CN115806586B - Whitening short peptide and preparation method thereof - Google Patents

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a whitening short peptide and a preparation method thereof. The application provides a peptide, the amino acid sequence of which comprises a sequence shown as SEQ ID No. 1. The application also provides a polynucleotide for encoding the peptide, a recombinant expression vector containing the polynucleotide, a recombinant host cell containing the recombinant expression vector, a preparation method and application of the peptide, and a product containing the peptide and having the functions of whitening, inhibiting melanocytes or inhibiting melanin generation. The peptide provided by the application has similar sequence with MSH-alpha, good water solubility and strong stability. The preparation method of the peptide provided by the application has simple operation process, can utilize biological fermentation to carry out large-scale preparation, and has obvious cost advantage. The product produced by the preparation method of the peptide provided by the application has accurate molecular weight, high purity and no obvious impurity component.

Description

Whitening short peptide and preparation method thereof

PRIORITY AND RELATED APPLICATION

The present application claims priority from the chinese patent office, application number 202210678931.1, chinese patent application entitled "whitening short peptide and method for preparing same," filed on day 15, 6, 2022, the entire contents of which are incorporated herein by reference.

Technical Field

The application belongs to the technical field of genetic engineering, and particularly relates to a whitening short peptide and a preparation method thereof.

Background

Skin whitening is a well-held pursuit of many asian women, with the traditional aesthetic concept of "a white-covered clown". From a scientific point of view, the colour of the skin is mainly determined by the pigment content of the skin, most notably the melanin content. The amount of melanin in the skin can largely determine the shade of skin color. Melanin is a protein that is present in every person's skin, hair, retina, pia mater, etc. The particles of melanin are not all pure black, but also yellow-brown, reddish-brown, tan, dark brown, etc. They work together to determine the different colors of human skin and hair.

Melanin is produced by the secretion of melanocytes. Melanocytes belong to glandular cells and have strong secretory capacity, and are mainly distributed among human epidermal basal cells. Melanin is a biological pigment formed by a series of chemical reactions of tyrosine or 3, 4-dihydroxyphenylalanine (also known as DOPA), and is the same pigment in animals, plants and protozoa. Melanin is typically present in a polymeric manner. The more melanin is produced, the darker the skin. Therefore, the human skin can be whitened by only making the melanoblast generate little melanin. There are generally two approaches to reduce melanin production, one approach is to reduce the biological activity of tyrosinase within the melanocytes, and the second approach is to inhibit the activity of the melanocytes by controlling the exogenous stimulation signal.

The activity of various cells in the human body is generally regulated by cytokines, and melanocytes are no exception. MSH, known collectively as melanocyte stimulating hormone (melanocyte-stimulating hormone), or melanocyte stimulating hormone, is a very important hormone in the human body, and is a polypeptide hormone produced by the pituitary. MSH is powerful, i.e. it stimulates melanocytes in hair and skin to produce melanin, turning the skin black; but also can free fatty acid of adipose tissue, improve vision retention of people, change nerve stress, and improve attention and memory of mental retardation people. Melanocyte surfaces express a melanocortin receptor, called MSH-R, belonging to the GPCR family of members. MSH-R is the receptor for MSH signaling molecules. After secretion from the pituitary gland, MSH hormone binds to MSH-R receptors on melanocytes, opening a signaling pathway, activating downstream melanin production. The activation of this signal pathway can be blocked and the production of skin melanin can be inhibited as long as the interaction between MSH and MSH-R can be disturbed.

At present, the crystal structure of MSH protein binding MSH-R receptor is not analyzed by human, so the specific binding mode of the MSH protein and the MSH-R receptor is not clear. However, one can still achieve the goal of preventing MSH from binding MSH-R by designing sequence analogs of MSH. In human body, there are alpha and beta MSH, wherein the amino acid sequence of MSH-alpha is SYSMEHFRWGKPV, and many similar polypeptides have been designed to simulate the biological function of the signal molecule, and the MSH signal molecule of human body is prevented from activating by binding MSH-R receptor. For example, nonapeptide-1, also known as melanostatine-5, is an analogue of MSH-alpha, which has been shown to have whitening properties. The amino acid sequence of the polypeptide is very similar to that of MSH-alpha. However, melanostatine-5 has 2D-type amino acids in its sequence, and is not easy to prepare by biological fermentation, so that its preparation method is limited to chemical synthesis, and its high cost limits the wide use of such products.

