CN115850392A

CN115850392A - Adeno-associated virus mutant of capsid protein fusion cell penetrating peptide and application thereof

Info

Publication number: CN115850392A
Application number: CN202211189832.3A
Authority: CN
Inventors: 邵嘉红; 潘丽萍; 赵晓明; 吴相�; 谈鹏程; 荀婷君; 雷真真; 陆阳
Original assignee: Suzhou Jiheng Gene Technology Co ltd
Current assignee: Suzhou Jiheng Gene Technology Co ltd
Priority date: 2022-09-28
Filing date: 2022-09-28
Publication date: 2023-03-28

Abstract

The invention discloses an adeno-associated virus mutant of capsid protein fusion cell-penetrating peptide and application thereof. The invention also discloses an AAV capsid protein mutant or functional fragment thereof, wherein compared with the amino acid sequence of the parental or wild type AAV capsid protein, the amino acid sequence of the cell penetrating peptide is inserted into the amino acid sequence of the parental or wild type AAV capsid protein. The adeno-associated virus mutant fused with the cell-penetrating peptide of the capsid protein comprises the AAV capsid protein mutant or a functional fragment thereof. The cell-penetrating peptide is directly inserted into the AAV capsid protein in a fusion expression mode, and the cell-penetrating peptide is firmly fused in the AAV capsid protein, so that the AAV cell transfection capability and transduction efficiency can be obviously improved, the gene expression efficiency can be improved, the virus dosage can be reduced, the immunogenicity can be further reduced, and the application of the AAV virus gene vector in the related field of gene therapy can be promoted.

Description

Adeno-associated virus mutant of capsid protein fusion cell penetrating peptide and application thereof

Technical Field

The invention relates to an adeno-associated virus mutant of capsid protein fusion cell-penetrating peptide, in particular to the adeno-associated virus mutant of capsid protein fusion cell-penetrating peptide, and preparation production and application of a gene vector insect cell of the adeno-associated virus mutant based on the capsid protein fusion cell-penetrating peptide, belonging to the technical field of genetic engineering.

Background

Adeno-associated virus (AAV) as a gene vector has many advantages not possessed by other viral vectors and non-viral vectors: AAV is a non-pathogenic virus, low in immunogenicity to the body and broad in host range (Xie Q, bu W, bhatia S, et al, the atomic structure of adono-assisted viruses (AAV 2), a vector for human gene therapy [ J ]. Proceedings of the National Academy of Sciences of the United States of America,2002,99 (16): 10405-10, weitzman MD, linden RM.Adeno-assisted viruses biology [ J ]. Methods in molecular biology, 2011. Adeno-associated virus is a replication-defective virus belonging to the parvoviridae, the viral genome of which contains only one DNA strand, and the viral coat has an icosahedral structure (Martin KR, klein RL, et al. Gene delivery to the eye using an adeno-associated viral vector [ J ]. Methods.2002,28 (2): 267-275, samulski RJ, muzycza N.AAV-Mediated Gene Therapy for Research and Therapeutic purpos [ J ]. Annu Rev virol.2014, 1-451 Srivastava A. In vivo tissue-tissue of advanced-associated viruses [ J ]. Curr in Virol, 2016.21-80.

The virus gene vector is used as an advantageous vector for gene therapy, particularly the AAV gene vector has unique advantages which other virus vectors do not have, and is widely applied to biological medicines. AAV is used as a vector for gene therapy at present, and a technical problem in application is that the cell transduction efficiency is not high enough and the virus dosage is large.

The transduction efficiency of AAV on cells is an important factor for AAV application, and the main reasons for influencing the transduction efficiency are: firstly, the virus receptor on the surface of the cell membrane of the tissue determines that virus particles can not smoothly enter cells; secondly, after the virus is endocytosed to form inclusion bodies and enter tissue cells, whether the inclusion bodies escape from the inclusion bodies smoothly or not is identified by intracellular tyrosine kinase, capsid protein tyrosine is phosphorylated, and whether the inclusion bodies enter cell nuclei smoothly or not is determined. One way to increase the efficiency of AAV transduction is to increase the dose of AAV, but large doses may cause an immune response in the body and incur more costly treatment costs. At present, the commonly used methods for improving the transduction efficiency mainly comprise amino acid modification on the surface of AAV capsid, introduction of polypeptide fragment, action of protease inhibitor in vivo and the like (Satkunanathan S, thorpe R, ZHao Y. The function of DNA binding protein Nuclear in AAV reproduction [ J].Virology,2017,510:46-54；Berry GE,Asokan A.Cellular transduction mechanisms of adeno-associated viral vectors[J].Current opinion in virology,2016,21:54-60；Daya S,Berns KI.Gene therapy using adeno-associated viral vectors[J]Clin Microbiol Rev,2008,21 (4): 583-93). Cell-penetrating peptides (CPP), in generalAre small, basic polypeptides that have good ability to deliver biologically active substances, such as proteins, plasmids, liposomes, and viruses, into cells and tissues, without specific toxicity (Lin, C and Engbersen, JF. Effect of chemical functional peptides in proteins, J Control Release,2008,132, 267-272 Moreira, C, oliveira, H, pires, LR,

s, barbosa, MA and P E logo, AP.ImpropengChinese-mediated gene transfer by the interaction of intracellular buffer ring within the chitosan backbone biomaterial, 2009, 5; pack, DW, putnam, D and Langer, R.design of imidazole-containing endo biolymolyzers for gene delivery.Biotechnol Bioeng,2000, 67. The commonly used cell-penetrating peptides mainly comprise LAH4, antp, TAT-HA2 and the like. LAH4 is a preferred family of histidine-rich polypeptides, the complex of which forms an amphipathic helical conformation upon binding to the cell membrane.

Studies have shown that cell-penetrating peptides (CPPs) can first increase the entry of AAV particles into cells by promoting endocytosis of the cells; can also help AAV avoid recognition of intracellular tyrosine kinase, reduce phosphorylation level and reduce degradation by proteasome; furthermore, the histidines in such polypeptides of LAH4 are able to form specific conformations at acidic pH, escape recognition of lysosomes, and they bind more readily to lipid membranes with anions, and this helical peptide can perturb the lipid acyl chains, facilitating AAV escape inclusion, thereby significantly increasing the efficiency of AAV transduced cells (Liu Y, kim YJ, ji M, fang J, siriwon N, zhang LI, wang p. Engineering gene delivery of adeno-associated viruses by cell-permanent peptides. Mol instruments method close dev.2014 Feb 1. A method reported to date for promoting the efficiency of AAV transduction of cells by CPPs is to mix and incubate AAV virions and cell-penetrating peptides to form complexes.

There are a number of problems associated with the method of producing AAV virions and LAH4 complexes by physical incubation: firstly, the binding between the AAV virions and LAH4 is physically bound and is not stable enough, and a detachment condition can be generated when cells are transduced, so that the purpose of improving AAV transduction efficiency cannot be achieved, and the use risk can be caused; secondly, during incubation, the time can influence the binding rate to a great extent, and an incomplete binding state may exist; in addition, AAV is used in large amounts during incubation, and LAH4 requires additional synthesis, which all contribute to increased costs. It can be seen that the method for improving the transduction efficiency of AAV by combining virions and cell-penetrating peptides by physical incubation is very limited in application.

