CN115806586A - Whitening short peptide and preparation method thereof - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a whitening short peptide and a preparation method thereof. The invention provides a peptide, the amino acid sequence of which comprises a sequence shown as SEQ ID No. 1. The invention also provides a polynucleotide for coding the peptide, a recombinant expression vector containing the polynucleotide, a recombinant host cell containing the recombinant expression vector, a preparation method and application of the peptide, and a product containing the peptide and having functions of whitening, inhibiting melanoblast or inhibiting melanin generation. The peptide provided by the invention has a sequence similar to that of MSH-alpha, good water solubility and strong stability. The preparation method of the peptide provided by the invention is simple in operation process, can be used for large-scale preparation by utilizing biological fermentation, and has a remarkable cost advantage. The product produced by the preparation method of the peptide provided by the invention has the advantages of accurate molecular weight, high purity and no obvious impurity components.

Description

Whitening short peptide and preparation method thereof

PRIORITY AND RELATED APPLICATION

The present application claims priority of the chinese patent application with application number 202210678931.1 entitled "whitening short peptide and method for preparing the same" filed by the chinese patent office on 6/15/2022, which is incorporated herein by reference in its entirety.

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a whitening short peptide and a preparation method thereof.

Background

Skin whitening is a licensed pursuit of many asian women, and more has the traditional aesthetic concept of "one white covering ugly". From a scientific point of view, the color of the skin is determined mainly by the pigment content in the skin, most importantly by the melanin content. The amount of melanin in the skin can largely determine the shade of the skin color. Melanin is a protein, and is present in every human skin, hair, retina, pia mater, and other tissues. Not all melanin granules are pure black, but also yellowish brown, reddish brown, tan, dark brown, and the like. They work together to determine the different colors of human skin and hair.

Melanin is produced by secretion from melanoblasts. Melanoblast belongs to glandular cells, has strong secretion capacity, and is mainly distributed among basal cells of human epidermis. Melanin is a biological pigment formed by a series of chemical reactions of tyrosine or 3, 4-dihydroxyphenylalanine (also known as DOPA, DOPA), which is the same pigment in animals, plants and protists. Melanin is usually present in a polymeric manner. The more melanin production, the darker the skin. Therefore, if the melanoblast produces little melanin, the skin of the human body can be whitened. There are generally two approaches to reduce melanin production, one to reduce the biological activity of tyrosinase within melanoblasts and the second to inhibit melanoblasts activity by controlling exogenous stimulation signals.

The activities of various cells in human body are generally regulated by cytokines, and melanoblasts are no exception. MSH, collectively known as melanocyte-stimulating hormone (melanocyte-stimulating hormone), or melanocyte stimulating hormone, is a very important hormone in humans, a polypeptide hormone produced by the pituitary gland. MSH is very powerful, i.e., it stimulates melanocytes in the hair and skin to produce melanin, which blackens the skin; can also free fatty acid of adipose tissue, improve visual retention of human, change nerve excitability, and improve attention and memory of mental retardation patients. Melanoblasts express a melanocortin receptor on the surface called MSH-R, a member of the GPCR family. MSH-R is a receptor for MSH signaling molecules. After secretion from the pituitary, MSH hormone binds to MSH-R receptor on melanoblast, opening the signal pathway and activating downstream melanin production. If the interaction between MSH and MSH-R can be interfered, the activation of the signal path can be blocked, and the generation of skin melanin can be inhibited.

At present, the crystal structure of the MSH protein combined with the MSH-R receptor is not analyzed by human, so that the specific mode of combining the MSH protein and the MSH-R receptor is not clear. However, one can still achieve the goal of preventing MSH from binding to MSH-R by designing sequence analogs of MSH. There are two kinds of MSH, alpha and beta, in human body, the amino acid sequence of MSH-alpha is SYSMEHFRWGKPV, and many similar polypeptides have been designed to mimic the biological function of this signaling molecule and prevent the MSH signaling molecule from activating by binding with MSH-R receptor. For example, nonapeptide-1, also known as melastatin-5, is an analogue of MSH-alpha and has been shown to have whitening effect. The amino acid sequence of the polypeptide is very similar to that of MSH-alpha. However, the melanostatin-5 sequence contains 2D-type amino acids, and is not easy to prepare by a biological fermentation method, so that the preparation method is limited to chemical synthesis, and the high cost limits the wide application of the product.

Therefore, the development of a lower-cost whitening peptide that can be biosynthesized is a problem to be urgently solved in the art.

