include: CD39 (ENTPD-1) and CD200.

Example 2

Use magnetic beads to label the TCR alpha and TCR beta chains and construct a TCR plasmid library. The magnetic beads carry DNA oligo (Figure 1). The DNA oligo includes: constant sequence 1, Barcode, constant sequence 2 and oligo dT sequence. Barcode is used to label individual cells. Oligo dT is used to capture mRNA. Constant sequence 1 and constant sequence 2 are used for cyclization and PCR processes. The overall technical flow of the present invention is shown in Figure 2.

1.Single cell sorting

1.1 Conduct activity measurement and cell counting on the sorted cells to ensure that the cell viability rate is above 85%. According to the counting, use PBS to adjust the cell density to 2×10 ⁵ /ml ~ 1×10 ⁶ /ml and prepare a single cell suspension. liquid.

1.2 Processing of microfluidic chips

The surface of the customized microfluidic chip has 20,000 micropores for accommodating single cells (preferably 1,000 to 150,000 pores). Place the microfluidic chip on a clean petri dish, use a 200 μl pipette to draw 200 μl of 100% absolute ethanol from the inlet and inject it into the chip. You can use the pipette to pump 100% absolute ethanol back and forth in the chip. Until bubbles no longer appear in the chip, remove the liquid from the sample outlet in time. Repeat flushing 2 to 3 times, remove the liquid at the sample outlet, and then draw 200 μl of 0.02% PBST (PBS contains 0.02% Tween-20) and inject it into the chip from the inlet. Control the time to within 10 seconds and remove the liquid at the sample outlet promptly. . Keep a small amount of liquid at the sample outlet, cover the petri dish, and let it stand at room temperature for later use.

1.3 Inject cells

Remove excess liquid from the sample inlet and outlet, add 200 μl of PBS to rinse the chip, then remove excess liquid from the sample outlet and inlet, and repeat rinsing once. Take 100 μl of resuspended cells (approximately 300 to 500 cells, preferably 50 to 2,000 cells), slowly and evenly inject into the chip, and immediately remove excess liquid from the sample outlet. Let the cells fall into the micropores for 5 minutes. During the resting period, the cells falling into the micropores can be observed under a microscope. After the cells fall into the microwell, draw 200 μl of PBS and slowly and evenly inject the chip into the chip to wash away excess cells, and immediately remove the liquid from the inlet and outlet. Repeat once with PBS to rinse away cells remaining on the surface that have not fallen into the microwells.

1.4 Inject single cell labeled magnetic beads

Take 60 μl of the resuspended single-cell labeled magnetic beads and add them to the chip inlet slowly and evenly. Aspirate 100 μl of PBS multiple times, add it slowly and evenly to the inlet, so that the single-cell labeled magnetic beads flow slowly, and promptly absorb the single-cell labeled magnetic beads from the outlet until it reaches the other end of the chip. During this period, collect the inlet and outlet of the single-cell labeled magnetic beads. Excess single cell labeling beads. Pipette 200 μl of PBS into the chip slowly and evenly, and suck away excess liquid from the sample inlet and outlet. Repeat once with PBS to wash away excess single cell labeled magnetic beads. Observe the single-cell labeling magnetic beads falling into the well under a microscope. If there are many vacancies for the single-cell labeling magnetic beads at the inlet end of the chip, the recovered single-cell labeling magnetic beads can be placed on a magnetic stand, and the supernatant can be aspirated to increase the single-cell labeling. After the density of cell labeling magnetic beads is injected again into the vacancy, let it sit for 10 seconds and then rinse. In the same way, if there are many vacancies for single-cell labeling magnetic beads at the outlet end of the chip, the recovered single-cell labeling magnetic beads can be injected into the outlet slot, and a pipette can be used to suck the single-cell labeling magnetic beads into the vacancies from the inlet end and let stand. Rinse again after 10 seconds.

2. Cell lysis and mRNA capture

2.1Inject Lysis Buffer

Draw 100 μl of Lysis Buffer from the inlet and slowly inject it into the chip for about 15 seconds, and immediately remove excess liquid from the inlet and outlet. Let stand at room temperature for 20 minutes to lyse cells and release mRNA. This step allows single-cell labeled magnetic beads to capture mRNA.

2.2 Remove the single cell labeling magnetic beads

2.2.1 Take a 1.5mL centrifuge tube, label it and place it on a 1.5mL magnetic stand.

2.2.2 Keep the magnetic stand at the bottom of the chip, add 200μl Wash Buffer to the groove of the sample outlet, and quickly rinse the concave surface of the sample outlet. After rinsing, remove the liquid immediately and repeat rinsing 3 times.