Disclosure of Invention

The invention mainly aims to provide an adeno-associated virus mutant of capsid protein fusion cell-penetrating peptide and application thereof, so as to overcome the defects in the prior art.

In order to achieve the purpose, the technical scheme adopted by the invention comprises the following steps:

the embodiment of the invention provides an AAV capsid protein mutant or a functional fragment thereof, wherein the AAV capsid protein mutant has an amino acid sequence of a cell penetrating peptide inserted in an amino acid sequence of a parental or wild type AAV capsid protein compared with the amino acid sequence of the parental or wild type AAV capsid protein.

The embodiments also provide an isolated polynucleotide comprising a nucleic acid sequence encoding the AAV capsid protein mutant or functional fragment thereof as described above.

The embodiments also provide a vector comprising the aforementioned isolated polynucleotide.

The embodiment of the invention also provides a host cell, which comprises the polynucleotide or the vector.

The embodiment of the invention provides an adeno-associated virus mutant of capsid protein fusion cell penetrating peptide, which comprises the AAV capsid protein mutant or functional fragments thereof.

The embodiment of the invention also provides a recombinant adeno-associated virion, which comprises:

AAV capsid protein mutants of the foregoing, or functional fragments thereof; and

an exogenous polynucleotide encoding an exogenous gene product.

The embodiment of the invention also provides a preparation method of the adeno-associated virus mutant of the capsid protein fusion cell-penetrating peptide, which comprises the following steps: constructing a recombinant baculovirus vector containing the separated polynucleotide, and producing the adeno-associated virus mutant of capsid protein fusion cell penetrating peptide by using a baculovirus-insect cell production system.

The embodiment of the invention also provides a pharmaceutical composition, which comprises the adeno-associated virus mutant of the capsid protein fusion cell penetrating peptide or the recombinant adeno-associated virion; and, a pharmaceutically acceptable excipient.

Compared with the prior art, the invention has the beneficial effects that:

the cell-penetrating peptide is directly inserted into the AAV capsid protein in a fusion expression mode, and the cell-penetrating peptide is firmly fused in the AAV capsid protein, so that the AAV entering proportion into the cell can be stably increased, the AAV cell transfection capability and transduction efficiency can be remarkably improved, the gene expression efficiency can be improved, the virus dosage can be reduced, and the immunogenicity can be further reduced. Compared with the prior art, the AAV and the cell-penetrating peptide are combined in an incubation mode, the invention is a fusion expression method, the combination rate of the cell-penetrating peptide and the AAV capsid protein is high, dissociation cannot occur, the fusion process is simple, and the cost is saved. The technology of the invention is beneficial to promoting the application of AAV virus gene vectors in gene therapy related fields.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the description of the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments described in the present invention, and it is also possible for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIGS. 1A-1B are maps of recombinant plasmids pFastbacanal-inCap 6-LAH4 and pFastbacanal-inCap 6, respectively, in example 1 of the present invention.

FIG. 2A is an SDS-PAGE electrophoresis of recombinant viral capsid proteins in example 1 of the present invention.

FIGS. 2B and 2C are graphs showing fluorescence microscope observation results and flow cytometry detection results of rAAV6-EGFP and rAAV6-LAH4-EGFP transfected HepG2 cells in example 1 of the present invention, respectively.

FIGS. 3A to 3D are graphs showing the fluorescence microscope observation result and the flow cytometry detection result of MSC of the wild type AAV transfected human umbilical cord blood mesenchymal stem cell in example 1 of the present invention, respectively.

FIGS. 4A to 4D are graphs showing fluorescence microscope observation results and flow cytometry detection results of wild type and mutant AAV-transfected human retinal pigment epithelial cells ARPE-19 in example 1 of the present invention, respectively.

FIGS. 5A to 5D are graphs showing fluorescence microscope observation and flow cytometry detection of wild type and mutant AAV-transfected human Burkitt's lymphoma cell line (Raji) in example 1 of the present invention, respectively.

FIGS. 6A to 6D are graphs showing fluorescence microscopic observation results and flow cytometry detection results of wild type and mutant AAV-transfected human acute T cell leukemia cell line (Jurkat) in example 1 of the present invention, respectively.

FIGS. 7A to 7D are graphs showing fluorescence microscopy and flow cytometry detection of wild-type and mutant AAV-transfected human primary T cells in example 1 of the present invention, respectively.

Detailed Description

As described above, in view of the defects of the prior art, the inventors of the present invention have made extensive studies and extensive practices to propose a technical solution of the present invention. The invention will be more fully understood from the following detailed description, which should be read in conjunction with the accompanying drawings. Detailed embodiments of the present invention are disclosed herein; however, it is to be understood that the disclosed embodiments are merely exemplary of the invention, which can be embodied in various forms. Therefore, specific functional details disclosed herein are not to be interpreted as limiting, but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed embodiment.

The following definitions of some of the terms mentioned in the present invention are to be construed:

"AAV" is an abbreviation for adeno-associated virus, and can be used to refer to the virus itself or derivatives thereof. Unless otherwise required, the term includes subtypes and naturally occurring and recombinant forms. The abbreviation "rAAV" refers to recombinant adeno-associated virus, also known as recombinant AAV vector (or "rAAV vector"). The term "AAV" includes AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. "Primate AAV" refers to AAV infecting primates, "non-primate AAV" refers to AAV infecting non-primate mammals, "bovine AAV" refers to AAV infecting bovine mammals, and the like.

As used herein, "rAAV vector" refers to an AAV vector comprising a polynucleotide sequence of non-AAV origin (i.e., a polynucleotide heterologous to AAV), typically a sequence of interest for genetic transformation of a cell. Generally, the heterologous polynucleotide is flanked by at least one, and typically two AAV Inverted Terminal Repeats (ITRs). The term rAAV vector encompasses rAAV vector particles and rAAV vector plasmids. rAAV vectors may be single stranded (ssAAV) or self-complementary (scAAV).

An "AAV virus" or "AAV viral particle" or "rAAV vector particle" refers to a viral particle composed of at least one AAV capsid protein (typically all capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, e.g., a transgene delivered to a mammalian cell), it is often referred to as a "rAAV vector particle" or simply as a "rAAV vector". Thus, production of rAAV particles necessarily includes production of rAAV vectors, as such vectors are contained within rAAV particles.

"packaging" refers to a series of intracellular events that lead to the assembly and encapsidation of AAV particles.

A "helper virus" of AAV refers to a virus that allows a mammalian cell to replicate and package AAV (e.g., wild type AAV). A variety of such helper viruses for AAV are known in the art, including adenovirus, herpesvirus, and poxvirus (e.g., vaccinia). Although adenovirus type 5 of subgroup C is most commonly used, adenoviruses encompass many different subgroups. Many adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as ATCC. Viruses of the herpes family include, for example, herpes Simplex Virus (HSV) and Epstein-Barr virus (EBV) as well as Cytomegalovirus (CMV) and pseudorabies virus (PRV); can also be obtained from depositories such as ATCC.

