CN116162133B - Wrinkle-removing short peptide and preparation method thereof - Google Patents

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a wrinkle-removing short peptide and a preparation method thereof. The application provides a short peptide, the amino acid sequence of which comprises a sequence shown as SEQ ID No. 1. The application also provides a polynucleotide for encoding the peptide, a recombinant expression vector containing the polynucleotide, a recombinant host cell containing the recombinant expression vector, a production method of the peptide, a tissue engineering product, a cosmetic or a medicine containing the peptide and having a wrinkle removing function, and application in preparing a wrinkle removing product. The wrinkle-removing short peptide provided by the application has the advantages of good water solubility, strong stability, high purity, simple production process and low cost, can enable the wrinkle-removing skin product to approach to the daily life of common people, and has wide market application prospect.

Description

Wrinkle-removing short peptide and preparation method thereof

PRIORITY AND RELATED APPLICATION

The present application claims priority from the chinese patent office, application number 202210681606.0, chinese patent application entitled "wrinkle-removing short peptide and method for its preparation," filed on day 15, 6, 2022, the entire contents of which are incorporated herein by reference.

Technical Field

The application relates to the field of genetic engineering, in particular to a wrinkle-removing short peptide and a preparation method thereof.

Background

The skin of humans and higher animals consists of epidermis, dermis, subcutaneous tissue. The epidermis is avascular and the energy and nutrition of the cells must be provided by the dermis microcirculation. The dermis is a living source of skin and is a layer of dense, tough and elastic tissue mainly composed of fibrous components (collagen fibers, elastic fibers and reticular fibers), glycoprotein, glucosamine, hyaluronic acid and the like.

Human studies confirm that the production of wrinkles is associated with facial muscle fiber overstimulation. Thus, in theory, the occurrence of wrinkles can be reduced by directly reducing the muscle movement contraction. Muscle contraction is regulated by neurotransmitters, and SNARE complexes are the source of signals transmitted by neurotransmitters. The botulinum toxin widely used in the market at present can inhibit the activity of nerve cells by inhibiting the function of SNARE complex, thereby achieving the purpose of removing wrinkles. However, the side effects of botulinum toxin are very great, and human beings have been researching functional analogues of botulinum toxin with the aim of minimizing the side effects on the premise of achieving the same.

The Argireline found by Lipotec is a functional analogue of botulinum toxin. Argireline consists of 6 amino acids, the amino acid composition is Ac-EEMQRR-NH ₂ . Functional experiments prove that Argireline has good skin permeability, can effectively inhibit the function of SNARE complex, has strong anti-wrinkle and anti-wrinkle activity, and is also called hexapeptide.

Currently, there are many families of well-known cosmetic brands in many countries to which Argireline hexapeptide has been added as an active ingredient for wrinkle removal. Some biotechnology companies in China sell the product. However, the current methods for producing hexapeptides are limited to chemical synthesis, and their high cost limits the wide use of such products. Therefore, in order to enable the skin nutritional products of these short peptides to approach the daily lives of common people, so that the common people have safe, stable and practical high-quality cosmetics, it is necessary to design and develop more efficient wrinkle-removing short peptides and explore a technique for preparing the wrinkle-removing short peptides on a large scale.

Disclosure of Invention

Problems to be solved by the application

The existing production methods of short peptide skin nutritional products such as hexapeptide are mostly limited to chemical synthesis, so that the problems of high production cost and limited application range of the products are caused. In this regard, the application provides a wrinkle-removing short peptide and a preparation method thereof, which can reduce the production cost and facilitate the large-scale production and application while achieving the excellent wrinkle-removing effect.