Therefore, developing a lower cost whitening peptide that can be synthesized by biosynthesis is a problem in the art.

Disclosure of Invention

Problems to be solved by the application

At present, the preparation method of MSH-alpha similar polypeptide is limited to chemical synthesis, and the high manufacturing cost hinders the wide application of the product. In view of the above, the application aims to provide a whitening short peptide and a preparation method thereof, which realize large-scale preparation by utilizing biosynthesis on the basis of ensuring that the amino acid sequence of the peptide is similar to MSH-alpha so as to be applied on a large scale.

Solution for solving the problem

The first aspect of the present application provides a peptide, wherein the amino acid sequence of the peptide comprises any one of the following (i) to (iii):

(i) An amino acid sequence as shown in SEQ ID No. 1;

(ii) An amino acid sequence in which 1 or more amino acid residues are added, substituted, deleted or modified in the amino acid sequence shown as SEQ ID No.1 and the activity of whitening or inhibiting melanocytes or inhibiting melanogenesis of the sequence shown as SEQ ID No.1 is retained;

(iii) An amino acid sequence encoded by a nucleotide sequence that hybridizes with a polynucleotide sequence encoding a sequence set forth in SEQ ID No.1 under stringent conditions, said stringent conditions being medium stringent conditions, medium-high stringent conditions, high stringent conditions or very high stringent conditions, and which retains the activity of whitening or inhibiting melanogenesis of a sequence set forth in SEQ ID No. 1.

In a second aspect the application provides a polynucleotide, wherein the polynucleotide encodes a peptide according to the first aspect of the application.

Further, the sequence of the polynucleotide comprises a sequence shown as SEQ ID No. 2.

In a third aspect, the present application provides a recombinant expression vector comprising n repeats of the polynucleotide according to the second aspect of the present application, n being an integer greater than or equal to 1, and when n is an integer greater than or equal to 2, the repeats are directly linked to each other;

preferably, n is 2;

preferably, the recombinant expression vector comprises a pET series vector, shuttle vector, phage or viral vector;

more preferably, the recombinant expression vector is pET-32a.

Further, the recombinant expression vector further comprises a polynucleotide encoding an amino acid sequence capable of being excised by a TEV protease;

preferably, the 3 'end of the polynucleotide encoding an amino acid sequence capable of cleavage by a TEV protease is directly linked to the 5' end of the first said repeat polynucleotide.

In a fourth aspect the present application provides a recombinant host cell, wherein the recombinant host cell comprises a recombinant expression vector according to the third aspect of the application;

preferably, the recombinant host cell is a prokaryotic cell, yeast or eukaryotic cell;

more preferably, the recombinant host cell is E.coli BL21 (DE 3).

In a fifth aspect, the present application provides a method for producing a peptide according to the first aspect of the present application, wherein the method comprises the steps as shown in S1 to S2:

s1: fermenting the recombinant host cell of claim 6 to induce expression of the peptide;

s2: the peptides were collected and purified.

Further, in step S2 comprises purifying the peptide using a Ni affinity chromatography column and/or an ion exchange chromatography column, and optionally comprises subjecting the peptide to cleavage;

preferably, the peptide is cleaved with TEV protease.

The sixth aspect of the present application provides the use of a peptide according to the first aspect of the present application in at least one of the following (a) to (c):

(a) As or to prepare a whitening product;

(b) As or in the preparation of a product for inhibiting melanocytes;

(c) As or in the preparation of a product for inhibiting melanogenesis.

A seventh aspect of the present application provides a product, wherein the product comprises a peptide according to the first aspect of the present application and the product has the function of whitening, inhibiting melanocytes or inhibiting melanogenesis.

ADVANTAGEOUS EFFECTS OF INVENTION

Through implementation of the technical scheme, the application provides a peptide which is more similar to human natural protein MSH-alpha, has good water solubility and strong stability, and has good functions of whitening, inhibiting melanocytes and inhibiting melanin generation. Meanwhile, the preparation method of the peptide provided by the application realizes large-scale production by using an escherichia coli expression system, can further improve the yield by the serial expression of polypeptide genes, has simple operation process, has obvious cost advantage compared with the traditional chemical synthesis process of the polypeptide, and has wide market application prospect. The product produced by the preparation method of the peptide provided by the application has accurate molecular weight, high purity and no obvious impurity component.