An "isolated" plasmid, nucleic acid, vector, virus, virosome, host cell or other substance refers to a preparation of a substance that is free of at least some other components that may be present in the substance or similar substance in nature or when originally prepared. Thus, for example, the isolated material can be prepared using purification counts to enrich it from the source mixture. The concentrate may be measured absolutely, e.g., weight per volume of solution, or may be measured relative to the second potentially interfering species present in the source mixture. More and more enrichments of embodiments of the disclosure are separated in stages.

As used herein, the terms "treat," "treating," and the like refer to obtaining a desired pharmacological and/or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or a symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or a side effect attributable to the disease. As used herein, "treatment" includes any treatment of a disease in a mammal (particularly a human) and includes: (a) Preventing the occurrence of a disease in a subject who may be susceptible to or at risk of developing the disease but has not yet been diagnosed as diseased; (b) inhibiting the disease, i.e. arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.

In the present invention, sequence Alignment, determination of percent Sequence identity and corresponding Sequence position can be performed according to some software known in the art, such as BLAST programs, CLUSTALW (http:// www.ebi.ac.uk/CLUSTALW /), MULTILIN (http:// pro. Toulouse.inra.fr/MULTALIN/cgi-bin/multalin.pl), or MUSCLE (Multiple Sequence Alignment), with default parameters indicated by these websites to probe (e.g., align) the obtained sequences. As used herein, the term "identity" or "percent identity" when used in relation to a particular pair of aligned amino acid sequences refers to the percentage of amino acid sequence identity obtained by counting the number of identical matches in the alignment and dividing such number of identical matches by the length of the aligned sequences.

As used herein, the terms "recombinant AAV vector", "recombinant AAV virus", "recombinant AAV virion", "recombinant AAV viral particle" or "AAV gene expression vector" are used interchangeably herein, and refer to an AAV virus encapsidated genomic DNA containing a heterologous nucleic acid. The vector may be deleted for the Rep and Cap genes in the genome and replaced with a heterologous polynucleotide expressing the gene of interest, which is then infected, transformed, transduced or transfected into a host cell to express the carried genetic material elements in the host cell. The vector may contain a number of elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, introns, kozak sequences, therapeutic genes, polyA sequences, selection elements, and reporter genes. In addition, the vector may further comprise an origin of replication.

For different therapeutic uses, the heterologous polynucleotides described herein (also referred to as "polynucleotides of interest") can encode a variety of gene products (also referred to as "gene products of interest"). Typically, such heterologous polynucleotides are located within a recombinant AAV vector, flanked by Inverted Terminal Repeat (ITR) regions. A variety of heterologous polynucleotides can be used in the present invention to produce recombinant AAV vectors for a variety of different applications. Such heterologous polynucleotides include, but are not limited to, for example, (i) polynucleotides suitable for use in gene therapy to alleviate a defect caused by a deletion, defect, or suboptimal level of a structural or functional protein; (ii) a polynucleotide transcribed into an antisense molecule; (iii) A polynucleotide that is transcribed into a decoy that binds a transcription or translation factor; (iv) Polynucleotides encoding cell regulators (e.g., cytokines); (v) Polynucleotides that sensitize the recipient cell to a particular drug (e.g., herpes virus thymidine kinase gene); (vi) Polynucleotides for use in cancer therapy, such as an E1A tumor suppressor gene or a p53 tumor suppressor gene for use in the treatment of various cancers; and (vii) a polynucleotide encoding a gene editing tool. To achieve expression of the gene product of interest in the recipient host cell, the polynucleotide may be operably linked to a promoter (either its own or a heterologous promoter). Many suitable promoters are known in the art, the choice of which depends on the level of expression of the desired polynucleotide of interest; whether constitutive expression, inducible expression, cell-specific or tissue-specific expression, etc., is desired. Recombinant AAV vectors may also contain a selectable marker.

The invention aims to provide an adeno-associated virus (AAV) mutant of capsid protein fused cell-penetrating peptides (CPPs), which is prepared in insect cells.

The technical solution, the implementation process and the principle thereof will be further explained with reference to the drawings.

An aspect of an embodiment of the invention provides an AAV capsid protein mutant or functional fragment thereof having an amino acid sequence of a cell penetrating peptide inserted in the amino acid sequence of a parental or wild type AAV capsid protein as compared to the amino acid sequence of the parental or wild type AAV capsid protein.

Further, the cell-penetrating peptide (e.g., LAH 4) has the amino acid sequence shown in SEQ ID NO.1 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto, the nucleotide sequence shown in SEQ ID NO.2 or a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto.

Furthermore, the cell-penetrating peptide can improve the AAV cell transduction capability and improve the gene expression efficiency. <xnotran> , LAH4, SEQ ID NO:1 , KKALLALALHHLAHLALHLALALKKAC, SEQ ID NO:2 , AAGAAGGCGTTATTGGCGCTTGCCCTCCATCACCTGGCCCACTTAGCACTTCACTTAGCCCTCGCATTAAAGAAAGCGTGC. </xnotran>

In some embodiments, the parental or wild-type AAV capsid protein comprises any one of, but not limited to, AAV capsid protein type 6, AAV capsid protein type 2.

Further, the AAV capsid protein mutant has the amino acid sequence shown in SEQ ID NO.10 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto, and the nucleotide sequence is shown in SEQ ID NO. 9.

An aspect of an embodiment of the invention also provides an isolated polynucleotide comprising a nucleic acid sequence encoding the AAV capsid protein mutant or a functional fragment thereof as described above.

An aspect of an embodiment of the present invention also provides a vector comprising the aforementioned isolated polynucleotide.

Further, the vector is selected from a shuttle vector, an expression vector or an integration vector, but is not limited thereto.

An aspect of an embodiment of the present invention also provides a host cell comprising the aforementioned polynucleotide or vector.

In one aspect of the embodiments of the present invention, there is also provided an adeno-associated virus mutant comprising a capsid protein fusion cell-penetrating peptide, wherein the mutant comprises the AAV capsid protein or a functional fragment thereof as described above.

An aspect of an embodiment of the present invention also provides a recombinant adeno-associated virion, comprising:

an AAV capsid protein mutant of the foregoing or a functional fragment thereof; and

an exogenous polynucleotide encoding an exogenous gene product.

Further, the exogenous polynucleotide has AAV ITR sequences at the 5 'and 3' ends.

Further, the exogenous polynucleotide further comprises at least one of a promoter sequence, an enhancer sequence, an intron, a polyA sequence, and a reporter gene.

One aspect of the embodiments of the present invention also provides a method for preparing an adeno-associated virus mutant of capsid protein fused cell penetrating peptide, which comprises: constructing a recombinant baculovirus vector containing the separated polynucleotide, and producing the adeno-associated virus mutant of capsid protein fusion cell penetrating peptide by using a baculovirus-insect cell production system.

In the present invention, the mode of producing recombinant AAV virus using a baculovirus-insect cell production system can be referred to documents such as "research on recombinant AAV (rAAV) baculovirus production system, reqin, university of chessmen, 2010-03-01".

The capsid protein fusion cell-penetrating peptide adeno-associated virus mutant is obtained by connecting the nucleic acid sequence of coding cell-penetrating peptide with the nucleic acid sequence of coding AAV capsid protein, and fusing and expressing.

