CN114606264A - AAV viral vector for nervous system drug delivery - Google Patents

Abstract

The invention relates to a novel AAV vector, which comprises a polypeptide sequence WPTSYDA inserted into the 588 th amino acid site corresponding to AAV9, wherein H527 is mutated into Y, R533 is mutated into S, in addition, a promoter for expressing a target gene is hSyn, compared with a wild AAV9 vector, the AAV9.7YS mutant has better blood brain barrier penetrating capability, the capability of infecting a nervous system after intravenous injection of the virus is stronger, and the infection efficiency on peripheral tissues (heart, liver and skeletal muscle) is lower. The invention also relates to a packaging preparation method of the disclosed virus vector and application of the virus vector in gene therapy.

Description

AAV (adeno-associated virus) viral vector for nervous system drug delivery

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a novel AAV (adeno-associated virus) for drug delivery in a nervous system.

Background

Adeno-associated virus (AAV), a microminiature non-pathogenic virus found in humans and other mammals, comprises an icosahedral capsid having a diameter of about 26nm and a 4.7kb single-stranded DNA genome. Recombinant aav (raav) has been developed as a gene delivery vector due to its high infectivity of dividing and non-dividing cells and specific in vivo tissue tropism. The discovery of numerous AAV serotypes and variants from humans and primates has greatly facilitated the development of AAV vectors, providing multiple options for targeting different tissues and cells.

Among all AAV serotypes found so far, AAV9 is widely used in gene therapy applications because of its high tissue tropism for liver, heart and skeletal muscle, and in addition, it has the ability to cross the blood-brain barrier (BBB) and infect nerve cells, and thus is widely used in gene therapy for neurological diseases. At present, based on AAV9, ZOLGENSMA gene therapeutic drugs of Nowa company are approved by FDA to be marketed, AAV9 is adopted to carry therapeutic gene SMN1 for treating spinal muscular atrophy patients under 2 years old, clinical trial evidence shows that Zolgesma can not only save lives of patients, but also can make part of patients thrive as healthy children, after receiving one treatment, the curative effect of Zolgesma can be maintained for more than 5 years, and a potential curative therapy of ' possible ' once for all ' is brought for saving lives of SMA patients (spinal muscular atrophy).

AAV capsid proteins dictate that AAV has tissue cell specificity, and therefore, since AAV has been demonstrated to have a clinical potential, designing novel AAV capsids to obtain new features has been a continuing goal sought by researchers. As technology advances, strategies to develop new capsids evolve. The current development strategies for capsid proteins are mainly divided into rational design, directed evolution and computer aided design. The improvement of targeting and high-efficiency transduction on target tissue cells is an important strategy for reducing toxic and side effects in AAV gene therapy, although AAV9 can pass through a blood-brain barrier to infect nerve cells, the infection efficiency is still low, and after AAV9 virus is injected intravenously, a large amount of AAV9 virus can infect cardiac muscle, skeletal muscle and liver cells, the proportion of AAV9 virus which passes through a blood brain barrier and infects nerve cells is small, and the phenomenon is verified in a plurality of laboratories at home and abroad.

Therefore, there is an urgent need in the art to develop a novel AAV vector that can efficiently infect nerve cells, less efficiently infect muscle, cardiac muscle, and liver cells, and has a greater ability to cross the blood-brain barrier.

Disclosure of Invention

To solve the problems described in the background art. The invention provides a novel AAV (adeno-associated virus) viral vector which can efficiently infect nerve cells, inefficiently infect muscles, cardiac muscles and liver cells and has stronger capability of crossing a blood-brain barrier.

In order to achieve the purpose, the invention adopts the following technical scheme:

the method utilizes the PCR site-directed insertion technology to insert nucleotide sequences of AAV9 capsid sequences, namely AAV9 wild type capsid protein VP1 amino acid sequence SEQ ID NO: 2 (wherein the DNA sequence of the AAV9 wild type capsid protein VP1 is SEQ ID NO: 3) followed by the 558 th position by the amino acid sequence SEQ ID NO: 4 (wherein, the specific nucleic acid sequence is SEQ ID NO: 5); then, the inserted AAV9 viral vector is transformed and the plasmid is extracted to obtain the AAV9 capsid protein sequence with the sequence, wherein the amino acid sequence is SEQ ID NO: 6, the DNA sequence is SEQ ID NO: 7.

on the basis of the sequences, a site-directed mutagenesis primer spanning a mutagenesis site is designed, then, the PCR technology is utilized to carry out site-directed mutagenesis on the 527 th site and the 533 th site on the AAV9 capsid sequence, the H527 of the AAV9 capsid protein amino acid is mutated into Y, the R533 is mutated into S, finally, the mutated AAV9 viral vector is transformed and the plasmid is extracted, so that the site-directed mutagenesis AAV9 capsid protein sequence is obtained, wherein the amino acid sequence is SEQ ID NO: 8, the DNA sequence is SEQ ID NO: 9.

on the basis of the sequences, the promoter of the target gene of the AAV viral vector is changed into a hSyn promoter by utilizing a PCR technology, and the hSyn promoter has a sequence of SEQ ID NO: and 10, then carrying out transformation on the vector and extraction of the plasmid to obtain a plasmid with the sequence of SEQ ID NO: 1 of the AAV viral vector.

And (3) carrying out the optimization on the novel AAV vector SEQ ID NO: 1, packaging, wherein the method comprises the following steps: culturing HEK293T cells with the cell density of 80-90%; then pHelper, pAAV9/pAAV9.7YS, pAAV-LUC and Neofect transfection reagent are mixed evenly, added into HEK293T cells together, and cultured for 72h after mixing evenly; and centrifugally separating the cell sediment from the supernatant, cracking the cell sediment by a repeated freeze-thaw method to release AAV, and finally purifying the AAV crude extract by iodixanol density gradient ultracentrifugation to obtain the AAV.

The packaged novel AAV is concentrated by ultrafiltration, and the titer of the AAV is determined by real-time fluorescence quantitative PCR technology, the formula is copy number (copies/. mu.L) ═ concentration (ng/. mu.L). 10^ (-9). 6.02 ^ 10^ 23/base logarithm bp 650, wherein 6.02 ^ 10^23 is Avogastrol constant, i.e. the number of molecules in 1mol of substance, then lg value of genome copy number is X, Ct value is Y, thereby establishing a standard curve, and the titer of the sample is calculated.

Protein immunoblotting assay was used to detect three components in AAV virus capsids: VP1, VP2 and VP3, thereby evaluating the packaging and purification effects of the AAV.

The tissue organ distribution of the novel AAV virus vector is evaluated in a mouse body, the method is that AAV virus carrying luciferase is injected through tail vein of the mouse, and the distribution condition of the AAV virus in the mouse body is detected by live imaging of the small animal; taking brain, heart, liver, spleen, lung, kidney and muscle tissues of the mouse, detecting the enzymatic activity of luciferase in each tissue organ and the copy number of AAV virus genome, and evaluating the specificity of the novel AAV vector AAV9.7YS infected nervous system.