Meanwhile, experimental data show that the peptide provided by the application can effectively inhibit the activity of tyrosinase and can effectively inhibit cells from generating melanin, has good whitening effect, and provides effective help for the development and production of whitening products.

Drawings

FIG. 1 shows the SDS-PAGE results of the polypeptides Trx-1T9 and 1T9.

FIG. 2 shows the mass spectrum of polypeptide 1T9.

FIG. 3 shows a pET-32a-1T9 vector map.

FIG. 4 is a test result of the effect of polypeptide 1T9 on melanogenesis in cells; wherein, # represents that the difference has statistical significance (p < 0.05) compared to the blank control group; * The differences were statistically significant (p < 0.05) as compared to the model control group; TA represents the substance to be tested, polypeptide 1T9.

FIG. 5 shows the results of detection of the effect of polypeptide 1T9 on tyrosinase activity; wherein, # represents that the difference has statistical significance (p < 0.05) compared to the blank control group; * The differences were statistically significant (p < 0.05) as compared to the model control group; TA represents the substance to be tested, polypeptide 1T9.

Detailed Description

The following describes embodiments of the present application, but the present application is not limited thereto.

In the present application, the meaning of "can" includes both the meaning of performing a certain process and the meaning of not performing a certain process. In this specification, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.

In the present disclosure, the terms "comprising," "having," "including," or "containing" may be used to specify the presence of stated features, integers, steps, or groups thereof, but do not preclude the presence or addition of other features, integers, steps, or groups thereof. In the meantime, "comprising," "having," "including," or "containing" may also mean enclosed, excluding additional, unrecited elements or method steps.

In the present application, the terms "peptide", "short peptide", "polypeptide", "protein" interchangeably refer to a string of at least two amino acid residues, which may be recombinant peptides, natural peptides or synthetic peptides, that are linked to each other by covalent bonds (e.g. peptide bonds). The peptide may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

In the present application, the term "amino acid" may include natural amino acids, unnatural amino acids, amino acid analogs, and all their D and L stereoisomers.

In the present application, "hybridization" means the ability of a polynucleotide or oligonucleotide to bind to a substantially complementary sequence under stringent conditions, without non-specific binding between non-complementary objects occurring under these conditions. In this connection, the sequences are preferably 90 to 100% complementary. The nature of complementary sequences capable of specifically binding to each other is used, for example, in Northern or Southern blotting techniques, or in primer binding for PCR or RT-PCR. According to the application, hybridization occurs under medium stringency conditions, medium-high stringency conditions, or very high stringency conditions. Such hybridization conditions are described in Current Protocols in Molecular Biology, john Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, specific hybridization conditions are as follows: (1) Low stringency hybridization conditions are washed 2 times in 6 x sodium chloride/sodium citrate (SSC), at about 45 ℃, then at least 50 ℃, in 0.2 x SSC,0.1% sds (for low stringency conditions the wash temperature can be raised to 55 ℃); (2) Medium stringency hybridization conditions are washed 1 or more times in 6 XSSC, at about 45℃followed by 0.2 XSSC, 0.1% SDS at 60 ℃; (3) High stringency hybridization conditions are washed 1 or more times in 6 XSSC, at about 45℃followed by 65℃in 0.2 XSSC, 0.1% SDS and preferably; (4) Very high stringency hybridization conditions are 0.5M sodium phosphate, 7% SDS, washed 1 or more times in 0.2 XSSC, 1% SDS at 65℃followed by 65 ℃.

The peptide 1T9 of the application consists of 10L-type amino acids. The amino acid sequence is as follows: GMPFRWFKPV (SEQ ID No. 1). The theoretical molecular weight of 1T9 is 1264.55Da.

The peptides of the application can be prepared by a variety of production processes. Can be prepared by conventional chemical synthesis process, and can also be prepared by recombinant expression by fermentation process, such as fermentation with Escherichia coli.

The peptide of the application may be encoded by a nucleotide sequence, for example by the nucleotide sequence shown in SEQ ID No.2 (specific sequence GGTATGCCATTTCGTTGGTTTAAACCGGTA). It will be appreciated that due to codon degeneracy, one skilled in the art will readily vary the nucleotide sequence while retaining the original amino acid sequence. The nucleotide sequence may be cloned into an expression vector by conventional techniques and the expression vector then transformed into a host cell. Transformation methods include, but are not limited to, electroporation, caCl ₂ Transformation, and the like. In the present application, the expression vector may be pET-26, pET-32, pGEX-6p, etc.