2.2.3 Add 200 μl of wash buffer to the sample outlet, transfer the magnetic stand to the top of the chip, and let it stand for 1 minute. Keep the magnetic stand on the top of the chip. Insert the 200 μl pipette tip into the sample inlet, absorb 200 μl of liquid, and collect. Transfer the liquid containing single-cell labeled magnetic beads to a pre-chilled 1.5 mL centrifuge tube. Repeat this step once to collect all the single-cell labeled magnetic beads that capture the mRNA.

3. Reverse transcription and amplification

3.1 Centrifuge the centrifuge tube containing the single-cell labeled magnetic beads briefly and place it on a 1.5ml magnetic stand. After the solution is clarified, carefully remove the supernatant. Remove the centrifuge tube from the magnetic stand, add 1 mL of Wash Buffer, pipet gently to mix, then centrifuge briefly and place on the magnetic stand. Carefully remove the supernatant after the solution is clear.

3.2 Remove the centrifuge tube from the magnetic stand, add 500 μl of 1×Wash Buffer, mix gently with a pipette, centrifuge briefly and place on the magnetic stand. Carefully remove the supernatant after the solution is clear.

3.3 Remove the centrifuge tube, centrifuge briefly and then place it on the magnetic stand. Use a 20 μl pipette to absorb the remaining liquid. Leave only the single-cell labeled magnetic beads at the bottom of the centrifuge tube.

3.4 Prepare RT Mix-1 on ice according to the following table, mix and centrifuge briefly

Components	volume
RT Master Mix	120μl
100mM DTT	20μl
TS primer	10μl
Reverse Transcriptase	10μl
RNase Inhibitor	5μl
ddH2O	35μl
Total	200μl

Add 200μl of the prepared RT Mix to the TCR Barcode Beads in step 3.3, and use a pipette to mix evenly. Place in a metal bath set in advance, 42°C, rotation speed 1300rpm, react for 90 minutes (preheated in advance).

3.5 cDNA amplification

3.5.1 Prepare PCR Mix-2 on ice according to the following table, mix and centrifuge briefly

Components	volume
Amplification Master Mix	172μl
G Primer Mix	3.2μl
Amplification Enzyme	8μl
ddH2O	216.8μl
Total	400μl

3.5.2 Centrifuge the reverse transcription product from the previous step and place it on a 1.5ml magnetic stand. Carefully remove the supernatant after the solution is clear.

3.5.3 Remove the centrifuge tube from the magnetic stand, add 400μl of the prepared PCR Mix to the tube, mix by pipetting, and distribute it into 8 row tubes, each tube is filled with 50μl.

3.5.4 Close the caps of the 8-row tubes and place them in the PCR machine for amplification. The PCR reaction procedure is:

4.cDNA product purification

4.1 Ampure XP purification magnetic beads are removed from 4°C 30 minutes in advance and returned to room temperature. Shake thoroughly before use.

4.2 Collect the PCR amplification products into a 1.5m centrifuge tube and centrifuge briefly. Add 0.6× purified magnetic beads, vortex and mix, incubate at room temperature for 5 minutes and centrifuge briefly. Place on a 1.5 mL magnetic stand and let stand for 5 minutes until the liquid is transparent and clear. Carefully remove the supernatant into a new 1.5 mL centrifuge tube.

4.3 Keep the centrifuge tube on the magnetic stand and add 800 μl of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30 seconds and carefully remove the supernatant.

4.4 Repeat step 4.3 once.

4.5 Remove the centrifuge tube, centrifuge briefly, place it on the magnetic stand again, absorb excess alcohol, open the lid and let dry for about 2 minutes.

4.6 Remove the centrifuge tube, add 100μl Buffer EB, pipette to mix, incubate at room temperature for 5 minutes, centrifuge briefly and place on a magnetic stand until the liquid is transparent and clear.

4.7 Absorb the supernatant and transfer it to a new EP tube, add 80μl magnetic beads (0.8×product volume), mix by pipetting, incubate at room temperature for 5 minutes and centrifuge briefly, place on a magnetic stand and let stand for 5 minutes until the liquid is transparent and clear, then remove carefully Transfer the supernatant to a new 1.5mL centrifuge tube.

4.8 Keep the PCR tube on the magnetic stand and add 800 μl of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30 seconds and carefully remove the supernatant.