Drawings

FIG. 1 shows the agarose gel electrophoresis of AAV9 and AAV9.7YS capsid protein plasmids.

FIG. 2 Standard Curve for AAV Virus titer test and AAV9, AAV9.7YS sample titers.

FIG. 3Western blot detection of AAV capsid proteins VP1, VP2, VP 3.

FIG. 4 distribution of AAV9, AAV9.7YS viruses in live mice.

Fig. 5 shows the brain imaging and quantification results of AAV9 and AAV9.7YS infected mice.

FIG. 6 is a graph showing the activity of luciferase in each tissue and organ of mice.

FIG. 7 is a graph showing the viral genome copy number of mouse tissues and organs AAV9 and AAV9.7YS.

Detailed Description

In the following, the technical solutions in the embodiments of the present invention are described in detail and completely, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments.

The reagents and kits involved in the examples were purchased from manufacturers and the reagent formulations were as follows:

5×Prime STAR^@Buffer(Mg²⁺Plus)：Takara；Prime STAR^@HS DNA Polymerase：Takara；dNTP Mixture：Takara；

DpnI enzyme: takara;

plasmid extraction kit: beijing Zhuang Union corporation;

DMEM medium: thermo Fisher Scientific;

neofect transfection reagent: beijing code science and technology, Inc.;

fetal bovine serum: biological Industries

10 XPBS-MK buffer 100 mL: 10X 100ml PBS solution +0.2g MgCl₂·6H₂O +0.19g KCl, and dissolving;

PBS: weighing 8.0g NaCl, 0.2g KCl and 1.44g Na₂HPO₄、0.24g KH₂PO₄Dissolving in 800mL of distilled water, adjusting the solution to 7.4 by using HCl, finally adding distilled water to a constant volume of 1L, sterilizing at high pressure and storing at 4 ℃;

0.5% phenol red solution: weighing 0.1g of phenol red powder into 20mL of 50% ethanol, and heating for dissolving;

60% iodixanol stock solution: stem cell;

0.001％PF68：Sigma-Aldrich；

2X SYBR Green Mix Buffer：TransGen Biotech；

5 × loading buffer: 200mM DTT, 4% SDS, 100mM Tris-HCl pH 6.8, 0.2% bromophenol blue, 20% glycerol;

30% Acrylamide solution (Acr: Bis ═ 29: 1): 29g of acrylamide and 1g of methylenebisacrylamide were dissolved in a total volume of 60ml of water. Heating to 37 deg.C to dissolve it, and adding water to a final volume of 100 ml. Filtering and sterilizing by using a 0.45 micron filter, and then placing in a brown bottle to be stored at room temperature;

1M Tris-HCl pH 6.8: weighing 121.1g of Tris, placing the Tris in a 1000ml beaker, adding about 800ml of deionized water, fully stirring and dissolving, adding concentrated HCl to adjust the pH value to 6.8, fixing the volume of the solution to 1000ml, sterilizing at high temperature and high pressure, and storing at room temperature;

10% SDS: dissolving 100 g SDS (Sodium dodecyl sulfate crystals) in 900ml purified water, heating to 68 ℃ to dissolve SDS crystals, adding purified water to 1L volume, subpackaging and storing at room temperature;

10% APS: dissolving 0.5g APS in 5ml deionized water, and storing at 4 ℃ in a dark place;

TEMED：Thermo Fisher Scientific；

and (3) membrane transfer buffer solution: 24mM Tris, 20% methanol, 190mM glycine;

cellulose nitrate membrane: GE Healthcare;

1 × TBST: 50mL of Tris-HCL (1M, pH7.5), 8g of NaCl, 0.2g of KCL and 0.5mL of Tween, and adding distilled water to a constant volume of 1L;

CAP primary antibody: american Research Products;

ECL reaction solution: thermo Fisher Scientific;

3% chloral hydrate anesthetic solvent: adding 3g of chloral hydrate powder into 100mL of PBS buffer solution, mixing uniformly, and filtering and sterilizing through a 0.22 mu M filter;

30mg/ml Luciferase substrate working solution: adding 90mg of Luciferin powder into 3ml of LPSB buffer solution, mixing uniformly, filtering and sterilizing through a 0.22 mu M filter, and storing in a dark place;

genomic DNA Kit (RNase A-containing) Kit (EE 101-01): t isransgene corporation;

RIPA lysate: beijing Solaibao science and technology, Inc.;

4% paraformaldehyde: beijing Sorbao technologies, Inc.;

0.05% Triton X-100 solution: Sigma-Aldrich; BSA: beijing Baiolai Boke technology, Inc.;

anti-fluorescence quenching mounting liquid: invitrogen.

Example 1

After the 558 th site of the AAV9 capsid protein sequence (AAV9 wild type capsid protein VP1 amino acid sequence SEQ ID NO: 2, AAV9 wild type capsid protein VP1 DNA sequence SEQ ID NO: 3), a specific sequence (amino acid sequence SEQ ID NO: 4, DNA sequence SEQ ID NO: 5) is inserted at a fixed point, and the specific steps are as follows:

(1) designing a pair of primers containing a specific insertion sequence, wherein the sequence of the primer is SEQ ID NO: 11 (sequence CACCAGAGTGCCCAATGGCCCACCAGCTACGACGCCGCACAGGCGCAGACC), and the sequence of the rear primer is SEQ ID NO: 12 (sequence is

GGTCTGCGCCTGTGCGGCGTCGTAGCTGGTGGGCCATTGGGCACTCTGGTG)；

(2) Insert was specified at specific positions using PCR technology, the reaction system is shown in Table 1, and the reaction procedure is shown in Table 2:

TABLE 1 PCR reaction System

TABLE 2 PCR reaction procedure

(4) Adding 1 mu L of DpnI enzyme into the PCR product to digest the original PCR template with methylation sites, and placing the template at 37 ℃ for digestion for 3 h;

(5) and (3) taking 5 mu L of enzyme digestion product for transformation, selecting colonies and shaking for a little to obtain the AAV9 virus vector inserted with a specific sequence, and obtaining the AAV9 virus vector with the amino acid sequence of SEQ ID NO: 6. the DNA sequence is SEQ ID NO: 7.

example 2

The method comprises the following steps of mutating H527 of an AAV9 virus vector inserted with a specific sequence into Y, R533 mutation site S:

(1) designing a pair of primers containing target mutation sites, wherein the sequence of the primer is SEQ ID NO: 13 (sequence CCTGCTATGGCCAGCCGCAAAGAAGGAGAGGACCGATTCTTTCCTTTGTCT), and the sequence of the rear primer is SEQ ID NO: 14 (sequence AGACAAAGGAAAGAATCGGTCCTCTCCTTCTTTGCGGCTGGCCATAGCAGG);

(2) the PCR technology is utilized to amplify the mutant fragment, and the reaction system and the procedure are the same as the example 1;

(3) adding 1 mu LDpnI enzyme into the PCR product, uniformly mixing, and digesting for 3h at 37 ℃;

(4) taking 5 mu L of enzyme digestion product for transformation, picking colonies and shaking for a short time to obtain the mutant AAV9 virus vector (amino acid sequence SEQ ID NO: 8, nucleic acid sequence SEQ ID NO: 9) inserted with a specific sequence.