The peptides of the application may be expressed by different organisms including, but not limited to, animal cells, plant cells, microbial cells, such as prokaryotes and eukaryotes. Preferably, the peptides of the application are produced in the present application using microbial cell fermentation. The microbial cell may be an enterobacteriaceae cell, such as an escherichia coli cell, e.g., BL21 (DE 3). It will be appreciated that the skilled artisan can select appropriate cells to express the peptides of the application.

The peptides of the application can be prepared and produced by conventional methods. For example, a host cell transformed with a polynucleotide of the application, such as E.coli, may be cultured in a medium under appropriate conditions; the peptides of the application are then isolated by conventional isolation and purification techniques. Separation and purification techniques include, but are not limited to, dialysis, ammonium sulfate precipitation, and high performance liquid chromatography.

The peptide of the present application comprises a sequence represented by SEQ ID No.1 or a sequence in which one or several amino acids are substituted, deleted and/or added in the sequence represented by SEQ ID No.1, and exhibits an activity of inhibiting melanogenesis or whitening. The "number" may be 2, 3,4, 5, 6, 7, 8, 9, 10 or 11.

Amino acid addition refers to addition of an amino acid within the amino acid sequence, e.g., the sequence of SEQ ID No.1, or addition of an amino acid at the C-or N-terminus of the amino acid sequence, which may be all or partially adjacent to each other, or none of the amino acids added adjacent to each other, so long as the peptide exhibits activity of inhibiting melanogenesis or whitening.

Amino acid substitutions refer to the replacement of a certain amino acid residue at a certain position of an amino acid sequence, e.g. the sequence of SEQ ID No.1, by other amino acid residues, as long as the peptide shows melanogenesis inhibiting activity or whitening activity.

Amino acid deletions mean that 1, 2 or 3 or more amino acids may be deleted from the amino acid sequence, e.g., the sequence of SEQ ID No.1, as long as the peptide exhibits melanogenesis-inhibiting activity or whitening activity.

It is known to those skilled in the art that the peptides of the application may be post-translationally modified at one or more positions between the amino acid sequences. Examples of post-translational modifications may include phosphorylation, acetylation, and deamidation.

The present application also provides an analog of the peptide shown in SEQ ID No.1, as long as the analog shows an activity of inhibiting melanogenesis or a whitening activity. These analogs may differ from the native peptide by differences in amino acid sequence, by differences in modified forms that do not affect the sequence, or by both. These peptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, by site-directed mutagenesis or other known techniques of molecular biology. Analogs also include analogs having residues other than the natural L-amino acid (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids).

In the present application, a substitution may be a conservative amino acid substitution, meaning that 3, more preferably 2 or 1 amino acids are replaced with amino acids having similar or similar properties to the amino acid sequence of SEQ ID No.1 to form a peptide. These conservatively mutated peptides may be generated by amino acid substitution according to Table 1.

TABLE 1 amino acid substitutions Table

The application also provides a nucleic acid molecule comprising a nucleic acid sequence encoding a peptide of the application. The nucleic acid may be DNA or cDNA. The nucleic acid molecule may consist essentially of a nucleic acid sequence encoding a peptide of the application, or may consist of only a nucleic acid sequence encoding a peptide of the application. Such nucleic acid molecules can be synthesized using methods known in the art. Because of the degeneracy of the genetic code, it will be understood by those skilled in the art that nucleic acid molecules of different nucleic acid sequences may encode the same amino acid sequence.

The application also provides a vector comprising the nucleic acid sequence of the application. Suitable vectors are known in the art of vector construction and include selection of promoters and other regulatory elements, such as enhancer elements. The vectors of the present application include sequences suitable for introduction into cells. For example, the vector may be an expression vector in which the coding sequence of the peptide is under the control of its own cis-acting regulatory element, the vector being designed to facilitate gene integration or gene replacement in a host cell, etc.

As understood by those of ordinary skill in the art, in the present application, the term "vector" includes DNA molecules, e.g., plasmids, phages, viruses or other vectors, which contain one or more heterologous or recombinant nucleic acid sequences. Suitable phage and viral vectors include, but are not limited to: lambda phage, EMBL phage, simian virus, bovine wart virus, epstein-Barr virus, adenovirus, herpes virus, mouse sarcoma virus, murine breast cancer virus, lentivirus, etc.