Disclosure of Invention

Problems to be solved by the invention

At present, the preparation method of MSH-alpha similar polypeptide is limited to chemical synthesis, and the high manufacturing cost prevents the wide application of the product. Therefore, the invention aims to provide the whitening short peptide and the preparation method thereof, which realize large-scale preparation by utilizing biosynthesis on the basis of ensuring that the amino acid sequence of the peptide is similar to MSH-alpha so as to facilitate large-scale application.

Means for solving the problems

The first aspect of the present invention provides a peptide, wherein the amino acid sequence of the peptide comprises any one of the following (i) to (iii):

(i) An amino acid sequence shown as SEQ ID No. 1;

(ii) 1 or more amino acid residues are added, substituted, deleted or modified in the amino acid sequence shown as SEQ ID No.1, and the amino acid sequence with the activity of whitening or inhibiting melanoblast or inhibiting melanin generation of the sequence shown as SEQ ID No.1 is reserved;

(iii) An amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a polynucleotide sequence encoding the sequence shown as SEQ ID No.1 and which retains the activity of the sequence shown as SEQ ID No.1 of whitening or inhibiting melanoblasts or inhibiting melanin production, said stringent conditions being medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.

In a second aspect, the present invention provides a polynucleotide, wherein said polynucleotide encodes a peptide according to the first aspect of the invention.

Further, the sequence of the polynucleotide comprises a sequence shown as SEQ ID No. 2.

A third aspect of the present invention provides a recombinant expression vector comprising n repeats of a polynucleotide according to the second aspect of the present invention, n being an integer of 1 or more, wherein when n is an integer of 2 or more, direct linkage between the repeated polynucleotides is provided;

preferably, n is 2;

preferably, the recombinant expression vector comprises a pET series vector, a shuttle vector, a phage or a viral vector;

more preferably, the recombinant expression vector is pET-32a.

Further, the recombinant expression vector further comprises a polynucleotide encoding an amino acid sequence capable of being cleaved by TEV protease;

preferably, the 3 'end of the polynucleotide encoding the amino acid sequence capable of being cleaved by the TEV protease is directly linked to the 5' end of the first of said repeat polynucleotides.

In a fourth aspect, the present invention provides a recombinant host cell, wherein the recombinant host cell comprises a recombinant expression vector according to the third aspect of the invention;

preferably, the recombinant host cell is a prokaryotic cell, a yeast or a eukaryotic cell;

more preferably, the recombinant host cell is E.coli BL21 (DE 3).

A fifth aspect of the present invention provides a method for producing the peptide according to the first aspect of the present invention, wherein the method comprises the steps of S1 to S2:

s1: fermentatively culturing the recombinant host cell of claim 6 to induce expression of the peptide;

s2: the peptide was collected and purified.

Further, step S2 comprises purifying the peptide using a Ni affinity column and/or an ion exchange column, and optionally comprises cleaving the peptide;

the peptide is preferably cleaved enzymatically with TEV protease.

The sixth aspect of the present invention provides the use of the peptide according to the first aspect of the present invention in at least one of the following (a) to (c):

(a) As or in the preparation of a whitening product;

(b) As or in the preparation of a product for inhibiting melanoblast;

(c) Can be used as or for preparing product for inhibiting melanin generation.

A seventh aspect of the present invention provides a product, wherein the product comprises the peptide according to the first aspect of the present invention, and the product has a function of whitening, inhibiting melanoblast, or inhibiting melanin production.

ADVANTAGEOUS EFFECTS OF INVENTION

Through the implementation of the technical scheme, the invention provides the peptide which is more similar to human body natural protein MSH-alpha, has good water solubility and strong stability, and has good functions of whitening, inhibiting melanoblast and inhibiting melanin generation. Meanwhile, the invention provides a preparation method of the peptide, which utilizes an escherichia coli expression system to realize large-scale production, can further improve the yield through the serial expression of the polypeptide gene, has simple operation process, and has obvious cost advantage and wide market application prospect compared with the traditional chemical synthesis process of the polypeptide. The product produced by the preparation method of the peptide provided by the invention has the advantages of accurate molecular weight, high purity and no obvious impurity components.

Meanwhile, experimental data show that the peptide provided by the invention can effectively inhibit the activity of tyrosinase, can effectively inhibit cells from generating melanin, has a good whitening effect, and provides effective help for development and production of whitening products.

Drawings

FIG. 1 shows the SDS-PAGE of the Trx-1T9 and the 1T9 polypeptides.