Solution for solving the problem

In a first aspect, the present application provides a short peptide, wherein the amino acid sequence of the short peptide comprises any one of the following (i) - (iv):

(i) An amino acid sequence as shown in SEQ ID NO. 1;

(ii) An amino acid sequence having 90%, 92%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence shown in SEQ ID No.1, which retains the wrinkle-removing effect of the sequence shown in SEQ ID No. 1;

(iii) An amino acid sequence in which 1 or more amino acid residues are added, substituted, deleted or modified in the amino acid sequence shown as SEQ ID NO.1 and the wrinkle-removing effect of the sequence shown as SEQ ID NO.1 is retained;

(iv) An amino acid sequence encoded by a nucleotide sequence which hybridizes with a polynucleotide sequence encoding a sequence as set forth in SEQ ID No.1 under stringent conditions, which are medium-high stringent conditions, high stringent conditions or very high stringent conditions, and which retains the wrinkle-removing effect of the sequence as set forth in SEQ ID No. 1.

In a second aspect, the present application provides a polynucleotide encoding a short peptide as described above, wherein the sequence of the polynucleotide comprises the sequence shown in SEQ ID NO.2, preferably the sequence of the polynucleotide is a sequence codon optimised for the expression system of the host cell.

In a third aspect, the present application provides a recombinant expression vector comprising, as described above, n repeats comprising the polynucleotide described above, n being an integer greater than or equal to 1, wherein when n is an integer greater than or equal to 2, the polynucleotides are directly linked to each other;

preferably, the recombinant expression vector comprises a pET series vector, shuttle vector, phage or viral vector;

more preferably, the recombinant expression vector is pET-32a.

Further, according to the above recombinant expression vector, the n is equal to 2.

Further, according to the recombinant expression vector described above, the recombinant expression vector further comprises a polynucleotide I, which is a polynucleotide encoding an amino acid sequence capable of being excised by TEV protease;

preferably, the polynucleotide I is directly linked to the 5' end of the first repeat polynucleotide.

Further, the recombinant expression vector further comprises a polynucleotide II, wherein the polynucleotide II is a polynucleotide for encoding an amino acid sequence shown as SEQ ID NO. 3;

preferably, the polynucleotide II is directly linked to the 3' end of the last repeat polynucleotide.

In a fourth aspect, the present application provides a recombinant host cell, wherein the recombinant host cell comprises the recombinant expression vector described above;

preferably, the recombinant host cell is a prokaryotic cell, yeast or eukaryotic cell;

more preferably, the recombinant host cell is E.coli BL21 (DE 3).

In a fifth aspect, the present application provides a method for producing the above-described short peptide, comprising the steps of: s1: introducing the recombinant expression vector into a host cell; s2: culturing the host cell in a production medium and producing the short peptide; s3: harvesting and purifying the short peptide, preferably purifying the protein with affinity column chromatography, preferably glutathione column chromatography; s4: optionally, the protein is cleaved, preferably with TEV protease.

In a sixth aspect, the present application provides a composition comprising the above-described short peptide, preferably the composition is a tissue engineering product, cosmetic or pharmaceutical.

In a seventh aspect, the present application provides the use of the above-described short peptide in the preparation of a wrinkle-removing product.

ADVANTAGEOUS EFFECTS OF INVENTION

Through implementation of the technical scheme, the novel wrinkle-removing short peptide prepared by the application is a sequence optimized by long-term screening, and has good water solubility and strong stability. The production method of the novel wrinkle-removing short peptide disclosed by the application adopts an escherichia coli expression system, is suitable for large-scale amplification, has very low production cost, and the sequence of the polynucleotide for encoding the wrinkle-removing short peptide carries out codon optimization aiming at the escherichia coli expression system, so that the yield is further improved. The novel production method of the wrinkle-removing short peptide disclosed by the application has high product purity, and no obvious impurity component is detected by utilizing a mass spectrometry method.

Meanwhile, experimental data show that the peptide provided by the application can effectively inhibit the expression of matrix metalloproteinase-I (MMP-1) in extracellular matrix for human skin fibroblasts induced by ultraviolet rays, has good anti-wrinkle effect, and provides effective help for the development and production of anti-wrinkle products.

In conclusion, the novel wrinkle-removing short peptide disclosed by the application has the advantages of good water solubility, strong stability, high purity, simple production process and low cost, can enable the wrinkle-removing skin product to approach to the daily life of common people, and has wide market application prospect.