The method for producing the peptide of the present application may comprise the steps of:

(1) Construction of genetically engineered bacteria, such as escherichia coli genetically engineered bacteria;

(2) Fermenting, culturing and inducing expression of the genetically engineered bacteria;

(3) Purifying and enzyme cutting the polypeptide.

Taking escherichia coli genetically engineered bacteria as an example, the construction steps in the step (1) are as follows: optimally selecting a DNA fragment of the peptide 1T9, and carrying out codon optimization and splicing recombination on the fragment by using a PCR method to obtain a complete recombined DNA sequence; transferring the recombinant DNA sequence into an escherichia coli expression strain, and screening to obtain escherichia coli genetic engineering bacteria.

The fermentation culture and the induced expression steps of the escherichia coli genetic engineering bacteria in the step (2) are as follows:

a. selecting a single colony of the optimized escherichia coli genetic engineering bacteria from an LB plate, placing the single colony in 10ml of LB culture medium, and culturing for 12-16 h at 220rpm and 37 ℃;

b. inoculating the bacterial liquid into LB culture medium according to the ratio of 1:100, performing amplification culture, 220rmp, and culturing at 37 ℃ for 3 hours until the OD of the bacterial liquid is reached ₆₀₀ About 0.6, IPTG was added to a final concentration of 0.5mM for induction, and the culture was continued at 16℃for 20 hours, followed by centrifugation to collect the cells.

In step (3), the peptide purification steps are as follows:

a. resuspending the bacteria with Tris buffer, sonicating, centrifuging and collecting supernatant;

b. purifying the supernatant by using an affinity column to obtain recombinant 1T9 fusion protein;

c. removing the fusion protein by using a TEV enzymolysis method to release free 1T9 peptide;

d. the 1T9 peptide in the solution is purified by dialysis, reverse phase column, etc.

Examples

The application is further illustrated by the following examples, but any examples or combinations thereof should not be construed as limiting the scope or embodiments of the application. The scope of the present application is defined by the appended claims, and the scope of the claims will be apparent to those skilled in the art from consideration of the specification and the common general knowledge in the field. Any modifications or variations of the technical solution of the present application may be carried out by those skilled in the art without departing from the spirit and scope of the present application, and such modifications and variations are also included in the scope of the present application.

The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. All reagents or equipment were commercially available as conventional products without the manufacturer's attention. Numerous specific details are set forth in the following description in order to provide a better understanding of the application. It will be understood by those skilled in the art that the present application may be practiced without some of these specific details. In other embodiments, methods, means, apparatus and steps well known to those skilled in the art have not been described in detail in order to not obscure the present application.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise indicated, all units used in this specification are units of international standard, and the numerical values and numerical ranges appearing in the present application are understood to include unavoidable systematic errors.

Example 1: construction and expression of pET-32a-1T9 gene expression vector

(1) Construction of E.coli genetically engineered bacteria

The gene whose E.coli codon was preferred, GGTATGCCATTTCGTTGGTTTAAACCGGTA (SEQ ID No. 2), was optimally selected based on the amino acid sequence of 1T9 (SEQ ID No.1: GMPFRWFKPV). The pET-32a-1T9 expression vector (specific structure of vector is shown in FIG. 3, which contains coding sequence of Trx tag) was constructed by inserting pET-32a expression vector (Beijing Cheng Yuanke allied Gene technology Co., ltd.) through cleavage sites of KpnI (NEB Co., ltd.: R0136L) and XhoI (NEB Co., ltd.: R0146L) after ligating 1T9 gene fragment to TEV protease cleavage site.

The recombinant expression vector pET-32a-1T9 is transformed into an escherichia coli expression strain BL21 (DE 3) (Merck company) and screened to obtain escherichia coli genetic engineering bacteria. The specific process is as follows:

1: mu.l of this plasmid was taken in 100. Mu.l of E.coli competent cells BL21 (DE 3) and allowed to stand on ice for 30min.

2: the mixture was heat shocked in a 42 ℃ water bath for 90s and then rapidly placed on ice for 2min.

3: to this mixture, 600. Mu.l of a non-resistant LB medium was added, and the mixture was cultured at 37℃for 1 hour at 220 rpm.

4: 200. Mu.l of this bacterial solution were spread evenly on LAB plates containing ampicillin resistance (10 g/L peptone, 5g/L yeast extract, 10g/L sodium chloride, 15g/L agar, 100. Mu.g/ml ampicillin).