Example 3

The method is characterized in that a promoter of a target gene on a mutant AAV9 viral vector inserted with a specific sequence is replaced by a hSyn promoter, and the method comprises the following steps:

(1) designing a primer according to the hSyn promoter sequence, wherein the sequence of the primer is SEQ ID NO: 15 (sequence CAGAAGCTTAGTGCAAGTGGGTTTTAG), and the sequence of the rear primer is SEQ ID NO: 16 (sequence CAGCTCGAGCTGCGCTCTCAGGCACGA);

(2) the hSyn promoter (hSyn promoter sequence is SEQ ID NO: 10) was amplified by PCR with the reaction system as in Table 1 and the reaction program as in Table 3 (verify if the tables represent the operating steps):

TABLE 3 PCR reaction procedure

(3) Carrying out agarose gel electrophoresis with the concentration of 1% on the PCR amplification product, and carrying out gel cutting and recovery on a single and brighter PCR strip;

(4) selecting restriction enzymes Hind III and Xba I to perform enzyme digestion on the recovered DNA fragment and AAV vector, performing enzyme digestion in water bath at 37 ℃ for 2-3h, observing the enzyme digestion effect by agarose gel electrophoresis after enzyme digestion, and recovering the target fragment for subsequent experiments;

(5) connecting the PCR product after enzyme digestion with an AAV virus vector, wherein the ratio of the vector to the DNA fragment influences the connection efficiency, generally speaking, the molar ratio of the vector to the DNA fragment is 1: 3-1: 8, and the connection reaction is as follows: taking a proper amount of PCR product and a proper amount of vector, adding 2 mu L of 10 Xligation buffer, adding 1 mu L T4 DNA ligase, ddH₂Supplementing O to 20 mu L, setting the temperature of the metal bath to 16 ℃, and placing the connection reaction liquid in the metal bath for connection for 16 h;

(6) and (4) all the connection products are used for transformation, and colonies are picked and shaken for a short time to obtain the AAV vector containing the hSyn promoter.

Example 4

Transformation of various plasmids and extraction of plasmid DNA

(1) Adding 2 μ L AAV plasmid containing hSyn promoter, pAAV9 plasmid and pAAV9.7YS plasmid into 100 μ L competent Escherichia coli;

(2) standing on ice for 30min, performing heat shock at 42 deg.C for 40s, and rapidly standing on ice for 2min after heat shock is finished;

(3) adding pre-cooled 500 μ L of non-resistant LB culture medium, and culturing for 1h at 37 ℃ with a shaking table at 220 rpm;

(4) centrifuging at 3000rpm for 3min after recovery, precipitating bacteria, discarding part of supernatant, retaining about 80 μ L of culture medium, after resuspending Escherichia coli precipitation, uniformly coating on LB solid culture plate containing corresponding antibiotics with a coating rod, and performing inverted culture at 37 deg.C overnight;

(5) plasmid DNA was extracted using an endotoxin-free plasmid macroextraction kit provided by Tiangen Biochemical technology Ltd. The extracted plasmid was analyzed by agarose gel electrophoresis, and the result is shown in fig. 1, wherein the AAV9.7YS capsid protein plasmid is based on the AAV9 capsid protein plasmid, and the sequence SEQ ID NO: 3 and H527 to Y and R533 to S. Both plasmids were about 7.3kb, and agarose gel electrophoresis showed the plasmid size to be 7.3 kb. The quality of the extracted plasmid is better, the size of the plasmid is about 7.3kb, and the construction of the plasmid is correct.

Example 5

The AAV9-LUC (SEQ ID NO: 3) and AAV9.7YS-LUC virus packaging method comprises the following steps:

(1) HEK293T cells were cultured in DMEM medium with fetal bovine serum concentration of 10% and 5% CO at 37 deg.C₂The cells are collected and counted after being cultured to the logarithmic growth phase in the cell culture box. Inoculating in 10cm diameter cell culture dish with the inoculum size of 4 × 10⁶Continuously culturing the cells for 20 hours until the cell density is 80-90%;

(2) the HEK293T cells were replaced with fresh DMEM medium 2h before plasmid transfection;

(3) uniformly mixing pHelper of 10 mu g/dish, pAAV9 or pAAV9.7YS of 8 mu g/dish and core plasmid pAAV-LUC of 6 mu g/dish, adding 500 mu L of DMEM medium for plasmid dilution, simultaneously diluting Neofect transfection reagent by 500 mu L of DMEM medium, and standing for 5min at room temperature;

(4) uniformly mixing the diluted plasmid and transfection reagent suspension, and standing for 20min at room temperature;

(5) taking out HEK293T cells from the cell incubator, dropwise adding the transfection working solution into the cells, shaking in a cross shape, uniformly mixing, and placing the cells in the cell incubator for continuous culture;

(6) after 16-24h, the culture solution is changed gently, and the culture is continued;

(7) collecting cell culture solution after 72h, collecting adherent cells by using a cell shovel, centrifuging at 1000rpm for 10min, and collecting the cell sediment at-80 ℃ for later use if downstream experiments are not performed immediately;

(8) mixing the centrifuged supernatant with PEG8000 solution, standing at 4 deg.C for 12-16h to precipitate virus in the culture medium supernatant, centrifuging at 3000rpm for 90min, and resuspending the precipitate with PBS;

(9) and (3) cracking the cell sediment by adopting a repeated freeze thawing method: placing the cell sediment in a refrigerator at minus 80 ℃, then quickly transferring to a water bath at 37 ℃ to melt the cell sediment, if necessary, shaking by a shaking instrument to fully crack the cell, wherein each round of shaking is about 15min, and repeatedly freezing and thawing for 3 times to collect the virus released by the cell;

(10) combining the AAV obtained in the steps (9) and (10), adding a totipotent nuclease to make the concentration of the AAV to be 50U/mL, and digesting for 2h at 37 ℃;

(11) centrifuging at room temperature of 10000g for 10min, transferring the supernatant to a new 4ml centrifuge tube in a biosafety cabinet to obtain crude AAV9-LUC and AAV9.7YS-LUC virus extracts.

Example 6

The purification method of AAV9-LUC and AAV9.7YS-LUC virus crude extract in example 5 comprises the following steps:

(1) iodixanol solutions of different concentrations were prepared, and the formulation is given in table 5:

TABLE 5 iodixanol solution formulations at different concentrations

(2) Adding AAV9-LUC and AAV9.7YS-LUC virus crude extract into 10ml ultracentrifuge tube, and adding 0.001% PF 68;

(3) layering was performed in the following order: 3mL of a 15% iodixanol solution; 2mL of 25% iodixanol solution; 2mL of 40% iodixanol solution; 1mL of 60% iodixanol solution, and then supplementing liquid by using 1 XPBS-MK until the top of the tube is balanced;

(4) ultracentrifugation is carried out for 2h at 60000rpm and 18 ℃;

(5) carefully taking out the ultracentrifuge tube, carefully sucking out the colorless 40% iodixanol layer by using a syringe, and collecting the layer into a clean EP tube or a 15mL centrifuge tube to obtain the purified AAV9-LUC and AAV9.7YS-LUC viruses.