4.9 Repeat step 4.8 once.

4.10 Remove the centrifuge tube, centrifuge briefly, place it on the magnetic stand again, absorb excess alcohol, open the lid and let dry for about 2 minutes.

4.11 Remove the centrifuge tube, add 20μl Buffer EB, pipet and mix evenly, incubate at room temperature for 5 minutes, centrifuge briefly and then place on a magnetic stand until the liquid is transparent and clear.

4.12 Aspirate the supernatant and transfer it to a new EP tube to obtain the purified product.

5. First cyclization

5.1 Purify the cDNA product and prepare the reaction system according to the following table

Components	volume
GA master mix	10μl
Purified cDNA product	500ng
ddH2O	To 20μl

Use a pipette to mix gently and thoroughly, centrifuge briefly and place the reaction tube in the PCR machine. The thermal cover of the PCR instrument is 85°C: react at 50°C for 1 hour; react at 75°C for 10 minutes; store at 4°C.

5.2 Enzyme digestion

After cyclization, the product is not purified and enzyme is added for enzymatic digestion. Place the PCR tube on ice and prepare the enzyme digestion system according to the following table.

Components	volume
The cyclization product of the previous step	20μl
Cyclicase	0.5μl
ddH2O	To 25μl

Use a pipette to mix gently and thoroughly, centrifuge briefly and place the reaction tube in a PCR machine: react at 37°C for 30 minutes; store at 4°C.

5.3 Purification of cyclization products

5.3.1 Remove the purified magnetic beads from 4°C 30 minutes in advance and return to room temperature. The magnetic beads need to be mixed thoroughly before use.

5.3.2 Eject the liquid in the PCR tube and calculate the volume. Add 1.3× product volume of magnetic beads, mix by pipetting, and incubate at room temperature for 5 minutes. Centrifuge briefly and place on a magnetic stand for 5 minutes until the liquid is transparent and clear. Carefully remove the supernatant to a new PCR tube.

5.3.3 Keep the PCR tube on the magnetic stand and add 200 μl of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30 seconds and carefully remove the supernatant. Repeat the steps twice.

5.3.4 Remove the PCR tube, centrifuge briefly, place it on the magnetic stand again to absorb excess alcohol, and dry it.

5.3.5 Remove the PCR tube, add 20μl Nuclease-free Water, pipe and mix the magnetic beads, incubate at room temperature for 5 minutes, centrifuge briefly and then place on a magnetic stand until the liquid is transparent and clear.

5.3.6 Aspirate the supernatant and transfer it to a new EP tube, which is the purified cyclization product.

6.TCR first round enrichment

6.1 Place the PCR tube on ice and prepare enrichment PCR Mix-3 according to the following table

Components	volume
Amplification Buffer	10μl
10mM dNTP mix	1.5ul

TCR R1 primer	1.5μl
TCR alpha-F-1/TCR beta-F-1	1.5μl
Amplification Enzyme	1ul
cyclization product	about 20ng
ddH2O	variable
Total	To 50μl

Components	volume
Amplification Buffer	10μl
10mM dNTP mix	1.5ul
TCR R1 primer	1.5μl
TCR alpha/TCR beta primer	1.5μl
Amplification Enzyme	1ul
cyclization product	about 20ng
ddH2O	variable
Total	50μl
Components	volume
Amplification Buffer	10μl
10mM dNTP mix	1.5ul
TCR R1 primer	1.5μl
TCR alpha/TCR beta primer	1.5μl
Amplification Enzyme	1ul
cyclization product	about 20ng
ddH2O	variable
Total	50μl

Among them, TCR R1 primer sequence: GCGTCAGATGTGTATAAGAG;

TCR alpha-F-1 primer sequence: AGTCTCTCAGCTGGTACACG;

TCR beta-F-1 primer sequence: TCTGATGGCTCAAACACAGC.

6.2 Mix the prepared PCR mix gently and thoroughly, and place the reaction tube in the PCR machine. The PCR reaction procedure is:

The enriched products were detected by agarose gel electrophoresis, and the results are shown in Figure 3. It can be seen from the electrophoresis results that the TCR alpha and TCR beta variable regions, including part of the constant region, form a single band after amplification.

6.3 First round of enrichment product purification

6.3.1 Remove the purified magnetic beads from 4°C 30 minutes in advance and return to room temperature. Shake thoroughly before use.