Drawings

FIG. 1 shows the results of electrophoresis detection of samples during the purification of the wrinkle-removing short peptide 3T6 according to the present application; the sample of the centrifugal supernatant after the centrifugation of the thalli is shown in the lane 1, the sample of the precipitate after the centrifugation of the thalli is shown in the lane 2, the sample of the filler after the washing of the impurities is shown in the lane 3, the sample of the elution flow-through liquid is shown in the lane 4, the sample of the flow-through liquid after the enzyme digestion is shown in the lane 5, and the molecular weight Marker is shown in the lane 6.

FIG. 2 shows the mass spectrum identification result of the wrinkle-removing short peptide 3T6 according to the present application in the purified product. The theoretical molecular weight of the wrinkle-removing short peptide 3T6 is 1699.86Da, which is completely consistent with the detection result of mass spectrum.

FIG. 3 shows a schematic diagram of the structure of pET-32a-3T6 expression vector.

FIG. 4 shows the relative activity of human skin fibroblasts in groups to which various concentrations of the wrinkle-removing short peptide 3T6 (tagged) were added, relative to the cellular activity of human skin fibroblasts in 100% of the negative control group.

Figure 5 shows the effect of the wrinkle-removing short peptide 3T6 (tag-removed) on human skin fibroblast MMP-1 levels. # indicates that the difference was statistically significant (p < 0.05) compared to the negative control group (NT); * The differences are statistically significant (p < 0.05) in comparison to the model control group (M).

Detailed Description

The following describes embodiments of the present application, but the present application is not limited thereto.

In the present application, the meaning of "can" includes both the meaning of performing a certain process and the meaning of not performing a certain process. In this specification, "optionally" or "optionally" means that the event or circumstance described below may or may not occur, and that the description includes instances where the event occurs and instances where it does not.

In the present disclosure, the terms "comprising," "having," "including," or "containing" may be used to specify the presence of stated features, integers, steps, or groups thereof, but do not preclude the presence or addition of other features, integers, steps, or groups thereof. In the meantime, "comprising," "having," "including," or "containing" may also mean enclosed, excluding additional, unrecited elements or method steps.

In the present application, the term "short peptide", "polypeptide" or "protein" interchangeably refers to a string of at least two amino acid residues, which may be recombinant, natural or synthetic, linked to each other by covalent bonds (e.g. peptide bonds). The short peptide may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component). In the present application, the term "short peptide" may refer to a short peptide containing 2 to 40 amino acid residues.

The wrinkle-removing short peptide of the present application comprises a sequence represented by SEQ ID No.1, an amino acid sequence having 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with the amino acid sequence represented by SEQ ID No.1, or a sequence in which one or more amino acids are added, substituted, deleted or modified in the sequence represented by SEQ ID No.1, as long as the wrinkle-removing effect of the amino acid sequence of SEQ ID No.1 is retained by the wrinkle-removing short peptide of the present application. The "plurality" may be 2, 3, 4, 5, 6 or 7. Preferably, the wrinkle-removing short peptide of the present application consists of 13 amino acids, and the amino acid sequence thereof is: GEEMQRRENLYFQ (SEQ ID No. 1).

In the present application, the term "amino acid" may include natural amino acids, unnatural amino acids, amino acid analogs, and all their D and L stereoisomers.

In the present application, "homology" refers to the degree of similarity between nucleotide sequences of two nucleic acid molecules or between amino acid sequences of two protein molecules.

In the present application, amino acid addition may refer to addition of 1, 2 or 3 or more amino acids at any position of the C-terminal, N-terminal or the middle of the C-terminal and N-terminal of an amino acid sequence, as long as the modified sequence fully or partially retains the activity of the original amino acid sequence.