Example 7

The AAV9-LUC, AAV9.7YS-LUC virus ultrafiltration concentration, the concrete steps are as follows:

(1) adding iodixanol solution containing AAV9-LUC and AAV9.7YS-LUC virus collected in example 6 into an ultrafiltration centrifuge tube with molecular weight of 100KDA, adding PBS below the tube orifice, and mixing;

(2) centrifuging at 4000rpm and 4 deg.C for about 20 min;

(3) discarding the filtrate in a biological safety cabinet, putting the filtrate in a special waste liquid barrel, continuously adding 1XPBS into the ultrafiltration centrifugal tube below the tube orifice, and uniformly mixing;

(4) centrifuging at 4000rpm and 4 deg.C for about 15 min;

(5) repeating the step (3) and the step (4) for 1-2 times;

(6) repeatedly and uniformly blowing the residual liquid in the ultrafiltration tube by using a 200 mu L liquid transferring gun, transferring and subpackaging into a virus storage tube, and marking the name and the date. Long-term storage at-80 deg.C. Short term (no more than 1 week) storage may be at 4 ℃.

Example 8

The AAV9-LUC and AAV9.7YS-LUC virus titer determination method comprises the following steps:

(1) an ITR sequence on a virus core plasmid vector is selected to design a real-time fluorescent quantitative PCR primer, and the sequence of the primer is SEQ ID NO: 17(GGAACCCCTAGTGATGGAGTT), and the post-primer sequence is SEQ ID NO: 18 (sequence CGGCCTCAGTGAGCGA);

(2) AAV9-LUC and AAV9.7YS-LUC virus samples to be detected and standard quality ssAAV-EGFP are respectively used as template plasmids for real-time fluorescent quantitative PCR amplification, a real-time fluorescent quantitative PCR reaction system is shown in table 6, and reaction procedures are shown in table 7:

TABLE 6 real-time fluorescent quantitative PCR reaction system

TABLE 7 real-time fluorescent quantitative PCR reaction procedure

(3) The experimental data of real-time fluorescent quantitative PCR are substituted into the following formula for calculation:

copy number (copies/. mu.L) × concentration (ng/. mu.L) × 10^ (-9) × 6.02 × 10^ 23/base logarithm bp × 650;

wherein 6.02 x 10^23 is the Avogastrol constant, i.e., the number of molecules in 1mol of substance,

subsequently, the titer of AAV9-LUC and AAV9.7YS-LUC virus samples was calculated by setting lg value of genome copy number as X-axis and Ct value as Y-axis to construct a standard curve as shown in FIG. 2. The AAV virus titer is detected by adopting a real-time fluorescent quantitative PCR method, and the correlation coefficient R of a drawn standard curve²>0.99, the fitting degree is better. The titer of AAV9-LUC was 5.01X 10 by calculating the virus titer⁶AAV9.7YS-LUC Virus titer of 1.28X 10⁷Indicating that the engineered AAV9.7YS virus titer was not affected, AAV9.7YS could still be packaged into AAV virus and the titer was also higher than AAV9.

Example 9

The AAV9, AAV9.7YS virus capsid protein expression identification comprises the following steps:

(1) taking each AAV virus sample from the EP tube to a titer of 2 x 10^9vg, and adding PBS buffer to keep the volume and concentration of each sample consistent;

(2) adding 5 × loading buffer into each sample, uniformly mixing, heating at 100 ℃ for 5min, and immediately placing on ice or storing at-20 ℃ for later use;

(3) preparing a separation gel with 10% of acrylamide concentration and a concentrated gel with 5% of acrylamide concentration, wherein the formula of the separation gel is shown in Table 10, and the formula of the concentrated gel is shown in Table 11:

TABLE 10 Release glue formulations

TABLE 11 concentrated gum formulations

(4) Loading the sample by using a 20-mu-L pipette, and then carrying out polyacrylamide gel electrophoresis;

(5) adjusting the voltage to 80V, and after about 30min, the sample runs to the junction of the concentrated glue and the separation glue, and the pre-dyed protein Marker has 1-3 obvious strips with separated colors; the voltage was adjusted to 120V and electrophoresis was continued. Stopping electrophoresis when the 55KDa pre-dyed protein Marker strip is electrophoresed to the bottom edge of the gel, wherein the step is about 2 hours;

(6) adding a film-transferring buffer solution into an enamel disc special for transferring a film, and soaking the subsequent filter paper and the nitrocellulose membrane in the film-transferring buffer solution;

(7) the gel was carefully removed and fixed in the following order to form a sandwich: the whole process is carried out by ensuring that no air bubbles exist between layers so as to avoid the influence on membrane transfer;

(8) the power supply is correctly connected, the membrane is rotated for 2-2.5h by adopting constant current 300mA, and the membrane rotating device is placed in an ice-water mixture to ensure that the membrane rotating device is at low temperature in the whole membrane rotating process, so that unnecessary damage to a sample and the device is avoided;

(9) quickly taking out the nitrocellulose membrane after the membrane conversion is finished, putting the membrane into a small box containing 5% skimmed milk powder prepared by 1 xTBST to seal the non-specific binding sites, and incubating for 1h in a shaking table at room temperature;

(10) washing the membrane with 1 × TBST until no milk remains in the 1 × TBST buffer, about 3 min;

(11) adding CAP primary antibody with dilution ratio of 1: 3000, shaking table incubating at 4 deg.C overnight, the next day, and shaking table washing with 1 × TBST at room temperature for 3 times, each time for 10 min;

(12) adding a secondary antibody with the dilution ratio of 1: 3000, and incubating for 1h in a shaking table at room temperature;

(13) washing the membrane with shaking table at room temperature for 3 times (10 min each time);

(14) the development is carried out by using a chemiluminescence apparatus, the experimental result is shown in figure 3, the AAV9 and AAV9.7YS viruses are subjected to iodixanol density gradient centrifugation, Western blot is used for detecting AAV capsid proteins, the result shows that the VP antibody can identify AAV9 and AAV9.7YS capsid proteins, the AAV9 and AAV9.7YS viruses can clearly see three bands which respectively correspond to the AAV capsid proteins VP1, VP2 and VP3 and meet the typical characteristics of the AAV viruses, the modified AAV9.7YS capsid protein band is higher than the AAV9 capsid protein, and the modified AAV capsid protein is large in mass. The successful package and good purification effect of AAV9-LUC and AAV9.7YS-LUC viruses are proved.

Example 10

AAV9-LUC and AAV9.7YS-LUC viruses are injected into mice by tail vein injection, and the method comprises the following steps:

(1) fixing about 20g of mice on a mouse fixing table;

(2) aspirate 1X 10 with 1mL insulin syringe¹¹Vg AAV9-LUC and AAV9.7YS-LUC virus, which need to remove air, are injected into tail blood vessels of mice;

(3) after the injection was completed, the injection was stopped for 5 seconds, and after the needle was slowly withdrawn, the injection site was quickly pressed with a dry cotton ball, and then the mice were quickly returned to the cage and kept on.