FIG. 2 shows the mass spectrometric detection of polypeptide 1T9.

FIG. 3 is a map of pET-32a-1T9 vector.

FIG. 4 shows the results of the measurement of the effect of the polypeptide 1T9 on the melanin production of cells; wherein # indicates that the difference is statistically significant (p < 0.05) compared to the blank control group; * Indicates that the difference is statistically significant (p < 0.05) compared to the model control group; TA represents the test substance polypeptide 1T9.

FIG. 5 shows the results of the measurement of the effect of the polypeptide 1T9 on tyrosinase activity; where # indicates that the difference is statistically significant (p < 0.05) compared to the blank control group; * Indicates that the difference has statistical significance (p < 0.05) compared with the model control group; TA represents the substance to be tested, i.e., polypeptide 1T9.

Detailed Description

The following describes embodiments of the present invention, but the present invention is not limited to these embodiments.

In the present invention, the meaning of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process. In this specification, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.

In the present invention, the terms "comprising," "having," "including," or "containing" may be inclusive or open-ended and do not exclude additional, unrecited elements or method steps. Also, the terms "comprising," "having," "including," or "containing" are intended to be inclusive and mean that there may be additional, unrecited elements or method steps.

In the present invention, the terms "peptide", "short peptide", "polypeptide", "protein" interchangeably refer to a string of at least two amino acid residues joined to each other by covalent bonds (e.g. peptide bonds), which may be recombinant, natural or synthetic peptides. The peptide may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

In the present invention, the term "amino acid" may include natural amino acids, unnatural amino acids, amino acid analogs, and all D and L stereoisomers thereof.

In the present invention, "hybridization" means the ability of a polynucleotide or oligonucleotide to bind to a substantially complementary sequence under stringent conditions, without non-specific binding between non-complementary objects occurring under these conditions. In this connection, the sequences are preferably 90 to 100% complementary. The property of complementary sequences capable of binding specifically to each other is applied, for example, in Northern or Southern blotting techniques, or in primer binding in PCR or RT-PCR. According to the present invention, hybridization occurs under medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions. Such hybridization conditions are described in Current Protocols in Molecular Biology, john Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, specific hybridization conditions are as follows: (1) Low stringency hybridization conditions are washed 2 times in 6 Xsodium chloride/sodium citrate (SSC), at about 45 ℃, then at least 50 ℃, in 0.2 XSSC, 0.1% SDS (for low stringency conditions, the wash temperature may be raised to 55 ℃); (2) Moderate stringency hybridization conditions are washed 1 or more times in 6 × SSC at about 45 ℃, then 0.2 × SSC,0.1% sds at 60 ℃; (3) High stringency hybridization conditions are washed 1 or more times in 6 × SSC, at about 45 ℃, then at 65 ℃, in 0.2 × SSC,0.1% sds and preferably; (4) Very high stringency hybridization conditions are 0.5M sodium phosphate, 7% SDS, 1 or more washes in 0.2X SSC,1% SDS at 65 ℃.

The peptide 1T9 of the present invention is composed of 10L-amino acids. The amino acid sequence is as follows: GMFRWFKPV (SEQ ID No. 1). The theoretical molecular weight of 1T9 is 1264.55Da.

The preparation of the peptides of the invention can be carried out by various production processes. The preparation can be carried out by conventional chemical synthesis processes, and the preparation can also be carried out by recombinant expression by fermentation processes, such as fermentation by using Escherichia coli.

The peptide of the invention may be encoded by a nucleotide sequence, for example the nucleotide sequence shown in SEQ ID No.2 (the specific sequence is GGTATGCCATTTTCGTTGGTTTAAACCGGTA). It is understood that due to codon degeneracy, one skilled in the art can readily alter the nucleotide sequence while retaining the original amino acid sequence. The nucleotide sequence may be cloned into an expression vector by conventional techniques, and the expression vector may then be transformed into a host cell. Transformation methods include, but are not limited to, electroporation, caCl ₂ Transformation, and the like. In the present invention, the expression vector may be a conventional vector such as pET-26, pET-32, pGEX-6 p.

The peptides of the invention may be expressed by different organisms including, but not limited to, animal cells, plant cells, microbial cells, such as prokaryotes and eukaryotes. Preferably, the peptides of the invention are produced in the present invention using microbial cell fermentation. The microbial cell may be an enterobacteriaceae cell, such as an escherichia coli cell, e.g. BL21 (DE 3). It will be appreciated that one skilled in the art can select appropriate cells to express the peptides of the invention.