In the present application, amino acid substitution may refer to the replacement of an amino acid at a position in the amino acid sequence with another amino acid, as long as the altered sequence retains the activity of the original amino acid sequence completely or partially. Amino acid substitutions may be conservative amino acid substitutions, meaning that several amino acids are substituted by amino acids of similar or similar nature to form a peptide (conservative variant peptide) as compared to the original amino acid sequence. By way of example, these conservatively variant peptides may be generated from the amino acid substitutions: val, leu or Ile substitution for Ala, lys, gln, asn or His substitution for Arg, gln, his, lys or Arg substitution for Asn, glu or Asn substitution for Asp, ser or Ala substitution for Cys, asn or Glu substitution for Gln, asp or Gln substitution for Glu, ala substitution for Gly, asn, lys, gln or Arg substitution for His, leu, met, ala, val or Phe substitution for Ile, ile, met, ala, val or Phe substitution for Leu, asn, gln or Arg substitution for Lys, ile, leu or Phe substitution for Met, leu, val, ile, ala or Tyr substitution for Phe, ala substitution for Pro, thr substitution for Ser, ser or Val substitution for Thr, phe or Tyr substitution for Trp, trp, phe, thr or Ser substitution for Tyr, and Phe, ala, met, ile or Leu substitution for Val. Amino acid substitutions may also be non-conservative amino acid substitutions.

In the present application, amino acid deletion may refer to deletion of 1, 2 or 3 or more amino acids from the amino acid sequence, as long as the altered sequence retains the activity of the original amino acid sequence completely or partially.

In the present application, amino acid modifications may include modifications to the native sequence, such as modification of functional groups, intramolecular covalent bonding (e.g., ring formation between side chains), methylation, acylation, ubiquitination, phosphorylation, aminocaproylation, biotinylation, and the like.

In the present application, "hybridization" means the ability of a polynucleotide or oligonucleotide to bind to a substantially complementary sequence under stringent conditions, without non-specific binding between non-complementary objects occurring under these conditions. In this connection, the sequences are preferably 90 to 100% complementary. The nature of complementary sequences capable of specifically binding to each other is used, for example, in Northern or Southern blotting techniques, or in primer binding for PCR or RT-PCR. According to the application, hybridization occurs under medium stringency conditions, medium-high stringency conditions, or very high stringency conditions. Such hybridization conditions are described in Current Protocols in Molecular Biology, john Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, specific hybridization conditions are as follows: (1) Low stringency hybridization conditions are washed 2 times in 6 x sodium chloride/sodium citrate (SSC), at about 45 ℃, then at least 50 ℃, in 0.2 x SSC,0.1% sds (for low stringency conditions the wash temperature can be raised to 55 ℃); (2) Medium stringency hybridization conditions are washed 1 or more times in 6 XSSC, at about 45℃followed by 0.2 XSSC, 0.1% SDS at 60 ℃; (3) High stringency hybridization conditions are washed 1 or more times in 6 XSSC, at about 45℃followed by 65℃in 0.2 XSSC, 0.1% SDS and preferably; (4) Very high stringency hybridization conditions are 0.5M sodium phosphate, 7% SDS, washed 1 or more times in 0.2 XSSC, 1% SDS at 65℃followed by 65 ℃.

The application also provides nucleic acid molecules comprising a nucleic acid sequence encoding a short peptide of the application. The nucleic acid may be DNA or cDNA. The nucleic acid molecule may consist essentially of a nucleic acid sequence encoding a short peptide of the application, or may consist of only a nucleic acid sequence encoding a short peptide of the application. Such nucleic acid molecules can be synthesized using methods known in the art. Because of the degeneracy of the genetic code, it will be understood by those skilled in the art that nucleic acid molecules of different nucleic acid sequences may encode the same amino acid sequence.

In a preferred embodiment, the optimization is performed according to the codon preference of E.coli, based on the amino acid sequence of 3T6 (comprising the sequence shown in SEQ ID No. 1). Preferably, the polynucleotide of the application has the sequence: GGAGAAGAAATGCAACGTCGTGAAAATTTGTACTTCC AG (SEQ ID NO. 2).