Example 11

After the mouse is intravenously injected with the AAV9-LUC and AAV9.7YS-LUC viruses for 1 week, the distribution of the AAV9-LUC and AAV9.7YS-LUC viruses in the mouse can be observed by adopting an IVIS Spectrum small animal in-vivo imager, and the specific steps are as follows:

(1) weighing the weight of the mouse, and determining the specific dosage of Luciferin and 3% chloral hydrate according to the weight;

(2) generally speaking, the injection amount of the Luciferin is 1.5mg/10g, namely, 100 mu L of 30mg/mL Luciferase enzyme substrate working solution is injected into the abdominal cavity of a mouse with 20g of Luciferin;

(3) after 10min, the anesthetic was injected, typically in an amount of 0.1mL/10g, i.e., 20g, into the mouse, and 200. mu.L of 3% chloral hydrate anesthetic was intraperitoneally injected;

(4) small animal living body imaging can be carried out 10min after the substrate Luciferin is injected. The results are shown in FIG. 4, and the mouse in vivo imaging shows that the fluorescence signals of AAV9-LUC group mice mainly appear in the dorsal muscle and abdominal liver positions, the fluorescence signals of AAV9.7YS-LUC group mice mainly appear in the brain positions, and no fluorescence signals are seen in other tissues. The AAV9.7YS carrier can penetrate the blood brain barrier of mice more effectively, and the gene transduction efficiency is higher in the nervous system.

(5) After living body imaging of the mouse is finished, taking brain tissues of the mouse for tissue imaging, wherein an imaging result is shown in figure 5, and a figure A is that after living body imaging of the mouse is finished, two groups of brain tissues of the mouse are taken for tissue imaging, and the imaging result shows that AAV9.7YS groups of fluorescence signals are obviously higher than those of AAV9 groups, namely, AAV9.7YS-LUC groups of fluorescence signals in the brain tissues of the mouse are obviously higher than those of AAV9-LUC groups; quantitative analysis of fluorescence signals was performed, and the fluorescence signals of AAV9.7YS brains were significantly higher than those of AAV9 (n-3, P < 0.001).

Example 12

After AAV9-LUC and AAV9.7YS-LUC viruses are injected, mouse heart, liver, spleen, lung, kidney, muscle and brain tissues are taken, various tissue proteins are extracted, the activity of luciferase enzyme in various tissues is detected, and further, the distribution of AAV9-LUC and AAV9.7YS-LUC viruses in a mouse body can be evaluated, and the tissue tropism of AAV is judged. The method comprises the following specific steps:

(1) taking a tissue with the weight of about 100mg, and putting the tissue into an EP tube containing 1mL of PBS for cleaning;

(2) centrifuging at 3000rpm for 3 min;

(3) adding the precipitate into a homogenizing tube filled with 400 mu L of RIPA lysate, and adding 6 ceramic beads;

(4) placing into an electric homogenizer for homogenate: homogenate for 10s, rest for 10s, total 3 times. If large tissues still exist after 3 times of homogenate, 1-2 rounds of homogenate can be continuously carried out;

(5) the homogenized suspension was incubated on ice for 10min and mixed well in a shaker three times.

(6)12000rpm, centrifuging for 10 min;

(7) the supernatant was transferred to a new EP tube, and then the concentration of total mouse tissue protein was adjusted to be uniform at 25. mu.g/. mu.L for a total of 20. mu.L and added to the assay tube;

(8) preparing a fresh substrate working solution: diluting the Luciferin substrate by 50 times, mixing in a detection buffer solution, and storing in a dark place;

(9) in the dark room, the fluorescence detector was turned on. And respectively adding 50 mu L of substrate reaction solution into each tube of the measuring tube, quickly and uniformly mixing, and performing detection on a computer after 10 seconds to obtain the enzyme activity value of the Luciferase in each tissue and organ. The results are shown in fig. 6, major tissue organ proteins of mice in groups of AAV9 and AAV9.7YS were extracted, and the reporter gene was used for detecting the Luciferase activity in the tissues, and the results showed that the Luciferase activity in brain tissue of mice in group AAV9.7YS was about 55 times that of the AAV9 group, while the Luciferase activity in heart, liver spleen, kidney and skeletal muscle in group AAV9.7YS was significantly lower than that of AAV9 group (n ═ 3, × P <0.05, × P <0.001), and there was no significant difference between the two in lung tissue. The statistical difference is not obvious in lung tissue, and further shows that the modified AAV9.7YS virus has stronger capability of infecting the nervous system and lower infection efficiency on peripheral tissues (such as heart, spleen, liver and skeletal muscle).

Example 13

After AAV9-LUC and AAV9.7YS-LUC viruses are injected, tissues of heart, liver, spleen, lung, kidney, muscle, brain, spinal cord and the like of a mouse are taken, genome DNA of each tissue organ of the mouse is extracted, and the tissue distribution of the AAV viruses is judged by detecting the copy number of AAV9 and AAV9.7YS virus genomes in each tissue organ. The method comprises the following specific steps:

(1) about 25mg of mouse tissue is taken and used

Extracting Genomic DNA of mouse tissue by using Genomic DNA Kit (EE101-01) containing RNase A;

(2) the primer sequence of the conserved gene GAPDH sequence in the mouse genome is designed to be SEQ ID NO: 19CATCACTGCCACCCAGAAGACTG, the rear primer sequence is SEQ ID NO: 20 ATGCCAGTGAGCTTCCCGTTCAG; primer sequences for ITRs of AAV viruses were the same as those in example 8;

(3) using the extracted genome DNA of the mouse tissue as a template, respectively carrying out qPCR amplification on the GAPDH sequence and the ITR sequence, wherein the qPCR system and the reaction procedure are the same as those in the example 8;

(4) the copy number of AAV9 and AAV9.7YS virus genomes in each tissue organ of the mouse can be obtained according to the CT value obtained by amplification, the result is shown in figure 7, the mouse tissue genome is extracted, the AAV virus genome copy number in the mouse tissue is detected by a qPCR method, the AAV genome copy number in brain, heart, liver, spleen and kidney tissues has no significant difference, and AAV9.7YS groups in lung and muscle tissues are significantly lower than those of AAV9 groups (n is 3, P is <0.05, and P is < 0.001).