The peptides of the invention can be prepared and produced by conventional methods. For example, a host cell transformed with a polynucleotide of the present invention, such as E.coli; the peptides of the invention are then isolated by conventional isolation and purification techniques. Isolation and purification techniques include, but are not limited to, dialysis, ammonium sulfate precipitation, high performance liquid chromatography.

The peptide of the present invention comprises a sequence represented by SEQ ID No.1 or a sequence in which one or several amino acids are substituted, deleted and/or added in the sequence represented by SEQ ID No.1, and shows an activity of inhibiting melanoblast or melanin production or an activity of whitening. The "number" may be 2, 3,4, 5, 6, 7, 8, 9, 10 or 11.

Amino acid addition refers to addition of amino acids inside an amino acid sequence, such as the sequence of SEQ ID No.1, or addition of amino acids at the C-terminus or N-terminus of an amino acid sequence, and the added amino acids may be adjacent to each other in whole or in part, or none of the added amino acids may be adjacent to each other, as long as the peptide exhibits an activity of inhibiting melanoblasts or melanogenesis or an activity of whitening.

Amino acid substitution refers to the substitution of an amino acid residue at a certain position of an amino acid sequence, such as the sequence of SEQ ID No.1, with another amino acid residue, as long as the peptide exhibits an activity of inhibiting melanoblast or melanin production or an activity of whitening.

Amino acid deletion means that 1, 2 or 3 or more amino acids may be deleted from an amino acid sequence, such as the sequence of SEQ ID No.1, as long as the peptide shows an activity of inhibiting melanoblast or melanogenesis or an activity of whitening.

It is known to those skilled in the art that the peptides of the invention may be post-translationally modified at one or more positions between the amino acid sequences. Examples of post-translational modifications may include phosphorylation, acetylation, and deamidation.

The present invention also provides analogs of the peptides represented by SEQ ID No.1, as long as the analogs exhibit activity of inhibiting melanoblasts or melanogenesis or activity of whitening. These analogs may differ from the native peptide by amino acid sequence differences, by modifications that do not affect the sequence, or by both. These peptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis, or other known molecular biological techniques. Analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids).

In the present invention, the substitution may be a conservative amino acid substitution, which means that 3, preferably 2 or 1 amino acids are substituted with amino acids having similar or similar properties to the amino acid sequence of SEQ ID No.1 to form a peptide. These conservative variant peptides can be generated by amino acid substitutions according to table 1.

TABLE 1 amino acid substitution Table

The invention also provides a nucleic acid molecule comprising a nucleic acid sequence encoding a peptide of the invention. The nucleic acid may be DNA or cDNA. The nucleic acid molecule may consist essentially of a nucleic acid sequence encoding a peptide according to the invention, or may consist of only a nucleic acid sequence encoding a peptide according to the invention. Such nucleic acid molecules can be synthesized using methods known in the art. Due to the degeneracy of the genetic code, it will be understood by those skilled in the art that nucleic acid molecules of different nucleic acid sequences may encode the same amino acid sequence.

The invention also provides a vector comprising a nucleic acid sequence according to the invention. Suitable vectors are known in the art of vector construction and include selection of promoters and other regulatory elements, such as enhancer elements. The vectors of the invention include sequences suitable for introduction into a cell. For example, the vector may be an expression vector in which the coding sequence for the peptide is under the control of its own cis-acting regulatory elements, the vector being designed to facilitate gene integration or gene replacement by a host cell, and the like.

It will be understood by those of ordinary skill in the art that, in the present invention, the term "vector" includes DNA molecules, e.g., plasmids, phages, viruses or other vectors, which contain one or more heterologous or recombinant nucleic acid sequences. Suitable phage and viral vectors include, but are not limited to: lambdophage, EMBL phage, simian virus, verruca bovis, epstein-Barr virus, adenovirus, herpes virus, murine sarcoma virus, murine mammary carcinoma virus, lentivirus, and the like.

The method for producing the peptide of the present invention may comprise the steps of:

(1) Constructing genetically engineered bacteria, such as genetically engineered bacteria of Escherichia coli;

(2) Fermentation culture and induction expression of the genetic engineering bacteria;

(3) And (3) purifying and enzyme cutting the polypeptide.