In the present application, suitable vectors are known in the art of vector construction and include selection of promoters and other regulatory elements, such as enhancer elements. The vectors of the present application include sequences suitable for introduction into cells. For example, the vector may be an expression vector in which the coding sequence of the protein is under the control of its own cis-acting regulatory element, the vector being designed to facilitate gene integration or gene replacement in a host cell, etc. As understood by those of ordinary skill in the art, in the present application, a "vector" includes a DNA molecule, e.g., a plasmid, phage, virus, or other vector, that contains one or more heterologous or recombinant nucleotide sequences. Suitable phage and viral vectors include, but are not limited to: lambda phage, EMBL phage, simian virus, bovine wart virus, epstein-Barr virus, adenovirus, herpes virus, mouse sarcoma virus, murine breast cancer virus, lentivirus, etc. In a preferred embodiment, the recombinant expression vector of the application comprises a pET series vector, shuttle vector, phage or viral vector. More preferably, the recombinant expression vector is pET-32a.

The application also provides a recombinant expression vector, wherein the recombinant expression vector comprises n repeats comprising the polynucleotide, n is an integer greater than or equal to 1, and when n is an integer greater than or equal to 2, the polynucleotides are directly connected. In a preferred embodiment, the n=2.

In a preferred embodiment, the recombinant expression vector of the application further comprises a polynucleotide I, which is a polynucleotide encoding an amino acid sequence capable of cleavage by TEV protease; preferably, the polynucleotide I is directly linked to the 5' end of the first repeat polynucleotide.

In another preferred embodiment, the recombinant expression vector of the present application further comprises a polynucleotide II, which is a polynucleotide encoding an amino acid sequence as shown in SEQ ID No. 3; preferably, the polynucleotide II is directly linked to the 3' end of the last repeat polynucleotide.

In a preferred embodiment, the short peptide sequences of the application may be expressed with an addition of an ENLYFQ (SEQ ID No. 4) sequence at its N-terminus, which may be excised by TEV protease to directly obtain the sequence of SEQ ID No. 1. Preferably, the sequence of ENLYFQ (SEQ ID No. 4) is directly linked to the N-terminus of the short peptide of the application.

In another preferred embodiment, the short peptide sequences of the application may comprise the C-terminal sequence GEEMQRR (SEQ ID No. 3) upon expression, thereby increasing the stability of the expressed polypeptide. Preferably, the GEEMQRR (SEQ ID No. 3) sequence is directly linked to the C-terminus of the short peptide of the application.

In the present application, the host cell may be a eukaryotic cell, such as fungi and yeasts, a prokaryotic cell, such as a bacterium of the enterobacteriaceae family. In a specific embodiment, the host cell is E.coli BL21 (DE 3).

The application provides a production method of the wrinkle-removing short peptide, which comprises the following steps:

s1: introducing a recombinant expression vector of the application into a host cell; s2: culturing the host cell in a production medium and producing the short peptide; s3: harvesting and purifying the short peptide; s4: optionally, cleaving the protein.

In a preferred embodiment, the wrinkle-removing short peptide of the present application can be prepared by the following method. For example, it can be produced by the steps of: (1) constructing escherichia coli genetic engineering bacteria; (2) fermenting and culturing escherichia coli genetic engineering bacteria; (3) induction and expression of proteins; (4) purification and optionally cleavage of the protein.

In the step (1), the construction of the escherichia coli genetically engineered bacterium can be performed by the following steps:

a. designing an amino acid sequence of a wrinkle-removing short peptide 3T 6; b. synthesizing a nucleotide sequence of the corresponding amino acid sequence; c. cloning the nucleotide sequence of the wrinkle-removing short peptide 3T6 into an expression vector, transferring the expression vector into an escherichia coli expression strain, and screening to obtain escherichia coli genetic engineering bacteria;

in the above steps (2) and (3), the fermentation culture of the E.coli genetically engineered bacterium and the induction and expression of the protein may be performed by the following steps:

a. selecting a single colony of the optimized escherichia coli genetic engineering bacteria, and culturing the single colony in an LB culture medium at 35-38 ℃ overnight; b. inoculating and amplifying the bacterial liquid, culturing for 2.5-3 hours at 35-38 ℃, adding IPTG for induction, continuously culturing for 18-22 hours at 15-18 ℃, and centrifugally collecting bacterial bodies;

in the above step (4), the purification and cleavage of the protein may be performed by:

a. resuspending the bacteria with Tris buffer, sonicating, centrifuging and collecting supernatant;

b. and purifying the supernatant by using a glutathione affinity column to obtain the wrinkle-removing short peptide.