6.3.2 Instantly separate the liquid in the PCR tube and calculate the volume. Add 30 μl magnetic beads (0.6 × product volume), mix by pipetting and incubate at room temperature for 5 minutes. Centrifuge briefly and place on a magnetic stand for 5 minutes until the liquid is transparent and clear. Carefully remove the supernatant to a new PCR tube.

6.3.3 Keep the PCR tube on the magnetic stand and add 200 μl of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30 seconds and carefully remove the supernatant.

6.3.4 Repeat step 3 for a total of 2 rinses.

6.3.5 Remove the PCR tube, centrifuge briefly, place it on the magnetic stand again, absorb excess alcohol and dry it.

6.3.6 Remove the PCR tube and add 20 μl of Buffer EB, pipe and mix the magnetic beads and incubate at room temperature for 5 minutes. Centrifuge briefly and then place on a magnetic stand until the liquid is transparent and clear.

6.3.7 Aspirate the supernatant and transfer it to a new EP tube to obtain the purified product, labeled TCR alpha-1 and TCR beta-1. The purified product carries the 5' end barcode sequence and other elements, the full length of the TCR variable region and part of the TCR constant region sequence.

7. Second cyclization

7.1 PCR amplification of part of the constant region: Design PCR primers to amplify the remaining constant region sequence TCR alpha-2 of TCR alpha-1 from the TCR-TRAC-pMax vector, and add TCR alpha to the 5' ends of the forward and reverse primers -1 fragment homologous sequence, constant region sequence TCR alpha-2 (see Seq ID No.1 for the nucleic acid sequence and Seq ID No.2 for the amino acid sequence). Follow the same method to design PCR primers to amplify the remaining constant region sequence TCR beta-2 of TCR beta-1 from the TCR-TRBC-pMax vector, and add the TCR beta-1 fragment to the 5' ends of the forward and reverse primers. Homologous sequence, constant region sequence TCR beta-2 (see Seq ID No.3 for nucleic acid sequence and Seq ID No.4 for amino acid sequence).

PCR amplification system:

Taq mix 2X	25μl
ddH 2 O	22μl
TCR-TRAC-pMax/TCR-TRBC-pMax	1μl
TCR alpha-2-F/TCR beta-2-F	1μl
TCR alpha-2-R/TCR beta-2-R	1μl

The primer sequence is:

TCR alpha-2-F: catatccagaaccctgaccc;

TCR alpha-2-R: ctgtctcttatacacatctgacgcttagctggaccacagccgcagcg;

TCR beta-2-F:gaggacctgaacaaggtgtt;

TCR beta-2-R: ctgtctcttatacacatctgacgcttagaaatcctttctcttgaccatg.

PCR amplification conditions:

The PCR products were detected by agarose gel electrophoresis, and the results are shown in Figure 4. It can be seen from the electrophoresis results that the TCR alpha and TCR beta constant regions formed a single band after amplification, and the gene fragment was amplified successfully.

7.2 Purify PCR products according to the standard operating procedures provided by the kit (Tiangen Biochemical Technology Co., Ltd., DP219-03).

7.2.1 Cut out a single DNA band from the agarose gel (try to cut off the excess part) into a clean centrifuge tube and weigh it.

7.2.2 Add 3 times the volume of sol liquid PE to the gel block (if the gel weighs 0.1g, its volume can be regarded as 100 μl, then add 300 μl of sol liquid PE). Solve at room temperature of 15-25°C for 5-10 minutes. During this period, gently turn the centrifuge tube up and down to ensure that the gel block is fully dissolved.

7.2.3 Add the solution obtained in the previous step to an adsorption column CA5 (put the adsorption column into the collection tube), place it at room temperature for 2 minutes, and centrifuge at 12000 rpm for 30 to 60 seconds. Pour out the waste liquid in the collection tube and put the adsorption column CA5 into the collection tube. in the tube.

7.2.4 Add 600 μl of rinse solution PW to the adsorption column CA5, centrifuge at 12000 rpm for 30 to 60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CA5 into the collection tube.

7.2.5 Repeat step 7.2.4.

7.2.6 Place the adsorption column CA5 back into the collection tube, and centrifuge at 12,000 rpm for 2 minutes to remove as much rinse liquid as possible. Place the adsorption column CA5 at room temperature for a few minutes and dry it thoroughly to prevent residual rinse solution from affecting the next experiment.

7.2.7 Place the adsorption column CA5 into a clean centrifuge tube, add preheated ddH2O dropwise to the middle of the adsorption membrane, and leave it at room temperature for 2 minutes. Centrifuge at 12,000 rpm for 2 minutes to collect the DNA solution. The products after purification and recovery are TCR alpha-2 and TCR beta-2 respectively.