Taking an escherichia coli genetic engineering bacterium as an example, the construction steps in the step (1) are as follows: optimizing and selecting a DNA fragment of the peptide 1T9, and performing codon optimization and splicing recombination on the fragment by using a PCR (polymerase chain reaction) method to obtain a complete recombinant DNA sequence; transferring the recombinant DNA sequence into an escherichia coli expression strain, and screening to obtain the escherichia coli genetic engineering strain.

The fermentation culture and induction expression steps of the escherichia coli genetic engineering bacteria in the step (2) are as follows:

a. selecting a single colony of the optimized escherichia coli genetic engineering bacteria from an LB flat plate, placing the single colony in 10ml of an LB culture medium, and culturing for 12-16 h at 220rpm and 37 ℃;

b. inoculating the bacterial liquid into an LB culture medium according to the proportion of 1 ₆₀₀ When the concentration is about 0.6, IPTG was added to the cells to a final concentration of 0.5mM for induction, and the cells were further cultured at 16 ℃ for 20 hours and collected by centrifugation.

In step (3), the peptide is purified as follows:

a. resuspending the bacteria with Tris buffer solution, carrying out ultrasonic disruption, and centrifuging to collect supernatant;

b. purifying the supernatant by using an affinity column to obtain the recombinant 1T9 fusion protein;

c. removing the fusion protein by TEV enzymolysis to release free 1T9 peptide;

d. the 1T9 peptide in the solution is purified by dialysis, reverse phase column, or the like.

Examples

The present invention is further illustrated by the following examples, but any examples or combination thereof should not be construed as limiting the scope or embodiment of the present invention. The scope of the invention is defined by the appended claims, and the scope defined by the claims will be clearly understood by those skilled in the art from this description and the common general knowledge in the field. Any modification or change can be made to the technical solution of the present invention by those skilled in the art without departing from the spirit and scope of the present invention, and such modifications and changes are also included in the scope of the present invention.

The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments are not indicated by manufacturers, and are conventional products which can be purchased commercially. In the following detailed description, numerous specific details are set forth in order to provide a better understanding of the invention. It will be understood by those skilled in the art that the present invention may be practiced without some of these specific details. In other instances, methods, means, devices and steps that are well known to those skilled in the art have not been described in detail so as not to obscure the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise indicated, all units used in this specification are international standard units, and numerical values and numerical ranges appearing in the present invention should be understood to include inevitable systematic errors.

Example 1: construction and expression of pET-32a-1T9 gene expression vector

(1) Construction of Escherichia coli genetic engineering bacteria

The gene whose E.coli codon bias was selected, i.e. GGTATGCCATTTTCGTTGGTTTAAACCGGTA (SEQ ID No. 2), was optimized according to the amino acid sequence of 1T9 (SEQ ID No.1: GMFRWFKPV). After connecting the 1T9 gene fragment to a TEV protein restriction enzyme site, the KpnI (NEB Corp.: R0136L) and XhoI (NEB Corp.: R0146L) restriction enzyme sites were inserted into a pET-32a expression vector (Beijing Shengyuan Corp. Gene technology Co., ltd.) to construct a pET-32a-1T9 expression vector (the specific structure of the vector is shown in FIG. 3, which contains a coding sequence of a Trx tag).

The recombinant expression vector pET-32a-1T9 is transformed into an escherichia coli expression strain BL21 (DE 3) (Merck company), and escherichia coli genetic engineering bacteria are obtained through screening. The specific process is as follows:

1: mu.l of the plasmid was taken in 100. Mu.l of E.coli competent cells BL21 (DE 3) and allowed to stand on ice for 30min.

2: the mixture was heat-shocked in a 42 ℃ water bath for 90s and then quickly placed on ice for 2min.

3: to the mixture was added 600. Mu.l of non-resistant LB medium and incubated at 37 ℃ for 1 hour at 220 rpm.

4: 200. Mu.l of this strain was applied evenly to LAB plates containing ampicillin resistance (10 g/L peptone, 5g/L yeast extract, 10g/L sodium chloride, 15g/L agar, 100. Mu.g/ml ampicillin).

5: the plates were cultured upside down in an incubator at 37 ℃ for about 20 hours until clearly visible colonies grew.

(2) Fermentation culture and induction expression of colibacillus gene engineering bacteria

Collecting bacteria: a single colony of the preferred Escherichia coli genetically engineered bacterium 1T9 is picked from an LB plate, placed in 10ml of LB medium (10 g/L peptone, 5g/L yeast extract, 10g/L sodium chloride), cultured at 220rpm and 37 ℃ for 12h-16h.