In the present application, "tissue engineering product" refers to a product for tissue engineering. Tissue engineering is an emerging discipline for constructing tissues or organs in vitro or in vivo by combining cell biology and material science.

Examples

The application is further illustrated by the following examples, but any examples or combinations thereof should not be construed as limiting the scope or embodiments of the application. The scope of the present application is defined by the appended claims, and the scope of the claims will be apparent to those skilled in the art from consideration of the specification and the common general knowledge in the field. Any modifications or variations of the technical solution of the present application may be carried out by those skilled in the art without departing from the spirit and scope of the present application, and such modifications and variations are also included in the scope of the present application.

The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. All reagents or equipment were commercially available as conventional products without the manufacturer's attention. Numerous specific details are set forth in the following description in order to provide a better understanding of the application. It will be understood by those skilled in the art that the present application may be practiced without some of these specific details. In other embodiments, methods, means, apparatus and steps well known to those skilled in the art have not been described in detail in order to not obscure the present application.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise indicated, all units used in this specification are units of international standard, and the numerical values and numerical ranges appearing in the present application are understood to include unavoidable systematic errors.

Example 1: construction of E.coli genetically engineered bacteria

a. In order to obtain the wrinkle-removing short peptide 3T6 after enzyme digestion, the amino acid sequence of the short peptide 3T6 is specifically designed as follows: GEEMQRRENLYFQ (SEQ ID NO. 1).

b. The nucleotide sequences for synthesizing the corresponding amino acid sequences are as follows: GGAGAAGAAATGCAACGTCGTGAAAATTTGTACTTCCAG (SEQ ID NO. 2).

c. Cloning the nucleotide sequence of the wrinkle-removing short peptide 3T6 into an expression vector, transferring the expression vector into an escherichia coli expression strain, and screening to obtain escherichia coli genetic engineering bacteria; the method comprises the following steps:

according to the amino acid sequence of the short peptide 3T6, the optimization is carried out according to the codon preference of escherichia coli, namely SEQ ID NO.2.

In this example, a target protein sequence was constructed using 2 repeats of the polynucleotide as an example.

The preparation method comprises the steps of repeating a 3T6 gene fragment (SEQ ID NO. 2) twice by Beijing Cheng Yuanke allied gene technology Co., ltd.) and connecting a gene sequence encoding a TEV protease cleavage site (namely ENLYFQ (SEQ ID NO. 4)) to the front end (namely the 5 'end of the 3T6 gene fragment), connecting a coding gene sequence corresponding to an amino acid sequence GEEMQRR (SEQ ID NO. 3) to the tail end (namely the 3' end of the 3T6 gene fragment), obtaining GAGAATCTATATTTTCAAGGAGAAGAAATGCAACGTCGTGAAAATTTGT ACTTCCAGGGCGAGGAAATGCAACGTCGCGAGAACCTGTATTTTCAGG GTGAAGAGATGCAGCGCCGT (the obtained fragment is named as C875LHB230-5 as shown in SEQ ID NO. 5), inserting a pET-32a expression vector (pET Cheng Yuanke allied gene sequence encoding Trx) through a cleavage site of KpnI (NEB company product number: R0136L) and XhoI (NEB company product number: R0146L), constructing a pET-32a-3T6 expression vector (recombinant expression plasmid) (see FIG. 3), and introducing the obtained fragment into escherichia coli gene map-screening engineering strain-positive vectors (E.coli) to obtain escherichia coli gene map-screening engineering-positive vectors (E.coli).

Example 2: fermentation culture of escherichia coli genetically engineered bacteria

a. The single colony of the optimized escherichia coli genetic engineering bacteria is selected and cultured in 5mL of LB culture medium at 37 ℃ overnight.

b. Bacterial liquid is prepared according to the following steps of 1:100 inoculated with amplified culture, cultured at 37 ℃ for 3 hours, added with 0.5mM IPTG for induction, and continuously cultured at 16 ℃ for 20 hours; the protein expressed at this time was 3T6, and the cells were collected by centrifugation.