Furthermore, the cell-penetrating peptide can improve the capability of AAV in transducing cells and improve the gene expression efficiency. <xnotran> , LAH4, SEQ ID NO:1 , KKALLALALHHLAHLALHLALALKKAC, SEQ ID NO:2 , AAGAAGGCGTTATTGGCGCTTGCCCTCCATCACCTGGCCCACTTAGCACTTCACTTAGCCCTCGCATTAAAGAAAGCGTGC. </xnotran>

In some preferred embodiments, it is obtained by ligating a nucleic acid sequence encoding LAH4 to a nucleic acid sequence encoding an AAV capsid protein, and fusion expressing.

In some preferred embodiments, it is obtained by inserting a nucleic acid sequence encoding LAH4 into the coding parental or wild-type AAV capsid protein at amino acid 139 and fusion expression.

Wherein the type 2 AAV capsid protein has the nucleotide sequence set forth in SEQ ID NO.13 or a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto; the type 2 AAV capsid protein has the amino acid sequence set forth in SEQ ID No.14 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

The adeno-associated virus mutant fused with the AAV capsid protein fusion cell-penetrating peptide type 2 has the nucleotide sequence shown in SEQ ID NO.15 or a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity therewith; an adeno-associated virus mutant of a type 2 AAV capsid protein fusion cell-penetrating peptide has the amino acid sequence shown in SEQ ID No.16 or an amino acid sequence with at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto.

Wherein the AAV capsid protein of type 6 has the nucleotide sequence set forth in SEQ ID NO 17 or a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto; the type 6 AAV capsid protein has the amino acid sequence set forth in SEQ ID No.18 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

The adeno-associated virus mutant fused with the AAV capsid protein fusion cell-penetrating peptide type 6 has the nucleotide sequence shown in SEQ ID No.19 or a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity therewith; adeno-associated virus mutants of AAV capsid protein type 6 fusion cell-penetrating peptides have the amino acid sequence shown in SEQ ID No.20 or an amino acid sequence with at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto.

The invention adopts an insect cell-baculovirus system to package adeno-associated virus mutant (hereinafter, may be referred to as AAV-cell-penetrating peptide mutant) of capsid protein fusion cell-penetrating peptide. Three plasmids (comprising the AAV genome, AAV mutant capsid proteins and AAV replication proteins, respectively) were constructed according to AAV packaging requirements. The skeletons of the three plasmids are all derived from pFastbacadual plasmid (purchased from invitrogen), namely, a target gene expression cassette is amplified by PCR and cut into a Multiple Cloning Site (MCS) of the pFastbacadual plasmid by enzyme.

The first plasmid involved in the present invention is plasmid pFastbacadual-inCap 6LA H4 encoding AAV6 mutant capsid protein. A nucleic acid sequence encoding LAH4 was ligated to a nucleic acid sequence encoding AAV capsid protein (Cap) by fusion PCR using pFastbdummy-Cap 6 plasmid as a template (Cao J, liu X, yuan Y, wang F, kong W, shi G, li W, zhang C. A rAAV2/6 Mutant with Enhanced Targeting for Mouse polypeptide cells. Curr Eye Res.2019 Aug 27 1-8).

In the invention, LAH4 is inserted into 139 th (but not limited to) amino acid of type 2 AAV (nucleotide sequence SEQ ID No.13, amino acid sequence SEQ ID No. 14) (nucleotide sequence SEQ ID No.15, amino acid sequence SEQ ID No.16 after fusion). The six primers used were: SEQ ID No.3 (specific sequence content is CAGAGAAGGCGTTATTGGCGCGCTTGCCCTCAGCAGCACAGACCCTGCCG), SEQ ID No.4 (specific sequence content is GCTGAGGGGCAAGCCAATAACGCCTTCTTGGAGATTGACTGCCACAGTC), SEQ ID No.5 (specific sequence content is GGAACAGGCCTATGGCTGCCGATGGTTATC) SEQ ID No.6 (the specific sequence content is GGAACAAGCTTTTACAGATTACAGATCGAGTCAGGAG), SEQ ID No.7 (the specific sequence content is GGGCAAGCCAATAACGCCTTCTTCCATCTTAACAGGTTTCCTCAACCAGG), and SEQ ID No.8 (the specific sequence content is TAGCCCTCGCCATTAAAAGAAAGCGTGCGCTCCGGGAAAAAAGGCCGGTAG). The second round PCR product was double-digested by StuI and HindIII into MSC of vector pFastbadual to obtain pFastbadual-Cap 2 LAH4.

In the invention, LAH4 is inserted into 139 th (but not limited to) amino acid of type 6 AAV (nucleotide sequence SEQ ID No.17, amino acid sequence SEQ ID No. 18) (nucleotide sequence SEQ ID No.19, amino acid sequence SEQ ID No.20 after fusion). The six primers used were: SEQ ID No.3, SEQ ID No.4, SEQ ID No.9 (specific sequence content is GGAACAGGCCTATGGCTGCCGATGGTTATC), SEQ ID No.10 (specific sequence content is GGAACAAGCTTTTACAGGGACGGGTGAGG), SEQ ID No.11 (specific sequence content is GGGCAAGCCAATAACGCCTTCATCTTTAGCACCTTCCTCCTCAACCAG), and SEQ ID No.12 (specific sequence content is GCCCTCGCCATTAAAAGCGTGCGCTCCTGGAAAAGAAACGTCCGGTAG). The second round PCR product was double-digested by StuI and HindIII into MSC of vector pFastbadual to obtain pFastbadual-Cap 6 LAH4.

The second plasmid related in the invention is AAV genome plasmid pFastbdual-ITR-EGFP, which comprises two inverted terminal repeat sequences (ITR) of AAV serotype 2 (AAV 2), and also comprises an exogenous gene expression cassette (comprising a promoter, an enhancer, an intron and a polyA sequence, and an exogenous gene expression cassette comprising a green fluorescent protein gene EGFP and the like) expressed in eukaryotic cells.

The third plasmid related in the invention is a plasmid pFastbinary-inrep for coding AAV replication protein (Rep), which comprises a Rep gene expression frame of AAV2, an intron sequence for enhancing expression and the like (Rizatamine and the like, AAV-ITR gene expression microcarrier prepared by insect cells, biological engineering report, 2015,31 (8), page 1232, and 'construction pFastbinary-ITR-EGFP plasmid' in the method 1.2.1).

The AAV gene vector involved in the invention is produced in insect cells:

firstly, respectively transforming escherichia coli DH10Bac competent cells of the three recombinant plasmids pFastbacanal-Cap 6 LAH 4/pFastbacanal-ITR-EGFP/pFastbacanal-inrep by a conventional method, screening the cells through two blue-white spots, selecting white cells to amplify, and extracting recombinant Bacmid-Cap6 LAH4/Bacmid-ITR-EGFP/Bacmid-inrep, wherein the cells containing the recombinant Bacmid are white, and the cells which are not recombined are blue.