7.3 Second cyclization

The purified product is used to prepare a reaction system according to the following table:

Components	volume
10X buffer	2μl
TCR alpha-1/TCR beta-1	5μl
TCR alpha-2/TCR beta-2	5μl
cyclase	1μl
ddH2O	7μl

The cyclization reaction was carried out at 50°C for 1 hour.

7.4 Purification of cyclization products

7.4.1 Take out the DNA Clean Beads half an hour in advance and place them at room temperature. Shake and mix thoroughly before use.

7.4.2 Add DNA Clean Beads (0.5×product volume) to the product of step 7.3, mix gently by pipetting, and incubate at room temperature for 10 minutes.

7.4.3 After the incubation, centrifuge briefly, place the 1.5mL EP tube on a magnetic stand, let it stand for 5 minutes until the liquid is clear, use a pipette to carefully absorb and discard the supernatant.

7.4.4 Keep the 1.5ml EP tube on the magnetic stand, add 500μl of freshly prepared 80% ethanol to rinse the magnetic beads and tube wall, carefully absorb and discard the supernatant. Repeat this step once.

7.4.5 Keep the 1.5ml EP tube fixed on the magnetic stand, open the cap of the 1.5ml EP tube, and dry at room temperature.

7.4.6 Remove the 1.5ml EP tube from the magnetic stand, add 22μl TE Buffer for DNA elution, gently pipet with a pipette to mix, and let stand at room temperature for 10 minutes.

7.4.7 Centrifuge briefly, place the 1.5ml EP tube on the magnetic stand, let it stand for 5 minutes until the liquid is clear, and transfer 20 μl of the supernatant to a new 1.5ml EP tube.

8.Second round of TCR enrichment

8.1 TCR alpha and TCR beta cyclization products are PCR amplified respectively to enrich TCR.

PCR amplification system:

Taq mix 2X	25μl
ddH 2 O	22μl
TCR alpha/TCR beta cyclization product	1μl
TCR-F	1μl
TCR-R	1μl

The primer sequence is

TCR-F: ttgcctttctctccacaggggtacctggtatcaacgcagagtacttggg;

TCR-R: cattctagttgtggtttgtccaaacctgcttggaacggtacatacttgct.

The PCR reaction procedure is:

The products of the second round of enrichment were detected by agarose gel electrophoresis as shown in Figure 5. It can be seen from the electrophoresis results that the TCR alpha and TCR beta full-length fragments were successfully amplified after secondary cyclization.

8.2 Second round of enrichment product purification

8.2.1 Take the purified magnetic beads out of 4°C and return to room temperature 30 minutes in advance. Shake and mix thoroughly before use.

8.2.2 Instantly separate the liquid in the PCR tube to calculate the volume. Add 30 μl magnetic beads (0.5 × product volume), mix by pipetting and incubate at room temperature for 5 minutes. Centrifuge briefly and place on a magnetic stand for 5 minutes until the liquid is transparent and clear. Carefully remove the supernatant to a new PCR tube.

8.2.3 Keep the PCR tube on the magnetic stand and add 200 μl of newly prepared 80% ethanol to rinse the magnetic beads. Incubate at room temperature for 30 seconds and carefully remove the supernatant.

8.2.4 Repeat step 3 for a total of 2 rinses.

8.2.5 Remove the PCR tube, centrifuge briefly, place it on the magnetic stand again, absorb excess alcohol, and dry it.

8.2.6 Remove the PCR tube, add 20 μl of Buffer EB, pipe and mix the magnetic beads and incubate at room temperature for 5 minutes, centrifuge briefly and then place on a magnetic stand until the liquid is transparent and clear.

8.2.7 Aspirate the supernatant and transfer it to a new EP tube, which is the purified product.

9. Connect the TCR expression vector

This vector carries the CMV promoter and polyA site. The specific map is shown in Figure 6. The purified full-length TCR-alpha and TCR-beta are cloned into the TCR-pMax vector through recombination, and then have a complete TCR expression cassette, which can efficiently express TCR subunits. The specific steps are:

9.1 Preparation of linearized TCR-pMax vector: Use XhoI (NEB: R0146S) and KpnI (NEB: R3142S) to linearize and purify TCR-pMax.

9.2 Recombination reaction:

React at 50°C for 20 minutes.

10. Transform E. coli

2.1 Thaw competent cells DH5α (Shanghai Vidy Biotechnology Co., Ltd.) on ice. Generally, the volume of the transformation product should not exceed 1/10 of the competent volume.