Example 3: purification and optional cleavage of recombinant wrinkle-removing short peptide 3T6

Crude and pure: a. and (5) washing the column material with water. b. The column was equilibrated with equilibration solution (200 mM sodium chloride, 25mM Tris,20mM imidazole). c. Loading: the obtained cells were crushed and collected, centrifuged (the name of the sample of the supernatant obtained by centrifugation was designated as "bacterial liquid supernatant", the name of the sample obtained by centrifugation was designated as "precipitate"), and the supernatant obtained by centrifugation was added to the column until the liquid was completely flowed out. d. Cleaning the hybrid protein: 25mL of wash solution (200 mM sodium chloride, 25mM Tris,20mM imidazole) was added until the liquid was complete (the name of the washed filler sample was designated as "column"). e. Collecting the target protein: 25mL of an eluent (200 mM sodium chloride, 25mM Tris,250mM imidazole) was added, and the flow-through was collected to give the objective short peptide Trx-3T6 (the sample name of the flow-through was designated "elution"). In order to cut off the target short peptide of the Trx tag and obtain a short peptide 3T6 with an amino acid sequence shown as SEQ ID NO.1, adding a proper amount of TEV protease with a His tag, incubating for 16h at 4 ℃, and collecting a flow-through liquid (the name of a flow-through liquid sample after enzyme cutting is named as "after cutting"), namely the short peptide 3T6 for removing the carrier protein Trx.

SDS-PAGE detection is carried out on each sample in the process of purifying the wrinkle-removing short peptide 3T6, and the detection result is shown in figure 1, and the detection can not be carried out and displayed by conventional SDS-PAGE due to the fact that the theoretical molecular weight of the short peptide 3T6 is smaller. Thus, the purified wrinkle-removing short peptide 3T6 was subjected to mass spectrometry, the test sample was desalted by ziptipC18, then mixed with a matrix (CHCA) and spotted, and analyzed in a reflection mode using a matrix-assisted laser desorption ionization-time-of-flight mass spectrometer MALDI-TOF/TOF UltraflextremeTM, brucker, germany. The mass spectrum detection result is shown in fig. 2, and the theoretical molecular weight of the short peptide 3T6 is 1699.86Da, which is completely matched with the mass spectrum detection result.

Example 4: in vitro anti-wrinkle efficacy assessment

The testing method comprises the following steps: MMP-1 assay (UVA-induced anti-wrinkle model of human skin fibroblasts).

Experimental principle: MMP-1 is the most predominant enzyme degrading type I and type III collagen, and when MMP-1 is overexpressed by skin cells, the structure of the extracellular matrix of the dermis, especially the normal structure of collagen fibers and elastin fibers, is severely disrupted. The anti-wrinkle effect of the sample to be tested is evaluated by detecting the content of matrix metalloproteinase-I (MMP-1) in the extracellular matrix through an in vitro premature senility model of human skin fibroblasts induced by ultraviolet rays.

Experimental materials:

● Cell line: human skin fibroblasts. Purchased from the China academy of sciences representative culture Collection Committee Kunming cell bank. For cell activity testing.

Preparation of samples at various concentrations:

test sample group (TA): the short peptide 3T6 prepared in example 3, from which the tag Trx was removed, was taken as 0.5mL of a sample of the test polypeptide, and 2.0mL of DMEM containing 1% FBS was added thereto to prepare a solution having a concentration of 20.00% (v/v). Followed by dilution to 6.33%, 2.00%, 0.63%, 0.20%, 0.06%, 0.02% and 0.01% in that order.

Negative control group (NC): DMEM with 1% fbs (purchased from beijing solebao technologies limited).

The experimental steps are as follows:

1. human skin fibroblasts were routinely cultured. The density was 3.0 to 3.5X10 using DMEM medium (available from Beijing Soy Bao technology Co., ltd.) containing 1% FBS ⁴ Each mL of the cell suspension was inoculated into a 96-well cell culture plate, 150. Mu.L per well, and cultured for 18-24 hours.