And (3) inducing expression: inoculating the bacterial liquid into an LB culture medium according to the proportion of 1 ₆₀₀ When the concentration is about 0.6, IPTG was added to the cells to a final concentration of 0.5mM for induction, and the cells were further cultured at 16 ℃ for 20 hours and collected by centrifugation.

Homogenizing and centrifuging to collect supernatant: and (3) resuspending the collected thalli by using a balanced working solution, cooling the bacterial liquid to be less than or equal to 15 ℃, homogenizing the bacterial liquid at high pressure twice, and collecting the bacterial liquid after the homogenization is finished. And subpackaging the homogenized bacterial liquid into a centrifuge bottle, centrifuging at 17000rpm and 4 ℃ for 30min, collecting supernatant, and taking the supernatant and precipitate for electrophoresis detection.

(3) Purification and restriction of recombinant polypeptides

Coarse purification: a. the column was washed with water and 5 CV's. b. Equilibration solution (200 mM NaCl, 25mM Tris,20mM imidazole) equilibrated the column. c. Loading: and adding the centrifuged supernatant into the column material until the liquid flows out. d. Cleaning the hybrid protein: 25mL of the wash solution (200 mM NaCl, 25mM Tris,20mM imidazole) was added until the solution was run out. e. Collecting the target protein: 25mL of the eluate (200 mM sodium chloride, 25mM Tris,250mM imidazole) was added, and flow-through was collected to obtain the desired polypeptide Trx-1T9, and the name of the flow-through sample was designated "elution".

Enzyme digestion: if the target polypeptide with the Trx label needs to be cut off, a proper amount of TEV protease with a His label can be added, after incubation for 16h at 4 ℃, the flow-through liquid is collected, namely the polypeptide 1T9 with the carrier protein Trx removed, and the name of the sample after enzyme cutting is marked as 'after cutting'.

Example 2: electrophoretic detection of peptide 1T9

The molecular weight and purity of the Trx-1T9 polypeptide and the Trx-1T9 polypeptide obtained in example 1 were checked by SDS-PAGE. The specific process is as follows: mu.l of the purified and digested polypeptide solution was taken, 10. Mu.l of 5X protein loading buffer (250 mM Tris-HCl (pH: 6.8), 10% SDS,0.5% bromophenol blue, 50% glycerol, 5% beta-mercaptoethanol) was added thereto, the mixture was boiled in boiling water at 100 ℃ for 10min, 10. Mu.l of each well was added to SDS-PAGE protein gel, and after running at 80V for 2h, protein staining was carried out with Coomassie brilliant blue staining solution (0.1% Coomassie brilliant blue R-250, 25% isopropanol, 10% glacial acetic acid) for 20min, and then protein staining was carried out with protein destaining solution (10% acetic acid, 5% ethanol). The detection result is shown in figure 1, the apparent molecular weight of Trx-1T9 is 18kDa, and the molecular weight corresponds to the Trx-1T9 polypeptide, which indicates that the polypeptide Trx-1T9 is correctly expressed; the molecular weight after enzyme digestion is less than the apparent molecular weight of Trx-1T9, which indicates that the protease digestion is complete.

Example 3: mass spectrometric detection of peptide 1T9

Since the theoretical molecular weight of the short peptide 1T9 is small, it cannot be detected and shown by conventional SDS-PAGE. Therefore, the protein molecular weight of the purified whitening short peptide 1T9 is measured: the samples were desalted by ziptipC18, then mixed with matrix (CHCA) and spotted on plates. Finally, matrix-assisted laser desorption ionization-time of flight mass spectrometer MALDI-TOF/TOF UltraflexreeTemTM, brucker, germany is used for analysis in reflection mode.

The theoretical molecular weight of the 1T9 polypeptide is 1264.55Da, which cannot be detected by conventional SDS-PAGE and needs to be identified by mass spectrometry. As shown in FIG. 2, the actual molecular weight of the 1T9 polypeptide of the invention, identified by mass spectrometry, was 1264.753Da, which is consistent with the theoretical molecular weight, and no significant impurities, no degradation occurred.

Example 4: polypeptide in vitro whitening efficacy assessment

Method: human melanocyte melanogenesis assay.