5: the plates were incubated upside down in a 37℃incubator for about 20 hours to allow for the growth of clearly visible colonies.

(2) Fermentation culture and induction expression of escherichia coli genetic engineering bacteria

And (3) bacterial collection: the optimized escherichia coli genetic engineering bacteria 1T9 single colony is selected from an LB plate and placed in 10ml of LB culture medium (10 g/L peptone, 5g/L yeast extract and 10g/L sodium chloride) for culturing for 12h-16h at 37 ℃ at 220 rpm.

Induction of expression: inoculating the bacterial liquid into LB culture medium according to the ratio of 1:100, performing amplification culture, 220rmp, and culturing at 37 ℃ for 3 hours until the OD of the bacterial liquid is reached ₆₀₀ About 0.6, IPTG was added to a final concentration of 0.5mM for induction, and the culture was continued at 16℃for 20 hours, followed by centrifugation to collect the cells.

Homogenizing and centrifuging to collect supernatant: and (3) re-suspending the collected thalli by using balance working solution, cooling the thalli to be less than or equal to 15 ℃, homogenizing the thalli at high pressure for two times, and collecting the thalli after the homogenization is completed. Subpackaging the homogenized bacterial liquid into a centrifugal bottle, centrifuging at 17000rpm and 4 ℃ for 30min, collecting supernatant, and taking supernatant and precipitate for electrophoresis detection.

(3) Purification and cleavage of recombinant polypeptides

Crude and pure: a. the column was washed with water, 5 CV. b. The column was equilibrated with equilibration solution (200 mM sodium chloride, 25mM Tris,20mM imidazole). c. Loading: adding the supernatant after centrifugation into the column until the liquid is completely flowed. d. Cleaning the hybrid protein: 25mL of wash solution (200 mM sodium chloride, 25mM Tris,20mM imidazole) was added until the liquid was complete. e. Collecting the target protein: 25mL of an eluent (200 mM sodium chloride, 25mM Tris,250mM imidazole) was added, and the flow-through was collected to give the target polypeptide Trx-1T9, and the name of the flow-through sample was designated as "elution".

And (3) enzyme cutting: if the target polypeptide with Trx tag needs to be excised, a proper amount of TEV protease with His tag can be added, and after incubation for 16 hours at 4 ℃, the flow-through liquid is collected, namely the polypeptide 1T9 with the carrier protein Trx removed, and the name of a sample after enzyme digestion is named as "after digestion".

Example 2: electrophoresis detection of peptide 1T9

The polypeptides Trx-1T9 and 1T9 obtained in example 1 were checked for molecular weight and purity by SDS-PAGE. The specific process is as follows: 40. Mu.l of purified and digested polypeptide solution was added to 10. Mu.l of 5 Xprotein loading buffer (250 mM Tris-HCl (pH: 6.8), 10% SDS,0.5% bromophenol blue, 50% glycerol, 5% beta-mercaptoethanol), and the mixture was boiled in boiling water at 100℃for 10 minutes, then 10. Mu.l of each well was added to SDS-PAGE protein gel, and after running at 80V for 2 hours, protein staining was performed for 20 minutes with Coomassie brilliant blue staining solution (0.1% Coomassie brilliant blue R-250, 25% isopropanol, 10% glacial acetic acid), and further decolorization was performed with protein decolorization solution (10% acetic acid, 5% ethanol). The detection result is shown in figure 1, the apparent molecular weight of Trx-1T9 is 18kDa, and the molecular weight corresponds to Trx-1T9 polypeptide, which indicates that the polypeptide Trx-1T9 is correctly expressed; the molecular weight after cleavage is smaller than the apparent molecular weight of Trx-1T9, which indicates that the protease cleavage is complete.

Example 3: mass spectrometric detection of peptide 1T9

Because of the small theoretical molecular weight of short peptide 1T9, it could not be detected and shown by conventional SDS-PAGE. Thus, the protein molecular weight of the purified whitening short peptide 1T9 is determined: the samples were desalted by ziptipC18, then mixed with matrix (CHCA) and spotted. Finally, analysis was performed in reflection mode using a matrix-assisted laser desorption ionization-time-of-flight mass spectrometer MALDI-TOF/TOF UltraflextremeTM, brucker, germany.