2.2 Take 10 μl of the recombinant product, add it to 100 μl of competent cells, mix gently, and place on ice for 20 minutes.

2.3 Heat shock at 42°C for 90 seconds, place on ice for 2 minutes, add 700 μl of double-antibody-free LB culture medium (Shanghai Sangon), resuscitate in a 37°C shaker at 220 rpm for 40 minutes, and centrifuge at 5000 rpm for 3 minutes. Aspirate 700 μl of the supernatant, mix the remaining liquid with a pipette, and apply it all to the Amp plate, and incubate it overnight in a 37°C microbial incubator.

Example 3

TCR library sequence comparison to obtain paired TCR sequences

1. On the next day, 192 single colonies were selected from the plates transformed with TCR-alpha and TCR-beta gene fragments, and placed in 200 μl of Amp-resistant LB medium on a shaking table at 37°C for 2 hours. 2 μl of the bacterial liquid was initially identified as positive by PCR. clone.

PCR bacteria detection system: 20μl

2X Taq mix	10μl
ddH2O	7μl
Bacterial liquid	2μl
TCR-F-JJ	0.5μl
TCR-R-JJ	0.5μl

The TCR-F-JJ primer sequence is: taggcacctattggtcttac;

The TCR-R-JJ primer sequence is: tcactgcattctagttgtgg.

PCR bacteria detection conditions:

The bacterial test results were detected by agarose gel electrophoresis, as shown in Figure 7. The band with an inserted sequence length of approximately 1000 bp is a positive clone, and the identified positive clones are sent to the corresponding bacterial solution for Sanger sequencing verification. The sequencing primers are:

TCR-seq-F: acctattggtcttactga;

TCR-seq-R:cattctagttgtggtttgtc.

2. Sequence alignment and TCR pairing

The complete sequence of TCR alpha and TCR beta and the barcode of a single cell obtained through Sanger sequencing. The complete sequence obtained was analyzed by DNA sequence analysis software to obtain the full-length sequence of TCR alpha and TCR beta. At the same time, the TCR alpha and TCR beta clones with the same barcode sequence were determined. A pair of TCRs is a paired TCR. A total of 86 paired TCR pairs were found in the selected clones by this method. That is, the full-length sequence that can be paired with TCR is obtained.

Table 1 shows the variable region nucleotide sequences of 24 pairs of paired TCR sequences.

Table 1 Variable region nucleotide sequences of 24 pairs of paired TCR sequences

Example 4

High-throughput TCR expression detection

1. Effector cell construction and testing

Use lentivirus with NFAT-luciferase to infect Jurkat cells (Cell Bank of Chinese Academy of Sciences), and select monoclonal cultures to obtain Jurkat-NFAT-luciferase reporter cell lines (TCR reconstitution in Jurkat reporter cells facilitates the identification of novel tumor antigens by cDNA expression cloning.Int J Cancer.2002 May 1;99(1):7-13). Use CRISPR/Cas9 electroporation to simultaneously knock out the TCR gene, and select non-knocked-out cells as negative controls. The specific steps are:

1.1 Take a certain amount of Jurkat-NFAT-luciferase cells, centrifuge them at 1200 rpm for 5 minutes, and then wash them twice with medium opti-MEM for later use. Resuspend cells in 25 μl of opti-MEM for every 1×10 ⁶ cells and set aside.

1.2 Prepare Cas9 and sgRNA on ice: add 10μl Cas9 (500ng/μl) protein (Nanjing GenScript), 2.5μl TRAC-sgRNA and 2.5μl TRBC-sgRNA) (400ng/μl Nanjing GenScript) per 1×106 cells Rui), incubate the two at room temperature for 10 minutes, add the cells prepared in advance and start electroporation.

1.3 Electroconversion conditions: BTX-ECM830 1mm electric shock cup, voltage 250V, pulse time 1ms.

1.4 After electroporation, quickly add 1 ml of culture medium to the electroporation cup, and then transfer the cells to the culture well for culture.

1.5 After 48 hours of electroporation knockout, take a certain volume of cells, add anti-CD3-APC antibody (BD Pharmingen, 555335) to stain the cells, and incubate at 4°C for half an hour. After staining, cells were washed with PBS and resuspended, and flow cytometry was used to detect TCR knockdown. The results of TCR knockout in Jurkat cells are shown in Figure 8. From the flow cytometry results, it can be seen that the TCR in Jurkat cells has been completely knocked out. The effector cells prepared through this step are named: Jurkat-KO-ER.