Principle of experiment: tyrosinase is the rate-limiting enzyme in the melanin synthesis pathway, which affects melanin production mainly by affecting tyrosine conversion to dopa, and oxidation of dopa to dopaquinone. Some whitening agents such as kojic acid and its derivatives and arbutin, etc. inhibit the production of melanin by inhibiting the activity of tyrosinase. The melanocyte stimulating hormone MSH-alpha can effectively promote the activity of tyrosinase of melanocyte, thereby promoting the synthesis of melanin. The method comprises the steps of inducing melanocytes through MSH-alpha, and detecting the inhibition result of a polypeptide sample (1T 9 polypeptide) on tyrosinase and the influence of melanin generation by a colorimetric method to evaluate the efficacy of the melanocytes.

Experimental Material：

Cell line: human melanoma cells, source: kunming cell bank.

Culture solution: DMEM medium (from Solebao) containing 10% FBS.

The culture conditions are as follows: 37 ℃ C., 5% CO ₂ Culturing under saturated humidity condition.

Melanocyte growth promoting hormone (α -MSH): 0.1. Mu.M.

DOPA:2mg/mL (from Sigma).

Positive control: arbutin (0.1 mg/mL) (Vanlong, guangzhou).

PBS：137mM NaCl，2.7mM KCl，10mM NaHPO ₄ ，2mM KH ₂ PO ₄ 。

The experimental steps are as follows:

evaluation of melanin content for whitening efficacy

1. Human melanoma cells were seeded into 6-well plates at a density of 1X 10 ⁵ Culturing for 18-24h in a culture medium per 2 mL/hole;

2. changing DMEM medium containing 10% FBS, and culturing for 12h;

3. the cells were divided into 6 groups and treated accordingly:

blank control group: the original culture solution was removed, 2mL of the culture solution was added, and the culture was continued for 3 days.

Model control group: the stock culture was removed, and 2mL of a culture containing 0.1. Mu.M MSH-. Alpha.was added thereto, followed by continuous culture for 3 days.

Positive control group: removing original culture solution, adding 2mL culture solution containing 0.1 μ M MSH-alpha and 0.1mg/mL arbutin, and continuously culturing for 3 days.

Sample group:

0.50mg/mL group: the original culture medium was removed, and 2mL of a culture medium containing 0.1. Mu.M MSH-. Alpha.and 0.50mg/mL of 1T9 polypeptide was added thereto, and the culture was continued for 3 days.

0.05mg/mL group: the stock culture was removed, and 2mL of a culture containing 0.1. Mu.M MSH-. Alpha.and 0.05mg/mL of 1T9 polypeptide was added and cultured continuously for 3 days.

0.01mg/mL group: the stock culture was removed, and 2mL of a culture containing 0.1. Mu.M MSH-. Alpha.and 0.01mg/mL of 1T9 polypeptide was added and cultured continuously for 3 days.

4. After exposure, removing the culture solution, washing with PBS for 2 times, collecting cells in each well by cell scraping, counting the cells, centrifuging at 10000rpm/min and 4 ℃ and collecting the cells;

5. adding 1M NaOH solution, and dissolving cells on ice to obtain cell sap;

6. heating the cell sap at 80 deg.C for 10min to crack melanosome;

7. the absorbance values of each set of cell fluid after lysis of melanosomes were measured at a wavelength of 405 nm.

Evaluation of tyrosinase Activity for whitening efficacy

1. Inoculating human melanoma cells into 6-well plate at a density of l × 10 ⁵ Culturing for 18-24h in a culture medium per 2 mL/hole;

2. changing DMEM medium containing 10% FBS and culturing for 12h;

3. the cells were divided into 6 groups and treated accordingly:

blank control group: the original culture medium was removed, 2mL of the culture medium was added, and the culture was continued for 3 days.

Model control group: the stock culture was removed, and 2mL of a culture containing 0.1. Mu.M MSH-. Alpha.was added and cultured continuously for 3 days.

Positive control group: removing original culture solution, adding 2mL culture solution containing 0.1 μ M MSH-alpha and 0.1mg/mL arbutin, and continuously culturing for 3 days.

Sample group:

0.50mg/mL group: the original culture medium was removed, and 2mL of a culture medium containing 0.1. Mu.M MSH-. Alpha.and 0.50mg/mL of 1T9 polypeptide was added thereto, and the culture was continued for 3 days.

0.05mg/mL group: the original culture medium was removed, and 2mL of a culture medium containing 0.1. Mu.M MSH-. Alpha.and 0.05mg/mL of 1T9 polypeptide was added thereto, and the culture was continued for 3 days.

0.01mg/mL group: the stock culture was removed, and 2mL of a culture containing 0.1. Mu.M MSH-. Alpha.and 0.01mg/mL of 1T9 polypeptide was added and cultured continuously for 3 days.