The theoretical molecular weight of the 1T9 polypeptide is 1264.55Da, and the detection cannot be carried out by conventional SDS-PAGE, and the identification is needed by a mass spectrometry method. As shown in FIG. 2, the actual molecular weight of the 1T9 polypeptide of the application is 1264.753Da, which is consistent with the theoretical molecular weight, and no obvious impurities and no degradation occur according to the identification of a mass spectrometry method.

Example 4: polypeptide in vitro whitening efficacy assessment

Method: human melanocyte melanogenesis assay.

Principle of experiment: tyrosinase is the rate-limiting enzyme in the melanin synthesis pathway, affecting melanin production primarily by affecting the conversion of tyrosine to dopa, and the oxidation of dopa to dopaquinone. Some whitening agents such as kojic acid and its derivatives and arbutin inhibit melanin production by inhibiting tyrosinase activity. The melanocyte stimulating hormone MSH-alpha can effectively promote the tyrosinase activity of melanocytes, therebyPromote melanin synthesis. The method utilizes MSH-alpha to induce melanocytes, and utilizes a colorimetric method to detect the influence of a polypeptide sample (1T 9 polypeptide) on the inhibition result of tyrosinase and melanin generation so as to evaluate the efficacy of the polypeptide sample.

Experimental materials：

Cell line: human melanoma cells, source: kunming cell bank.

Culture solution: DMEM medium (from solebao) containing 10% fbs.

Culture conditions: 37 ℃,5% CO ₂ Culturing under saturated humidity.

Melanocyte stimulating hormone (alpha-MSH): 0.1. Mu.M.

DOPA:2mg/mL (from Sigma).

Positive control: arbutin (0.1 mg/mL) (Guangzhou Mo Lilong company).

PBS：137mM NaCl，2.7mM KCl，10mM NaHPO ₄ ，2mM KH ₂ PO ₄ 。

The experimental steps are as follows:

evaluation of whitening efficacy melanin content

1. Human melanoma cells were seeded into 6-well plates at a density of 1X 10 ⁵ Culturing for 18-24h at a concentration of 2 mL/hole;

2. replacing DMEM medium containing 10% FBS, and culturing for 12h;

3. the cells were divided into 6 groups as follows and treated accordingly:

blank control group: the original culture solution was removed, and 2mL of the culture solution was added thereto for continuous culture for 3 days.

Model control group: the stock culture was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha was added thereto for continuous culture for 3 days.

Positive control group: the original culture solution was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha, 0.1mg/mL arbutin was added thereto, followed by continuous culture for 3 days.

Sample group:

0.50mg/mL group: the stock culture was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha, 0.50mg/mL 1T9 polypeptide was added thereto, followed by continuous culture for 3 days.

0.05mg/mL group: the stock culture was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha, 0.05mg/mL 1T9 polypeptide was added thereto, followed by continuous culture for 3 days.

0.01mg/mL group: the stock culture was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha, 0.01mg/mL 1T9 polypeptide was added thereto, followed by continuous culture for 3 days.

4. At the end of exposure, removing the culture solution, washing with PBS for 2 times, scraping and collecting cells of each hole by using cells, counting the cells, centrifuging at 10000rpm/min and collecting the cells at 4 ℃;

5. adding 1M NaOH solution, and dissolving cells on ice to obtain cell sap;

6. heating the cell sap at 80deg.C for 10min, and lysing melanin corpuscles;

7. the absorbance value was measured at 405nm of each group of cell fluids after cleavage of the melanosomes.

Evaluation of tyrosinase Activity with whitening efficacy

1. Human melanoma cells were seeded into 6-well plates at a density of lx10 ⁵ Culturing for 18-24h at a concentration of 2 mL/hole;

2. replacing DMEM medium containing 10% FBS, and culturing for 12h;

3. the cells were divided into 6 groups as follows and treated accordingly:

blank control group: the original culture solution was removed, and 2mL of the culture solution was added thereto for continuous culture for 3 days.

Model control group: the stock culture was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha was added thereto for continuous culture for 3 days.

Positive control group: the original culture solution was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha, 0.1mg/mL arbutin was added thereto, followed by continuous culture for 3 days.

Sample group:

0.50mg/mL group: the stock culture was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha, 0.50mg/mL 1T9 polypeptide was added thereto, followed by continuous culture for 3 days.