Then, transfecting the three recombinant Bacmid-Cap6 LAH4/Bacmid-ITR-EGFP/Bacmid-inrep with an insect cell transfection reagent for 4-5 days respectively, collecting cell supernatant, and filtering the cell supernatant by using a 0.22 mu m filter to obtain P1 generation recombinant Baculovirus Baculovir-incCap 6 LAH 4/baculovir-ITR-EGFP/baculovir-inrep; and (3) carrying out twice infection on Sf9 cells by the P1 generation recombinant baculovirus and amplifying to obtain the P3 generation recombinant baculovirus. The titer of P3 generation baculovirus was determined by plaque assay, virus titer (pfu/mL) = 1/dilution x number of plaques x 1/volume of inoculation per well.

And finally, co-infecting Sf9 cells with three recombinant baculoviruses (Baculovir-Cap 6 LAH 4/Baculovir-ITR-EGFP/Baculovir-inrep) of the P3 generation, and packaging to obtain LAH4-rAAV6-EGFP.

And a method for purifying and concentrating high-concentration recombinant AAV by using a CsCl density gradient centrifugation method, a method for detecting LAH4-rAAV6-EGFP titer by using fluorescent quantitative PCR, and a method for detecting LAH4-rAAV6-EGFP purity by using SDS-PAGE.

In order to prove the universality of the method on different serotypes of AAV, pFastbacdual-Cap2 LAH4 is constructed according to the method, and LAH4-rAAV2-EGFP virus is packaged.

The embodiment of the invention also provides application of the adeno-associated virus mutant of the capsid protein fusion cell penetrating peptide or the recombinant adeno-associated virion in preparing gene therapy medicaments.

In another aspect of the embodiments of the present invention, there is provided a pharmaceutical composition comprising the above-described adeno-associated virus mutant or recombinant adeno-associated virion fused with a cell-penetrating peptide of capsid protein; and, a pharmaceutically acceptable excipient.

In yet another aspect, the present invention relates to a pharmaceutical composition comprising a recombinant adeno-associated virion (component i) as disclosed herein and a pharmaceutically acceptable carrier/excipient (component ii). In some embodiments, component i comprises 0.1 to 99.9wt%, preferably 10 to 99.9wt%, more preferably 70 to 99wt% of the total weight of the pharmaceutical composition. Further, such excipients, carriers, diluents and buffers include any agent that can be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, and ethanol. Which may include pharmaceutically acceptable salts such as mineral acid salts such as hydrochloride, hydrobromide, phosphate, sulphate and the like; and salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. In addition, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances and the like may be present in such vehicles. A wide variety of pharmaceutically acceptable excipients are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been described extensively in a variety of publications, including, for example, a. Gennaro (2000) "Remington: the Science and Practice of Pharmacy," 20 th edition, lippincott, williams, & Wilkins; edited by Pharmaceutical document Forms and Drug delivery systems (1999) H.C. Ansel et al, 7 th edition, lippincott, williams, & Wilkins; and handbook of Pharmaceutical Excipients (2000) A.H.Kibbe et al, 3 rd edition, amer.pharmaceutical Assoc.

In another aspect of the embodiments of the present invention, there is also provided a use of the above-described adeno-associated virus mutant fused with cell-penetrating peptide of capsid protein or pharmaceutical composition for highly efficient transduction of cells or expression of foreign genes.

The invention relates to AAV-cell-penetrating peptide mutant high-efficiency transduction cells and expression exogenous genes:

transfection of in vitro cells: inoculating a human retinal pigment epithelial cell line (ARPE-19) (an adherent cell line), a human Burkitt's lymphoma cell line (Raji) (a suspension cell line), a human umbilical cord blood Mesenchymal Stem Cell (MSC) (a primary adherent cell) and a human acute T cell leukemia cell line (Jurkat) (a primary suspension cell) into a 24-hole cell culture plate at a proper cell density, infecting cells with the same MOI through LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) and rAAV6-EGFP (rAAV 2-EGFP) wild-type viruses, observing by an inverted fluorescence microscope after 48h, detecting the proportion of the fluorescent cells through a flow cytometer, and repeating each group for at least three holes. And the LAH4-rAAV6-EGFP is verified to infect the in vitro cultured cells more efficiently than a wild type rAAV6-EGFP gene vector.

In conclusion, the Cell-penetrating peptides CPP (Cell penetrating peptides) are directly inserted into the AAV capsid protein in a fusion expression mode, and the Cell-penetrating peptides are firmly fused in the AAV capsid protein, so that the proportion of AAV entering the cells can be stably increased, the AAV Cell transfection capability and transduction efficiency can be remarkably improved, the gene expression efficiency can be improved, the virus dosage can be reduced, and the immunogenicity can be further reduced. Compared with the prior art, the AAV and the cell-penetrating peptide are combined in an incubation mode, the invention is a fusion expression method, the combination rate of the cell-penetrating peptide and the AAV capsid protein is high, dissociation cannot occur, the fusion process is simple, and the cost is saved. The technology of the invention is beneficial to promoting the application of AAV virus gene vectors in gene therapy related fields.

The technical solutions of the present invention are further explained below with reference to several preferred embodiments and the accompanying drawings, but the experimental conditions and the setting parameters should not be construed as limitations of the basic technical solutions of the present invention. And the scope of the present invention is not limited to the following examples. Unless otherwise specified, various reagents used in the following examples are well known to those skilled in the art and can be obtained by means of commercial sources and the like. However, the experimental methods in the following examples, in which specific conditions are not specified, are generally performed under conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or under the conditions recommended by the manufacturers.

Example 1

The specific method of the embodiment comprises the following steps:

1. preparation of pFastbacadual-Cap 6-LAH4 recombinant plasmid vector

A nucleotide sequence encoded by LAH4 was inserted into the Cap6 sequence by a fusion PCR method using pFastbacual-inCap 6 plasmid as a template (Cao J, liu X, yuan Y, wang F, kong W, shi G, li W, zhang C. A rAAV2/6 Mutant with Enhanced Targeting for Mouse returned Muller cells. Curr Eye Res.2019 Aug 27.

The LAH4 double-stranded template is obtained by annealing the long primers LAH4-F1 and LAH4-R1 (SEQ 3 and SEQ 4).

The upstream sequence PCR primers of the insertion sites are AAV6-StuI-F (SEQ 9) and AAV6-LAH4-R2 (SEQ 11), and the downstream sequence PCR primers are AAV6-LAH4-F2 (SEQ 12) and AAV6-HindIII-R (SEQ 10).

The final fusion product is obtained by amplifying the three products through AAV6-StuI-F (SEQ 9) and AAV6-HindIII-R (SEQ 10).

1. preparation of pFastbacadual-Cap 2-LAH4 recombinant plasmid vector

The nucleotide sequence encoded by LAH4 is inserted into the Cap2 sequence by fusion PCR method using pFastbacdual-inCap2 plasmid as template.

The upstream sequence PCR primers of the insertion sites are AAV2-StuI-F (SEQ 5) and AAV2-LAH4-R2 (SEQ 7), and the downstream sequence PCR primers are AAV2-LAH4-F2 (SEQ 8) and AAV2-HindIII-R (SEQ 6).

The final fusion product is obtained by amplifying the three products through AAV6-StuI-F (SEQ 5) and AAV6-HindIII-R (SEQ 6).

2. Preparation of recombinant bacmid

The three recombinant plasmids in the last step are respectively used for preparing recombinant Bacmid, and the specific method is as follows:

(1) 100 μ L of DH10Bac was slowly thawed on ice.