Sequence listing

<110> university of three gorges

<120> an AAV viral vector for nervous system drug delivery

<130>

<160> 20

<210> 1

<211> 5604

<212> DNA

<213> AAV viral vector

<400> SEQ ID NO：1

CACGGGCGCGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAGTCGAGAAACCGGCTAGAGGATCCTCTAGAGTCGACCTGCAGAAGCTTGCCACCATGGAAGATGCCAAAAACATTAAGAAGGGCCCAGCGCCATTCTACCCACTCGAAGACGGGACCGCCGGCGAGCAGCTGCACAAAGCCATGAAGCGCTACGCCCTGGTGCCCGGCACCATCGCCTTTACCGACGCACATATCGAGGTGGACATTACCTACGCCGAGTACTTCGAGATGAGCGTTCGGCTGGCAGAAGCTATGAAGCGCTATGGGCTGAATACAAACCATCGGATCGTGGTGTGCAGCGAGAATAGCTTGCAGTTCTTCATGCCCGTGTTGGGTGCCCTGTTCATCGGTGTGGCTGTGGCCCCAGCTAACGACATCTACAACGAGCGCGAGCTGCTGAACAGCATGGGCATCAGCCAGCCCACCGTCGTATTCGTGAGCAAGAAAGGGCTGCAAAAGATCCTCAACGTGCAAAAGAAGCTACCGATCATACAAAAGATCATCATCATGGATAGCAAGACCGACTACCAGGGCTTCCAAAGCATGTACACCTTCGTGACTTCCCATTTGCCACCCGGCTTCAACGAGTACGACTTCGTGCCCGAGAGCTTCGACCGGGACAAAACCATCGCCCTGATCATGAACAGTAGTGGCAGTACCGGATTGCCCAAGGGCGTAGCCCTACCGCACCGCACCGCTTGTGTCCGATTCAGTCATGCCCGCGACCCCATCTTCGGCAACCAGATCATCCCCGACACCGCTATCCTCAGCGTGGTGCCATTTCACCACGGCTTCGGCATGTTCACCACGCTGGGCTACTTGATCTGCGGCTTTCGGGTCGTGCTCATGTACCGCTTCGAGGAGGAGCTATTCTTGCGCAGCTTGCAAGACTATAAGATTCAATCTGCCCTGCTGGTGCCCACACTATTTAGCTTCTTCGCTAAGAGCACTCTCATCGACAAGTACGACCTAAGCAACTTGCACGAGATCGCCAGCGGCGGGGCGCCGCTCAGCAAGGAGGTAGGTGAGGCCGTGGCCAAACGCTTCCACCTACCAGGCATCCGCCAGGGCTACGGCCTGACAGAAACAACCAGCGCCATTCTGATCACCCCCGAAGGGGACGACAAGCCTGGCGCAGTAGGCAAGGTGGTGCCCTTCTTCGAGGCTAAGGTGGTGGACTTGGACACCGGTAAGACACTGGGTGTGAACCAGCGCGGCGAGCTGTGCGTCCGTGGCCCCATGATCATGAGCGGCTACGTTAACAACCCCGAGGCTACAAACGCTCTCATCGACAAGGACGGCTGGCTGCACAGCGGCGACATCGCCTACTGGGACGAGGACGAGCACTTCTTCATCGTGGACCGGCTGAAGAGCCTGATCAAATACAAGGGCTACCAGGTAGCCCCAGCCGAACTGGAGAGCATCCTGCTGCAACACCCCAACATCTTCGACGCCGGGGTCGCCGGCCTGCCCGACGACGATGCCGGCGAGCTGCCCGCCGCAGTCGTCGTGCTGGAACACGGTAAAACCATGACCGAGAAGGAGATCGTGGACTATGTGGCCAGCCAGGTTACAACCGCCAAGAAGCTGCGCGGTGGTGTTGTGTTCGTGGACGAGGTGCCTAAAGGACTGACCGGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGCAAGATCGCCGTGTAACTCGAGAGATCTACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTAACCACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCTTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACTCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGTCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTCCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCACGCGTTTAATTAAGTGTCTAGACTGCAGAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTCAGCACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTCCCGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGG

<210> 2

<211> 650

<212> PRT

<213> wild type AAV9 capsid protein VP1 amino acid sequence

<400> SEQ ID NO：2

MAADGYLPDWLEDNLSEGIREWWALKPGAPQPKANQQHQDNARGLVLPGYKYLGPGNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNSTSGGSSNDNAYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHEGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYEFENVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTINGSGQNQQTLKFSVAGPSNMAVQGRNYIPGPSYRQQRVSTTVTQNNNSEFAWPGASSWALNGRNSLMNPGPAMASHKEGEDRFFPLSGSLIFGKQGTGRDNVDADKVMITNEEEIKTTNPVATESYGQVATNHQSAQAQAQTGWVQNQGILPGMVWQDRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGMKHPPPQILIK

<210> 3

<211> 650

<212> DNA

<213> DNA sequence of wild-type capsid protein VP1 of AAV9

<400> SEQ ID NO：3

ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTTAGTGAAGGAATTCGCGAGTGGTGGGCTTTGAAACCTGGAGCCCCTCAACCCAAGGCAAATCAACAACATCAAGACAACGCTCGAGGTCTTGTGCTTCCGGGTTACAAATACCTTGGACCCGGCAACGGACTCGACAAGGGGGAGCCGGTCAACGCAGCAGACGCGGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAGGCCGGAGACAACCCGTACCTCAAGTACAACCACGCCGACGCCGAGTTCCAGGAGCGGCTCAAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAAAAGAGGCTTCTTGAACCTCTTGGTCTGGTTGAGGAAGCGGCTAAGACGGCTCCTGGAAAGAAGAGGCCTGTAGAGCAGTCTCCTCAGGAACCGGACTCCTCCGCGGGTATTGGCAAATCGGGTGCACAGCCCGCTAAAAAGAGACTCAATTTCGGTCAGACTGGCGACACAGAGTCAGTCCCAGACCCTCAACCAATCGGAGAACCTCCCGCAGCCCCCTCAGGTGTGGGATCTCTTACAATGGCTTCAGGTGGTGGCGCACCAGTGGCAGACAATAACGAAGGTGCCGATGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCCAATGGCTGGGGGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAATCACCTCTACAAGCAAATCTCCAACAGCACATCTGGAGGATCTTCAAATGACAACGCCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCTAAGCGACTCAACTTCAAGCTCTTCAACATTCAGGTCAAAGAGGTTACGGACAACAATGGAGTCAAGACCATCGCCAATAACCTTACCAGCACGGTCCAGGTCTTCACGGACTCAGACTATCAGCTCCCGTACGTGCTCGGGTCGGCTCACGAGGGCTGCCTCCCGCCGTTCCCAGCGGACGTTTTCATGATTCCTCAGTACGGGTATCTGACGCTTAATGATGGAAGCCAGGCCGTGGGTCGTTCGTCCTTTTACTGCCTGGAATATTTCCCGTCGCAAATGCTAAGAACGGGTAACAACTTCCAGTTCAGCTACGAGTTTGAGAACGTACCTTTCCATAGCAGCTACGCTCACAGCCAAAGCCTGGACCGACTAATGAATCCACTCATCGACCAATACTTGTACTATCTCTCAAAGACTATTAACGGTTCTGGACAGAATCAACAAACGCTAAAATTCAGTGTGGCCGGACCCAGCAACATGGCTGTCCAGGGAAGAAACTACATACCTGGACCCAGCTACCGACAACAACGTGTCTCAACCACTGTGACTCAAAACAACAACAGCGAATTTGCTTGGCCTGGAGCTTCTTCTTGGGCTCTCAATGGACGTAATAGCTTGATGAATCCTGGACCTGCTATGGCCAGCCACAAAGAAGGAGAGGACCGTTTCTTTCCTTTGTCTGGATCTTTAATTTTTGGCAAACAAGGAACTGGAAGAGACAACGTGGATGCGGACAAAGTCATGATAACCAACGAAGAAGAAATTAAAACTACTAACCCGGTAGCAACGGAGTCCTATGGACAAGTGGCCACAAACCACCAGAGTGCCCAAGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGACAGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACGGCAACTTTCACCCTTCTCCGCTGATGGGAGGGTTTGGAATGAAGCACCCGCCTCCTCAGATCCTCATCAAA