2. Electroporation of paired TCR plasmids into effector cells

According to the optimal conditions for electroporation, 10 paired TCR pairs with complete sequences among the 24 paired TCR plasmids were selected, named TCRab-1-10 respectively, and electroporated into Jurkat-KO-ER. The electrical transfer process is:

2.1 Take Jurkat-KO-ER cells, centrifuge them at 1200 rpm for 5 minutes, and wash them twice with medium opti-MEM for later use.

2.2 Add 4ug of paired TCR plasmid (2ug each of TCRalpha and TCRbeta plasmid) to every 1×106 Jurkat-KO-ER cells, and supplement the medium opti-MEM to 100μl.

2.3 Add 100 μl of the plasmid and cell mixture to a 96-well electroporation plate (BTX, 45-0450), with a voltage of 260V and a pulse time of 1ms. After electroporation, transfer the cells to a new 96-well plate and continue to culture the cells.

3. Screen for functional TCRs

3.1 Detection of TCR expression in cells by flow cytometry: 24 hours after electroporation of paired TCR plasmids into Jurkat-KO-ER cells, take a certain volume of cells and add anti-CD3-APC antibody (BD Pharmingen, 555335) to stain the cells. 4 °C for half an hour. After staining, cells were washed with PBS and resuspended, and flow cytometry was used to detect the expression of TCR cells. Representative results of expression of electroporated TCR in Jurkat-KO-ER cells are shown in Figure 9. It can be seen from the figure that after 10 pairs of representative paired TCRs were electroporated into cells, CD3 expression resumed.

Example 5

Cloning paired TCRs into transposon vectors

The full-length sequences of TCR alpha and TCR beta were cloned into transposon vectors using conventional molecular cloning methods.

Example 6

Personalized TCR-T cell therapy

The transposon carrying the active TCR sequence is delivered into the patient's T cells through electroporation to prepare personalized TCR-T cells. These cells can be used to treat cancer patients.

The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various transformations can be made to the technical solution of the present invention. These simple variations are all belong to the protection scope of the present invention.

In addition, it should be noted that each of the specific technical features and steps described in the above-mentioned specific embodiments can be combined in any suitable manner without conflict. In order to avoid unnecessary repetition, the present invention includes various Possible combinations are not specified further.

In addition, any combination of various embodiments of the present invention can also be carried out. As long as they do not violate the idea of the present invention, they should also be regarded as the disclosed content of the present invention.

Claims (17)

1. A method for cloning paired TCR sequences, characterized in that the method includes the following steps: sorting and capturing single tumor-reactive T cells in tumor tissues, extracting and labeling the mRNA of single cells by Barcode, reverse transcribing and constructing Full-length cDNA, cDNA-specific PCR amplification to obtain the full-length cDNA transcriptome, first circularization after enrichment, specific amplification of the TCR sequence, second circularization after enrichment, and enrichment again, enrichment The product is ligated into an expression vector to obtain a full-length clone of the TCR, and the Barcode sequence in the library is compared to obtain the paired TCR sequence.
2. A method for cloning paired TCR sequences according to claim 1, characterized in that: in the method, TSO is added to the reverse transcription system during reverse transcription of mRNA to amplify the enrichment of the full-length transcriptome of cDNA. set.
3. A method for cloning paired TCR sequences according to claim 2, characterized in that: in the method, through the constant region sequence at the 5' end of the single-cell labeling magnetic beads and the TSO sequence added during the reverse transcription process, Amplification completes the enrichment of the full-length transcriptome.
4. A method for cloning paired TCR sequences according to claim 1, characterized in that: the first cyclization in the method is to cyclize the obtained amplification product and use single-cell labeled magnetic beads to The constant sequence and TCR-specific primer (end of the constant region) perform specific amplification of the TCR sequence to complete the enrichment of TCR.
5. A method for cloning paired TCR sequences according to claim 1, characterized in that: in the method, the second cyclization is: after the obtained amplification product is subjected to a second cyclization process, the method is used according to the single The forward and reverse primers designed from the constant sequence of cell labeling magnetic beads are used to enrich TCR. After enrichment, the cell barcode will be connected to the TCR constant region and located at the 3' end of the enriched product.
6. A method for cloning paired TCR sequences according to claim 1, characterized in that: the paired TCR sequences include TCR-alpha and TCR-beta sequences.
7. A method for rapidly cloning paired TCR sequences according to claim 1, characterized in that the method for sorting single tumor-reactive T cells is: digesting tumor tissue into single cells and preparing single cell suspensions and then injecting them into microfluidics Control the chip to obtain single tumor-reactive T cells.
8. A TCR-T cell, characterized in that: the TCR-T cell is obtained by injecting the paired TCR sequence obtained in any one of claims 1 to 7 into the corresponding T cell through bioengineering technology.
9. A TCR-T cell according to claim 8, characterized in that: the corresponding T cell refers to an individual's own T cell or allogeneic T cell.
10. A pharmaceutical composition, characterized in that the pharmaceutical composition contains the TCR-T cells described in claim 8 or 9.
11. The pharmaceutical composition according to claim 10 is used to treat diseases related to T cells, including infectious diseases, tumors, autoimmune diseases and organ transplantation.
12. A diagnostic and/or evaluation preparation containing the TCR-T cell according to claim 8 or 9.
13. The diagnostic and/or evaluation preparation according to claim 12, characterized in that the preparation is prepared as a preparation kit.
14. Use of the diagnostic and/or evaluation preparation according to claim 12 or 13 for the preparation of a kit for diagnosing or evaluating a disease or event related to T cells;