4. After exposure, removing the culture solution, washing with PBS for 2 times, collecting cells in each well by cell scraping, centrifuging at 10000rpm/min and 4 ℃ and collecting the cells;

5. adding 200 μ L cell lysis solution, treating by repeated freeze thawing, lysing cells, centrifuging at 10000rpm/min at 4 deg.C for 20min to obtain supernatant;

6. mu.L of each group of supernatants was added to a 96-well plate, 20. Mu.L of DOPA solution was rapidly added, and absorbance was measured at 475nm after shaking. After 30min of reaction at 37 ℃ the absorbance values were determined again.

Data analysis：

Relative content of melanin:

tyrosinase relative activity:

results of the experiment：

1. Analysis of melanin content

As shown in FIG. 4, in the results of the melanin content test, the relative melanin content of the positive control group was significantly reduced (p < 0.05) compared with the model control group, and the melanin content of the sample was significantly reduced (p < 0.05) at the three 1T9 polypeptide test concentrations of 0.50mg/mL, 0.05mg/mL and 0.01 mg/mL.

2. Tyrosinase Activity result analysis

As shown in FIG. 5, in the tyrosinase activity test results, compared with the model control group, the positive control group has significantly reduced tyrosinase relative activity (p < 0.05), and the samples have significantly reduced tyrosinase relative activity (p < 0.05) at the test concentrations of three 1T9 polypeptides of 0.50mg/mL, 0.05mg/mL and 0.01 mg/mL.

Therefore, under the test conditions, the 1T9 polypeptide has certain whitening effect at three test concentrations of 0.50mg/mL, 0.05mg/mL and 0.01 mg/mL.

Claims (10)

1. A peptide, wherein the amino acid sequence of said peptide comprises any one of the following (i) - (iii):

(i) An amino acid sequence shown as SEQ ID No. 1;

(ii) 1 or more amino acid residues are added, substituted, deleted or modified in the amino acid sequence shown as SEQ ID No.1, and the amino acid sequence with the activity of whitening or inhibiting melanoblast or inhibiting melanin generation of the sequence shown as SEQ ID No.1 is reserved;

(iii) An amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a polynucleotide sequence encoding the sequence shown as SEQ ID No.1 and which retains the activity of the sequence shown as SEQ ID No.1 of whitening or inhibiting melanoblasts or inhibiting melanin production, said stringent conditions being medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.

2. A polynucleotide encoding the peptide of claim 1.

3. The polynucleotide of claim 2, wherein the sequence of the polynucleotide comprises the sequence set forth in SEQ ID No. 2.

4. A recombinant expression vector comprising n repeats of the polynucleotide of claim 2 or 3, n being an integer of 1 or more, wherein when n is an integer of 2 or more, direct linkage between the repeated polynucleotides is achieved;

preferably, n is 2;

preferably, the recombinant expression vector comprises a pET series vector, a shuttle vector, a phage or viral vector;

more preferably, the recombinant expression vector is pET-32a.

5. The recombinant expression vector of claim 4, further comprising a polynucleotide encoding an amino acid sequence capable of being cleaved by TEV protease;

preferably, the 3 'end of the polynucleotide encoding the amino acid sequence capable of being cleaved by the TEV protease is directly linked to the 5' end of the first of said repeat polynucleotides.

6. A recombinant host cell comprising the recombinant expression vector of claim 4 or 5;

preferably, the recombinant host cell is a prokaryotic cell, a yeast or a eukaryotic cell;

more preferably, the recombinant host cell is E.coli BL21 (DE 3).

7. The method for producing a peptide according to claim 1, comprising the steps S1 to S2 as follows:

s1: fermentatively culturing the recombinant host cell of claim 6 to induce expression of the peptide;

s2: the peptide was collected and purified.

8. The method of claim 7, wherein step S2 comprises purifying the peptide using a Ni affinity column and/or an ion exchange column, and optionally comprises cleaving the peptide;

the peptide is preferably cleaved enzymatically with TEV protease.

9. Use of the peptide according to claim 1 in at least one of the following (a) to (c):

(a) As or in the preparation of a whitening product;

(b) As or in the preparation of a product for inhibiting melanoblast;

(c) Can be used as or for preparing product for inhibiting melanin generation.

10. A product comprising the peptide according to claim 1, wherein the product has a skin whitening, melanoblast inhibiting and/or melanogenesis inhibiting effect.

Images