<210> 4

<211> 7

<212> PRT

<213> specific amino acid sequence

<400> SEQ ID NO：4

WPTSYDA

<210> 5

<211> 21

<212> DNA

<213> specific nucleic acid sequence

<400> SEQ ID NO：5

TGGCCCACCAGCTACGACGCC

<210> 6

<211> 657

<212> PRT

<213> AAV9 capsid protein amino acid sequence

<400> SEQ ID NO：6

MAADGYLPDWLEDNLSEGIREWWALKPGAPQPKANQQHQDNARGLVLPGYKYLGPGNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNSTSGGSSNDNAYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHEGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYEFENVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTINGSGQNQQTLKFSVAGPSNMAVQGRNYIPGPSYRQQRVSTTVTQNNNSEFAWPGASSWALNGRNSLMNPGPAMASHKEGEDRFFPLSGSLIFGKQGTGRDNVDADKVMITNEEEIKTTNPVATESYGQVATNHQSAQWPTSYDAAQAQTGWVQNQGILPGMVWQDRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGMKHPPPQILIK

<210> 7

<211> 1971

<212> DNA

<213> AAV9 capsid protein DNA sequence

<400> SEQ ID NO：7

ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTTAGTGAAGGAATTCGCGAGTGGTGGGCTTTGAAACCTGGAGCCCCTCAACCCAAGGCAAATCAACAACATCAAGACAACGCTCGAGGTCTTGTGCTTCCGGGTTACAAATACCTTGGACCCGGCAACGGACTCGACAAGGGGGAGCCGGTCAACGCAGCAGACGCGGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAGGCCGGAGACAACCCGTACCTCAAGTACAACCACGCCGACGCCGAGTTCCAGGAGCGGCTCAAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAAAAGAGGCTTCTTGAACCTCTTGGTCTGGTTGAGGAAGCGGCTAAGACGGCTCCTGGAAAGAAGAGGCCTGTAGAGCAGTCTCCTCAGGAACCGGACTCCTCCGCGGGTATTGGCAAATCGGGTGCACAGCCCGCTAAAAAGAGACTCAATTTCGGTCAGACTGGCGACACAGAGTCAGTCCCAGACCCTCAACCAATCGGAGAACCTCCCGCAGCCCCCTCAGGTGTGGGATCTCTTACAATGGCTTCAGGTGGTGGCGCACCAGTGGCAGACAATAACGAAGGTGCCGATGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCCAATGGCTGGGGGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAATCACCTCTACAAGCAAATCTCCAACAGCACATCTGGAGGATCTTCAAATGACAACGCCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCTAAGCGACTCAACTTCAAGCTCTTCAACATTCAGGTCAAAGAGGTTACGGACAACAATGGAGTCAAGACCATCGCCAATAACCTTACCAGCACGGTCCAGGTCTTCACGGACTCAGACTATCAGCTCCCGTACGTGCTCGGGTCGGCTCACGAGGGCTGCCTCCCGCCGTTCCCAGCGGACGTTTTCATGATTCCTCAGTACGGGTATCTGACGCTTAATGATGGAAGCCAGGCCGTGGGTCGTTCGTCCTTTTACTGCCTGGAATATTTCCCGTCGCAAATGCTAAGAACGGGTAACAACTTCCAGTTCAGCTACGAGTTTGAGAACGTACCTTTCCATAGCAGCTACGCTCACAGCCAAAGCCTGGACCGACTAATGAATCCACTCATCGACCAATACTTGTACTATCTCTCAAAGACTATTAACGGTTCTGGACAGAATCAACAAACGCTAAAATTCAGTGTGGCCGGACCCAGCAACATGGCTGTCCAGGGAAGAAACTACATACCTGGACCCAGCTACCGACAACAACGTGTCTCAACCACTGTGACTCAAAACAACAACAGCGAATTTGCTTGGCCTGGAGCTTCTTCTTGGGCTCTCAATGGACGTAATAGCTTGATGAATCCTGGACCTGCTATGGCCAGCCACAAAGAAGGAGAGGACCGTTTCTTTCCTTTGTCTGGATCTTTAATTTTTGGCAAACAAGGAACTGGAAGAGACAACGTGGATGCGGACAAAGTCATGATAACCAACGAAGAAGAAATTAAAACTACTAACCCGGTAGCAACGGAGTCCTATGGACAAGTGGCCACAAACCACCAGAGTGCCCAATGGCCCACCAGCTACGACGCCGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGACAGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACGGCAACTTTCACCCTTCTCCGCTGATGGGAGGGTTTGGAATGAAGCACCCGCCTCCTCAGATCCTCATCAAA

<210> 8

<211> 657

<212> PRT

<213> site-directed mutated AAV9 capsid protein amino acid sequence

<400> SEQ ID NO：8

MAADGYLPDWLEDNLSEGIREWWALKPGAPQPKANQQHQDNARGLVLPGYKYLGPGNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSAGIGKSGAQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNSTSGGSSNDNAYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHEGCLPPFPADVFMIPQYGYLTLNDGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYEFENVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTINGSGQNQQTLKFSVAGPSNMAVQGRNYIPGPSYRQQRVSTTVTQNNNSEFAWPGASSWALNGRNSLMNPGPAMASYKEGEDSFFPLSGSLIFGKQGTGRDNVDADKVMITNEEEIKTTNPVATESYGQVATNHQSAQWPTSYDAAQAQTGWVQNQGILPGMVWQDRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGMKHPPPQILIK

<210> 9

<211> 1971

<212> DNA

<213> site-directed mutated AAV9 capsid protein amino acid sequence

<400> SEQ ID NO：9

ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTTAGTGAAGGAATTCGCGAGTGGTGGGCTTTGAAACCTGGAGCCCCTCAACCCAAGGCAAATCAACAACATCAAGACAACGCTCGAGGTCTTGTGCTTCCGGGTTACAAATACCTTGGACCCGGCAACGGACTCGACAAGGGGGAGCCGGTCAACGCAGCAGACGCGGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAGGCCGGAGACAACCCGTACCTCAAGTACAACCACGCCGACGCCGAGTTCCAGGAGCGGCTCAAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAAAAGAGGCTTCTTGAACCTCTTGGTCTGGTTGAGGAAGCGGCTAAGACGGCTCCTGGAAAGAAGAGGCCTGTAGAGCAGTCTCCTCAGGAACCGGACTCCTCCGCGGGTATTGGCAAATCGGGTGCACAGCCCGCTAAAAAGAGACTCAATTTCGGTCAGACTGGCGACACAGAGTCAGTCCCAGACCCTCAACCAATCGGAGAACCTCCCGCAGCCCCCTCAGGTGTGGGATCTCTTACAATGGCTTCAGGTGGTGGCGCACCAGTGGCAGACAATAACGAAGGTGCCGATGGAGTGGGTAGTTCCTCGGGAAATTGGCATTGCGATTCCCAATGGCTGGGGGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAATCACCTCTACAAGCAAATCTCCAACAGCACATCTGGAGGATCTTCAAATGACAACGCCTACTTCGGCTACAGCACCCCCTGGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCTAAGCGACTCAACTTCAAGCTCTTCAACATTCAGGTCAAAGAGGTTACGGACAACAATGGAGTCAAGACCATCGCCAATAACCTTACCAGCACGGTCCAGGTCTTCACGGACTCAGACTATCAGCTCCCGTACGTGCTCGGGTCGGCTCACGAGGGCTGCCTCCCGCCGTTCCCAGCGGACGTTTTCATGATTCCTCAGTACGGGTATCTGACGCTTAATGATGGAAGCCAGGCCGTGGGTCGTTCGTCCTTTTACTGCCTGGAATATTTCCCGTCGCAAATGCTAAGAACGGGTAACAACTTCCAGTTCAGCTACGAGTTTGAGAACGTACCTTTCCATAGCAGCTACGCTCACAGCCAAAGCCTGGACCGACTAATGAATCCACTCATCGACCAATACTTGTACTATCTCTCAAAGACTATTAACGGTTCTGGACAGAATCAACAAACGCTAAAATTCAGTGTGGCCGGACCCAGCAACATGGCTGTCCAGGGAAGAAACTACATACCTGGACCCAGCTACCGACAACAACGTGTCTCAACCACTGTGACTCAAAACAACAACAGCGAATTTGCTTGGCCTGGAGCTTCTTCTTGGGCTCTCAATGGACGTAATAGCTTGATGAATCCTGGACCTGCTATGGCCAGCTACAAAGAAGGAGAGGACAGTTTCTTTCCTTTGTCTGGATCTTTAATTTTTGGCAAACAAGGAACTGGAAGAGACAACGTGGATGCGGACAAAGTCATGATAACCAACGAAGAAGAAATTAAAACTACTAACCCGGTAGCAACGGAGTCCTATGGACAAGTGGCCACAAACCACCAGAGTGCCCAATGGCCCACCAGCTACGACGCCGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGACAGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACGGCAACTTTCACCCTTCTCCGCTGATGGGAGGGTTTGGAATGAAGCACCCGCCTCCTCAGATCCTCATCAAA

<210> 10

<211> 448

<212> DNA

<213> hSyn

<400> SEQ ID NO：10

AGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTCAGCACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTCCCGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAG

<210> 11

<211> 51

<212> DNA

<213> Pre-primer sequence comprising specific insertion sequence

<400> SEQ ID NO：11

CACCAGAGTGCCCAATGGCCCACCAGCTACGACGCCGCACAGGCGCAGACC

<210> 12

<211> 51

<212> DNA

<213> rear primer sequence comprising specific insertion sequence

<400> SEQ ID NO：12

GGTCTGCGCCTGTGCGGCGTCGTAGCTGGTGGGCCATTGGGCACTCTGGTG

<210> 13

<211> 51

<212> DNA

<213> Pre-primer sequence comprising the site of the desired mutation

<400> SEQ ID NO：13

CCTGCTATGGCCAGCCGCAAAGAAGGAGAGGACCGATTCTTTCCTTTGTCT

<210> 14

<211> 51

<212> DNA

<213> rear primer sequence comprising the site of the desired mutation

<400> SEQ ID NO：13

AGACAAAGGAAAGAATCGGTCCTCTCCTTCTTTGCGGCTGGCCATAGCAGG

<210> 15

<211> 27

<212> DNA

<213> promoter Pre-primer sequence

<400> SEQ ID NO：15

CAGAAGCTTAGTGCAAGTGGGTTTTAG

<210> 16

<211> 27

<212> DNA

<213> post promoter primer sequence

<400> SEQ ID NO：16

CAGCTCGAGCTGCGCTCTCAGGCACGA

<210> 17

<211> 21

<212> DNA

<213> fluorescent quantitative PCR primer Pre-primer sequence

<400> SEQ ID NO：17

GGAACCCCTAGTGATGGAGTT

<210> 18

<211> 16

<212> DNA

<213> post-primer sequence of fluorescent quantitative PCR primer

<400> SEQ ID NO：18

CGGCCTCAGTGAGCGA

<210> 19

<211> 23

<212> DNA

<213> primer Pre-primer sequence of conserved gene GAPDH sequence

<400> SEQ ID NO：19

CATCACTGCCACCCAGAAGACTG

<210> 20

<211> 23

<212> DNA

<213> post-primer sequence of conserved gene GAPDH sequence

<400> SEQ ID NO：20

ATGCCAGTGAGCTTCCCGTTCAG

Claims (5)

1. An AAV viral vector, wherein the AAV capsid protein comprises a variant capsid protein of a modified sequence having the sequence of SEQ ID NO: 1;

the modification comprises inserting an amino acid sequence at the 588 th site of an AAV9 capsid protein amino acid sequence, mutating H527 of the AAV9 capsid protein amino acid into Y, mutating R533 into S, and passing through a gene expression vector of a hSyn promoter.

2. The AAV viral vector according to claim 1, wherein the inserted amino acid sequence at position 588 is SEQ ID NO: 2.

3. the AAV viral vector according to claim 1, wherein the hSyn promoter has the sequence of SEQ ID NO: 3.

4. a pharmaceutical composition comprising the AAV viral vector according to any of claims 1-3 and a pharmaceutically acceptable carrier.

5. The use of an AAV viral vector for the preparation of a medicament for delivering a drug to a neuronal cell involves a neurological disease selected from the group consisting of, but not limited to, multiple sclerosis, amyotrophic lateral sclerosis, ataxia-microvascular dilatation syndrome, Huntington's chorea, Ratt's syndrome, spinal muscular atrophy, spinocerebellar ataxia, tuberous sclerosis, congenital indolent anhidrosis, neurofibromatosis type II, Alexander's disease, stiff body syndrome, Joubert's syndrome, Pemery's disease, Charcmaire Tooth's disease, Kennedy's disease, familial amyloid polyneuropathy, Mobis syndrome, globuloleukodystrophy, Tagetian syndrome, neuroblastoma, polyneuroblastoma type I, schwannoma, Creutzfeldt-Jakob syndrome, infantile axonal dystrophy, hereditary spastic paraplegia, and neuroleptic paraplegia, Juvenile Parkinson, smog, corpus callosum hypoplasia, hypothalamic dysfunction syndrome, Aicardi-Goutieres syndrome.

Images