    Such diseases or events include infectious diseases, tumors, autoimmune diseases, and organ transplantation.
15. Use of the pharmaceutical composition according to claim 10 or 11 for preparing a medicament for treating T cell-related diseases, including cancer, infectious diseases and autoimmune diseases.
16. The use of the pharmaceutical composition according to claim 15, characterized in that: the cancer is selected from acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical cancer, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendix Carcinoma, astrocytoma, neuroblastoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, bone cancer, brain tumor, breast cancer, bronchial adenoma, Burkitt lymphoma, carcinoma of unknown primary, central nervous system Lymphoma, cerebellar astrocytoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, uterus Endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma, germ cell tumors, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor, glioma, hairy cell leukemia, head and neck cancer , heart cancer, hepatocellular carcinoma, Hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, Kaposi's sarcoma, kidney cancer, laryngeal cancer, lip cancer and oral cavity cancer, liposarcoma, liver cancer, lung cancer , lymphoma, leukemia, macroglobulinemia, bone malignant fibrous histiocytoma/osteosarcoma, medulloblastoma, melanoma, mesothelioma, metastatic squamous neck cancer with occult primary site, oral cancer, Multiple endocrine neoplasia syndrome, myelodysplastic syndrome, myeloid leukemia, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cavity cancer, oropharyngeal cancer , osteosarcoma/malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumors, pancreatic cancer, pancreatic islet cell cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, chromaffin Cytoma, pineal astrocytoma, pineal germinoma, pituitary adenoma, pleuropulmonary blastoma, plasmacytoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma , transitional cell carcinoma of the renal pelvis and ureter, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, skin cancer, Merkel cell skin cancer, small bowel cancer, soft tissue sarcoma, squamous cell carcinoma, gastric cancer, T-cell lymphoma, throat Carcinoma, thymoma, thymic carcinoma, thyroid carcinoma, trophoblastic tumor, carcinoma of unknown primary site, urethral carcinoma, uterine sarcoma, vaginal carcinoma, vulvar carcinoma, Waldenström's macroglobulinemia and Wilms' tumor The group of autoimmune diseases is selected from the group consisting of arthritis, chronic obstructive pulmonary disease, ankylosing spondylitis, Crohn's disease, dermatomyositis, type I diabetes, endometriosis, Goodpasture's syndrome , Graves' disease, Guillain-Balinese syndrome, Hashimoto's disease, hidradenitis suppurativa, Kawasaki disease, IgA nephropathy, idiopathic thrombocytopenic purpura, interstitial cystitis, lupus erythematosus, mixed connective tissue disease, Morphea, myasthenia gravis, narcolepsy, neuromyotonia, pemphigus vulgaris, pernicious anemia, psoriasis, psoriatic arthritis, polymyositis, primary biliary cirrhosis, relapsing Group consisting of polychondritis, rheumatoid arthritis, schizophrenia, scleroderma, Sjogren's syndrome, stiff-legged syndrome, temporal arteritis, ulcerative colitis, vasculitis, vitiligo, and Wegener's granulomatosis .
17. The preparation according to claim 14 is further used for biomarkers, antibody development, drug and vaccine evaluation, immune cell differentiation tracing, immune rejection and tolerance, minimal residual disease detection, and food or other allergen detection.

Images