0.05mg/mL group: the stock culture was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha, 0.05mg/mL 1T9 polypeptide was added thereto, followed by continuous culture for 3 days.

0.01mg/mL group: the stock culture was removed, and 2mL of a culture solution containing 0.1. Mu.M MSH-alpha, 0.01mg/mL 1T9 polypeptide was added thereto, followed by continuous culture for 3 days.

4. At the end of exposure, the culture solution is removed, PBS is used for cleaning for 2 times, cells in each hole are scraped and collected by using the cells, 10000rpm/min is used for centrifugally collecting the cells at 4 ℃;

5. adding 200 mu L of cell lysate, repeatedly freezing and thawing, lysing cells, centrifuging at 10000rpm/min at 4deg.C for 20min to obtain supernatant;

6. 150. Mu.L of each supernatant was added to a 96-well plate, 20. Mu.L DOPA solution was rapidly added, and absorbance was measured at 475nm after shaking. After 30min of reaction at 37 ℃, the absorbance was again determined.

Data analysis：

Melanin relative content:

tyrosinase relative activity:

experimental results：

1. Analysis of melanin content

As a result, as shown in FIG. 4, in the melanin content test results, the melanin content of the positive control group was significantly reduced (p < 0.05) compared with the model control group, and the melanin content of the sample was significantly reduced (p < 0.05) at three 1T9 polypeptide test concentrations of 0.50mg/mL, 0.05mg/mL and 0.01 mg/mL.

2. Analysis of tyrosinase Activity results

As shown in FIG. 5, in the tyrosinase activity test result, compared with the model control group, the tyrosinase relative activity of the positive control group is obviously reduced (p < 0.05), and the tyrosinase relative activity of the sample is obviously reduced (p < 0.05) at three 1T9 polypeptide test concentrations of 0.50mg/mL, 0.05mg/mL and 0.01 mg/mL.

Therefore, under the test condition, the 1T9 polypeptide has certain whitening effect at three test concentrations of 0.50mg/mL, 0.05mg/mL and 0.01 mg/mL.

Claims (18)

1. A peptide, which is characterized in that the amino acid sequence of the peptide is shown as SEQ ID No. 1.

2. A polynucleotide encoding the peptide of claim 1.

3. The polynucleotide according to claim 2, wherein the sequence of the polynucleotide is as shown in SEQ ID No. 2.

4. A recombinant expression vector comprising n repeats of the polynucleotide of claim 2 or 3, n being 1.

5. The recombinant expression vector of claim 4, wherein the recombinant expression vector comprises a pET series vector, a shuttle vector, or a viral vector.

6. The recombinant expression vector of claim 4, wherein the recombinant expression vector is a phage.

7. The recombinant expression vector of claim 4, wherein the recombinant expression vector is pET-32a.

8. The recombinant expression vector according to any one of claims 4-7, further comprising a polynucleotide encoding an amino acid sequence that is cleavable by a TEV protease.

9. The recombinant expression vector of claim 8, wherein the 3 'end of the polynucleotide encoding an amino acid sequence capable of cleavage by TEV protease is directly linked to the 5' end of the polynucleotide of claim 2 or 3.

10. A recombinant host cell comprising the recombinant expression vector according to any one of claims 4-9.

11. The recombinant host cell of claim 10, wherein the recombinant host cell is a prokaryotic cell or a eukaryotic cell.

12. The recombinant host cell of claim 10, wherein the recombinant host cell is a yeast.

13. The recombinant host cell according to claim 10, wherein the recombinant host cell is e.coli BL21 (DE 3).

14. The method for producing a peptide according to claim 1, wherein the method comprises the steps of S1 to S2:

s1: fermenting the recombinant host cell according to any one of claims 10-13 to induce expression of the peptide;

s2: the peptides were collected and purified.

15. The method of claim 14, wherein in step S2 comprises purifying the peptide using a Ni affinity chromatography column and/or an ion exchange chromatography column, and optionally comprising cleaving the peptide.

16. The method of claim 15, wherein the peptide is cleaved using TEV protease.

17. Use of the peptide according to claim 1 in at least one of the following (a) - (c):

(a) Preparing a whitening product;

(b) Preparing a product for inhibiting melanocyte;

(c) Preparing a product for inhibiting melanin generation.

18. A product, characterized in that the product comprises the peptide according to claim 1, and the product has a function of whitening, inhibiting melanocytes and/or inhibiting melanogenesis.