(2) Add 50ng plasmid DNA and mix gently.

(3) Standing on ice for 30min, heat shocking at 42 deg.C for 90s, immediately transferring to ice and standing for 2min.

(4) Add 900. Mu.L of SOC medium and shake at 37 ℃ and 225rpm for 4h.

(5) mu.L of 2% (20 mg/mL) Blue-gal and 7. Mu.L of 20% (200 mg/mL) IPTG were added dropwise to the center of a prepared 90mm agar plate containing 50. Mu.g/mL kanamycin (Kan), 7. Mu.g/mL gentamicin (Gen), 10. Mu.g/mL tetracycline (Tet). The plates were spread over the entire surface using a sterile spreader and incubated at room temperature until all liquid disappeared.

(6) Cells (10-1, 10-2, 10-3) were diluted in SOC medium in 10-fold gradients, and 100. Mu.L of each gradient was plated on LB plates.

(7) After 48h at 37 ℃ 10 white colonies were picked and dipped on fresh LB agar plates (resistant as above) overnight at 37 ℃. The confirmed white spots were picked and inoculated into LB liquid medium (containing 50. Mu.g/mL kanamycin (Kan), 7. Mu.g/mL gentamicin (Gen), 10. Mu.g/mL tetracycline (Tet)).

(8) The mixture was left overnight at 4 ℃ to allow the blue color to develop sufficiently during this period.

(9) Sf9 can be transfected after the correct PCR identification can be performed for white spots.

(10) Extracting and separating recombinant bacmid DNA by using an OMEGA kit, and measuring the concentration of bacmid by the experimental method according to the kit specification, subpackaging and freezing at-20 ℃ to avoid repeated freezing and thawing.

(11) And (3) PCR identification of Bacmid, wherein the used primers are respectively as follows: an upstream primer of 5.

(12) The correctly identified Bacmid strain is taken out and inoculated in 3mL LB (Kan +, gen +, tet +) shake bacteria according to the proportion of 1. Then inoculating the strain into 150mL LB (Kan +, gen +, tet +) shake bacteria for 16h according to the proportion of 1.

3. Preparation of recombinant baculovirus

(1) Sf9 cell culture. Sf9 cells were plated in six well plates one day in advance, 50% well density, complete medium used, 95% viability. The recombinant Bacmid DNA was incubated in a 70 ℃ water bath for 20min, and centrifuged at 12000g for 10min to obtain the supernatant.

(2) And (5) plating cells.

Ensuring the cell density to be 1.5-2.5 multiplied by 10 ⁶ cells/mL were manipulated (medium without antibiotics). Add 2mL basal (Grace) medium without additives (no antibiotics and serum) to 6-well plates. Inoculation 8X 10 ⁵ cells/mL Sf9 in step 1 (medium not changed and cells washed) and cells allowed to adhere for 15min at room temperature.

(3) And (4) preparing a transfection reagent.

a) Transfection reagent II was mixed well, 8. Mu.L to 92. Mu.L basal medium without additives (without antibiotics and serum) was added and vortexed.

b) Take 5. Mu.L bacmid DNA (500 ng/. Mu.L, ensuring the bacmid amount to be 2-3. Mu.g) to 95. Mu.L basal medium without additives (containing no antibiotics and serum), mix gently.

c) Mixing the above two solutions, and incubating at room temperature for 30min.

(4) The above DNA-Lipid mixture was added dropwise to the wells plated with cells, and the cells were incubated at 27 ℃ for 5 hours.

(5) The plate medium was removed and replaced with 2mL of complete medium.

(6) After incubation at 27 ℃ for 72h, signs of viral infection were observed.

Separation P1:

after confirming that the cells are in a late stage of infection (usually 4-5 days after transfection), 2mL of virus-containing medium per well was collected into a sterile 15mL centrifuge tube and centrifuged at 1000g for 5min to remove cell debris.

The supernatant was filtered through a 0.22 μm filter into a sterile 15mL centrifuge tube and stored at 4 ℃ in the dark. If long-term storage is desired, subpackaging and freezing at-80 ℃.

And (3) virus amplification:

taking 10mL suspension culture cells with MOI of 0.05-0.1 and density of 2 x 10 ⁶ cell/mL; or cells in 6-well plates at a density of 2X 10 ⁶ Cells/well, calculate the required P1 volume.

(1) Sf9 cells plated in six-well plates, 2X 10 ⁶ Cells/well. The plate was left at room temperature for 1 hour to adhere and observed under a microscope.

(2) Adding a proper amount of P1 into each hole, and culturing at 27 ℃ for 48-72 h.

(3) 2mL of virus-containing medium was collected per well in a sterile 15mL centrifuge tube and centrifuged at 1000g for 5min.

(4) The supernatant was transferred to a sterile 15mL centrifuge tube and the viral supernatant was P2. Storing at 4 deg.C in dark place, and freezing at-80 deg.C if long-term storage is desired.

(5) P3 can be amplified as described above (typically resulting in P1 virus titers of 1X 10 ⁶ ～1×10 ⁷ P2 titre between 1X 10 ⁷ ～1×10 ⁸ In between).

Viral titers were determined by plaque assay. The detailed experimental procedure is as follows:

(1) 2 mL/well cell (5X 10) ⁵ cells/mL) were seeded in 6-well plates, incubated at room temperature for 1h to adhere to the wall, and the degree of adherence was examined under a microscope after incubation.

(2) 4% agarose gel is put into a 70 ℃ water bath kettle for melting, and 2 XGrace and a 100mL sterile bottle are put into a 40 ℃ water bath kettle for preheating.

(3) Baculovirus was diluted in a gradient with serum-free basal medium: 10 ^-1 ～10 ^-8 。

(4) The supernatant in the 6-well plate is discarded, the diluted virus is rapidly added, and the mixture is incubated for 1h at room temperature in 1 mL/well (multiple wells).

(5) Preparing upper agar, adding 20mL of high-temperature inactivated FBS to 2 XGrace 100mL,25mL of 2 XGrace (containing FBS) +12.5mL of sterile water +12.5mL of 4% agarose gel, pouring into a preheated 100mL sterile bottle, gently mixing, and placing into a water bath kettle at 37 ℃ for later use.

(6) Discarding the supernatant in the 6-well plate, quickly adding 2mL of upper agar to prevent the bacterial layer from drying, and standing for 10-20 min to solidify. The 6-well plate was placed in an incubator at 27 ℃ and cultured for 5 days.

(7) Prepare 1mg/mL neutral red solution, in the basic complete medium, sterile filtration.

(8) 1.5mL of the above solution, 16.5mL of basal complete medium, 6mL of 4% agar was prepared as neutral red top agar.

(9) 4 days after viral infection, 1mL of neutral red top agar was added.

And (3) putting the protein at the red spot into an incubator for 4-5 days to observe the plaques, counting the number of the plaques and solving the virus titer.

Note: viral titer (pfu/mL) = 1/dilution factor × number of plaques × 1/inoculation volume per well

4. LAH4-rAAV6-EGFP virus packaging and purification

Three baculoviruses, namely, baculovir-inCap 6-LAH4, baculovir-inRep (AAV replication protein Rep required for expression and packaging) and Baculovir-ITR-EGFP are used for co-infecting insect cells Sf9, and the cells are collected after 72h. The supernatant medium was discarded and the cells were harvested by pipetting with 4 ℃ precooled PBS. Placing at-80 deg.C for 30min, placing in water bath at 37 deg.C for 30min, repeatedly freezing and thawing for three times, and fully lysing cells to release virus. And purifying and concentrating rAAV virus by CsCl density gradient centrifugation.

5. Purity detection and titer determination of LAH4-rAAV6-EGFP virus

The purity of rAAV virus is detected by SDS-PAGE, and the specific method is as follows:

1) Preparing glue: 10% separation gel (5 mL/plate): ddH ₂ O1.3 mL, 1.7mL of a 30% acrylamide mixture (29.

5% concentrated gum (2 mL/plate): ddH ₂ O1.4 mL, 0.33mL of a 30% acrylamide mixture (29.

2) Preparing glue: respectively mixing separating gel and concentrated gel, filling gel into mould, and adding ddH ₂ O detecting leakage, pouring into ddH ₂ O, adding a separating gel to about 3/4, and ddH ₂ Filling O with spreading separating gel, pouring ddH after the gel is solidified ₂ And O, adding concentrated glue, fully spreading, inserting the comb teeth, and carefully pulling out the comb teeth after the comb teeth are solidified by gelling.

3) Sample adding electrophoresis: putting the gel plate in an electrophoresis tank, adding a fresh electrophoresis buffer solution, adding a sample into 4 × loading buffer, boiling for 10min, and respectively loading 5 μ L Marker, 12 μ L sf9 cell lysate and 12 μ L purified virus after treatment. The voltage is adjusted to 60V, electrophoresis is carried out until the band runs through the concentrated gel, and then the voltage is adjusted to 120V until the bromophenol blue band runs out of the gel plate.

4) And (3) dyeing and decoloring by using Coomassie brilliant blue: carefully peeling off the gel from the gel plate, removing the concentrated gel, adding Coomassie brilliant blue R-250 staining solution, staining for 1h, recovering the staining solution, and treating with ddH ₂ And O rinsing for decoloration until clear strips appear.

The titer of the rAAV virus is detected by adopting fluorescent quantitative PCR, and the specific method comprises the following steps:

1) Making a standard curve: sample copy number (copies/. Mu.L) = sample concentration (ng/. Mu.L). Times.10 ^-9 ×6.02×10 ²³ X 2/(base number bp x 648) of the sample, calculating the required plasmid concentration, as 10 ⁸ 、10 ⁷ 、10 ⁶ 、10 ⁵ Copy number gradient dilution.

2) Virus pretreatment: purifying the virus, treating with DNAse at 37 deg.C for 30min, denaturing at 96 deg.C for 10min, adding proteinase K at 56 deg.C for 1h, and denaturing at 96 deg.C for 10min to release virus DNA.

3) And (3) performing fluorescent quantitative PCR detection, wherein the reaction system is as follows, and the standard substance and the sample are repeated for three times.

The PCR reaction procedure was as follows:

the virus sample copy number was calculated by the fluorescent quantitative PCR instrument software.

6. LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) in vitro transfected cells

LAH4-rAAV6-EGFP transfection human liver cancer cell line HepG2: hepG2 cells were seeded in 24-well plates and when the cell density reached 70-80%, LAH4-rAAV6-EGFP was infected at the MOI 1E5 ratio, while cells were infected with wild-type rAAV6-EGFP at the same number of virus particles as a control. And (5) after 48 hours, inverting the fluorescent microscope for observation, and detecting the proportion of the fluorescent cells by using a flow cytometer. Please refer to fig. 2B and fig. 2C, which are graphs showing the fluorescent microscope observation result and the flow cytometry detection result of HepG2 cells transfected by rAAV6-EGFP (i.e. wild-type 6) and rAAV6-LAH4-EGFP (i.e. mutant 6) in this example.

LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) transfects human retinal pigment epithelial cell line (ARPE-19): ARPE-19 cells were seeded in 24-well plates and when cell density reached 70-80%, LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) was used to infect adherent ARPE-19 cells at MOI 3E4/1E4 ratio, while cells were infected with wild type rAAV6-EGFP at the same number of virus particles as a control. And (5) after 48h, inverting the fluorescent microscope for observation, and detecting the proportion of the fluorescent cells by using a flow cytometer. Please refer to fig. 4A and 4B, which show the fluorescence microscope observation results and flow cytometry detection results of the rAAV6-EGFP (i.e., wild-type 6) and rAAV6-LAH4-EGFP (i.e., mutant 6) transfected human retinal pigment epithelial cells ARPE-19 in this example. Please refer to fig. 4C and 4D, which show the fluorescence microscope observation results and flow cytometry detection results of the transfection of Raav2-EGFP (i.e., wild-type 2) and Raav2-LAH4-EGFP (i.e., mutant 2) into human retinal pigment epithelial cells ARPE-19 in this example.

LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) transfects human umbilical cord blood Mesenchymal Stem Cells (MSC): MSC inoculated into 24-well plate, when cell density reached 70-80%, rAAV6-LAH4-EGFP (LAH 4-rAAV 2-EGFP) was infected at MOI 1E5 ratio, and cells were infected with wild type rAAV6-EGFP at the same virus particle number as control. And (5) after 48h, inverting the fluorescent microscope for observation, and detecting the proportion of the fluorescent cells by using a flow cytometer. Please refer to fig. 3A and fig. 3B, which show the fluorescence microscope observation results and the flow cytometry detection results of the human umbilical cord blood mesenchymal stem cell MSC transfected by rAAV6-EGFP (i.e. wild type 6) and rAAV6-LAH4-EGFP (i.e. mutant 6) in this example. Please refer to fig. 3C and fig. 3D, which show the fluorescence microscope observation results and the flow cytometry detection results of the human umbilical cord blood mesenchymal stem cell MSC transfected by rAAV2-EGFP (i.e. wild type 2) and rAAV2-LAH4-EGFP (i.e. mutant 2) in this example.

LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) transfected human Burkitt's lymphoma cell line (Raji): the 96-well plate was inoculated with 1E5 Raji cells, and suspended Raji cells were infected with LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) at a MOI 1E5 ratio, while cells were infected with wild-type rAAV6-EGFP at the same number of virus particles as a control. After 6h, transfer to 48-well plates and replenish the medium to 800. Mu.l. And (5) after 48 hours, inverting the fluorescent microscope for observation, and detecting the proportion of the fluorescent cells by using a flow cytometer. FIGS. 5A and 5B are graphs showing fluorescence microscopy and flow cytometry assays of rAAV6-EGFP (i.e., wild-type 6) and rAAV6-LAH4-EGFP (i.e., mutant 6) transfected human Burkitt's lymphoma cell line (Raji) in this example. Referring to FIGS. 5C and 5D, fluorescence microscopy and flow cytometry analysis of the rAAV2-EGFP (wild-type 2) and rAAV2-LAH4-EGFP (mutant 2) transfected human Burkitt's lymphoma cell line (Raji) in this example are shown.

LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) transfects human acute T cell leukemia cell line (Tlympocyte): the 96-well plate was inoculated with 5E 5T lymphocytes, and suspended T lymphocytes were infected with LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) at the MOI 1E6 ratio, while cells were infected with wild-type rAAV6-EGFP at the same number of virus particles as a control. After 6h, transfer to 48-well plates and replenish the medium to 800. Mu.l. And (5) after 48h, inverting the fluorescent microscope for observation, and detecting the proportion of the fluorescent cells by using a flow cytometer.

LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) transfects human T lymphocytes (Jurkat): the 96-well plate was inoculated with 1E5 Jurkat cells, and LAH4-rAAV6-EGFP (LAH 4-rAAV 2-EGFP) was used as a control to infect suspended Jurkat cells at MOI 1E5 ratio, while cells were infected with wild-type rAAV6-EGFP at the same virion number. After 6h, transfer to 48-well plates and replenish the medium to 800. Mu.l. And (5) after 48 hours, inverting the fluorescent microscope for observation, and detecting the proportion of the fluorescent cells by using a flow cytometer.

Please refer to fig. 6A and fig. 6B, which show the fluorescence microscopy observation and flow cytometry detection results of the rAAV6-EGFP (i.e., wild-type 6) and rAAV6-LAH4-EGFP (i.e., mutant 6) transfected human acute T cell leukemia cell line (Jurkat) in this example. Please refer to fig. 6C and fig. 6D, which show the fluorescence microscopy observation and flow cytometry detection results of the rAAV2-EGFP (i.e., wild-type 2) and rAAV2-LAH4-EGFP (i.e., mutant 2) transfected human acute T cell leukemia cell line (Jurkat) in this example.

Please refer to fig. 7A and fig. 7B, which show the fluorescence microscope observation result and the flow cytometry detection result of the rAAV6-EGFP (i.e., wild-type 6) and rAAV6-LAH4-EGFP (i.e., mutant 6) transfected human primary T cells in this example. Please refer to fig. 7C and fig. 7D, which show the fluorescence microscope observation results and flow cytometry detection results of the rAAV2-EGFP (i.e., wild-type 2) and rAAV2-LAH4-EGFP (i.e., mutant 2) transfected human primary T cells in this example.

FIG. 2A is an SDS-PAGE electrophoresis of recombinant viral capsid proteins of embodiments of the invention, including rAAV2-EGFP (i.e., wild-type 2) and rAAV2-LAH4-EGFP (i.e., mutant 2), rAAV6-EGFP (i.e., wild-type 6) and rAAV6-LAH4-EGFP (i.e., mutant 6).

The above examples show that the cell-penetrating peptide is directly inserted into the AAV capsid protein in a fusion expression manner, and the cell-penetrating peptide is firmly fused in the AAV capsid protein, so that the AAV can stably increase the proportion of entering the cell, the AAV cell transfection capability and transduction efficiency can be remarkably improved, the gene expression efficiency can be improved, the virus dosage can be reduced, and the immunogenicity can be further reduced. Compared with the prior art, the AAV and the cell-penetrating peptide are combined in an incubation mode, the invention is a fusion expression method, the combination rate of the cell-penetrating peptide and the AAV capsid protein is high, dissociation cannot occur, the fusion process is simple, and the cost is saved.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

It will be appreciated by persons skilled in the art that the above-described embodiments of the present invention are not intended to limit the scope of the present invention. Any other corresponding changes and modifications made according to the technical idea of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. An AAV capsid protein mutant having an amino acid sequence of a cell penetrating peptide inserted into the amino acid sequence of a parental or wild type AAV capsid protein as compared to the amino acid sequence of the parental or wild type AAV capsid protein, or a functional fragment thereof.

2. The AAV capsid protein mutant or functional fragment thereof according to claim 1, characterized in that: the cell-penetrating peptide has an amino acid sequence shown as SEQ ID NO.1 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto;

and/or the cell-penetrating peptide has the nucleotide sequence shown in SEQ ID NO.2 or a nucleotide sequence with at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the nucleotide sequence;

and/or, the parental or wild-type AAV capsid protein comprises any one of a type 6 AAV capsid protein, a type 2 AAV capsid protein; wherein the content of the first and second substances,

(ii) when a type 2 AAV capsid protein is selected, said type 2 AAV capsid protein has the nucleotide sequence set forth in SEQ ID No.13 or a nucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto; and/or, the AAV capsid protein of type 2 has the amino acid sequence set forth in SEQ ID No.14 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto;

an adeno-associated virus mutant of a type 2 AAV capsid protein fusion cell-penetrating peptide has the nucleotide sequence shown in SEQ ID No.15 or a nucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto; and/or, an adeno-associated virus mutant of a type 2 AAV capsid protein fusion cell-penetrating peptide has the amino acid sequence shown in SEQ ID No.16 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto;

when an AAV capsid protein of type 6 is selected, the AAV capsid protein of type 6 has the nucleotide sequence set forth in SEQ ID NO.17 or a nucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto; and/or, the type 6 AAV capsid protein has the amino acid sequence set forth in SEQ ID No.18 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto;

an adeno-associated virus mutant fused cell-penetrating peptide AAV capsid protein type 6 has the nucleotide sequence shown in SEQ ID No.19 or a nucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto; and/or, an adeno-associated virus mutant of a type 6 AAV capsid protein fusion cell-penetrating peptide has the amino acid sequence shown in SEQ ID No.20 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto.

3. An isolated polynucleotide comprising a nucleic acid sequence encoding the AAV capsid protein mutant of any one of claims 1-2, or a functional fragment thereof.

4. A vector comprising the isolated polynucleotide of claim 3; preferably, the vector is selected from a shuttle vector, an expression vector or an integration vector.

5. A host cell comprising the polynucleotide of claim 3 or the vector of claim 4.

6. An adeno-associated virus mutant comprising a capsid protein fusion cell-penetrating peptide, which comprises an AAV capsid protein mutant according to any one of claims 1-2, or a functional fragment thereof.

7. A recombinant adeno-associated virion, comprising:

an AAV capsid protein mutant of any one of claims 1-2, or a functional fragment thereof; and

an exogenous polynucleotide encoding an exogenous gene product;

preferably, the exogenous polynucleotide has AAV ITR sequences at the 5 'and 3' ends;

preferably, the exogenous polynucleotide further comprises at least one of a promoter sequence, an enhancer sequence, an intron, a polyA sequence and a reporter gene.

8. A preparation method of an adeno-associated virus mutant of a capsid protein fusion cell-penetrating peptide is characterized by comprising the following steps: constructing a recombinant baculovirus vector comprising the isolated polynucleotide of claim 3, and producing an adeno-associated virus mutant of capsid protein fusion cell-penetrating peptide using a baculovirus-insect cell production system.

9. Use of the adeno-associated virus mutant of capsid protein fusion cell-penetrating peptide according to claim 6 or the recombinant adeno-associated virion according to claim 7 in the preparation of a gene therapy medicament.

10. A pharmaceutical composition characterized by comprising: an adeno-associated virus mutant of the capsid protein fusion cell-penetrating peptide of claim 6 or a recombinant adeno-associated virion of claim 7; and, a pharmaceutically acceptable excipient.