2. The original culture solution in the wells is discarded, 150 mu L of samples to be tested with different concentrations are added into each well, and the mixture is returned to the incubator for incubation for 72 hours.

3. The plates were removed, 100. Mu.L of DMEM medium containing 1% FBS was added to each well, and 20. Mu.L of MTT solution was added thereto, and the culture was incubated in an incubator for 3-4 hours. The liquid in the wells was removed, 100. Mu.L of DMSO was added to each well, and after shaking for 10-15min with a shaker, absorbance was measured at 570nm wavelength with an ELISA reader.

Data analysis:

the relative cell activity of the samples to be tested at each concentration was calculated based on the following formula, taking the cell activity of the negative control group as 100%. The results are shown in FIG. 4.

In the above formula:

OD _TA absorbance measured at 570nm wavelength for the sample to be measured using an enzyme-labeled instrument;

OD _control To the medium of step 2, in which the concentration of the sample to be measured was 0, 150. Mu.L of a medium containing 1% FBS was added, and the absorbance was measured at 570nm using a microplate reader.

Cell activity assay:

as shown in fig. 4, based on the obtained relative cell activity results, the cell activity at 0.20%, 0.06%, 0.02% concentration was higher than that of the control group, and these three concentrations were selected as the concentrations for the subsequent efficacy experiment test.

● MMP-1 assay

Preparation of samples at various concentrations:

sample to be Tested (TA): the short peptide 3T6 prepared in example 3, from which the tag Trx was removed, was taken as a sample of the test polypeptide in an amount of 0.05mL, and 2.45mL of DMEM containing 1% FBS was added thereto to prepare a concentration of 2% (v/v). Followed by dilution to a total of three concentrations of 0.20%, 0.06% and 0.02%.

Positive Control (PC): vc (L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate) (purchased from Sigma) was diluted to 200. Mu.M Vc using DMEM with 1% FBS.

Negative Control (NC): DMEM with 1% fbs.

The experimental steps are as follows:

1. normal human skin fibroblast is treated with the method of 3.0-3.54 multiplied by 10 ⁴ The cells/well were inoculated into 24-well plates and cultured for 18-24 hours.

2. Cell layers were washed 2 times with PBS, and maintenance medium containing samples to be tested at different concentrations (DMEM medium containing 1% fbs (purchased from beijing soleba technology limited)) and maintenance medium containing no samples (DMEM medium containing 1% fbs (purchased from beijing soleba technology limited)) were added in groups of 3 duplicate wells, and left for 24 hours.

3. Removing the maintenance medium containing the sample to be tested and the maintenance medium without the sample, washing with PBS for 2-3 times, and covering with a small amount of PBS, 15J/cm ² UVA irradiates human skin fibroblasts. After the irradiation is finished, the cells are washed for 2 times by PBS, the negative control group and the model control group are replaced by the same maintenance medium, and the maintenance medium containing the sample to be detected or the positive control is added into the other groups for incubation for 48 hours.

4. Cell supernatants were collected, stored at-80℃and assayed for MMP-1 content using ELISA kits.

The detailed groupings are summarized in table 1 below.

TABLE 1 grouping of experiments

MMP-1 content determination:

the relative amounts of MMP-1 in the negative control (NT), positive Control (PC) and the sample groups to be Tested (TA) at different concentrations were calculated with the model control (M) as 100%, and the results are shown in FIG. 5.

Experimental results

As shown in fig. 5, the relative MMP-1 content was significantly increased (P < 0.05) in the model control group (M) compared to the negative control group (NT); compared with the model control group (M), the positive control group (PC) has obviously reduced MMP-1 relative content (P < 0.05), which indicates that the modeling is successful; compared with the model control group (M), the relative MMP-1 content of the sample group (TA, sample polypeptide) to be tested is obviously reduced by 66.74%, 92.26% and 81.12% (P < 0.05) at the test concentration of 0.20% (v/v), 0.06% (v/v) and 0.02% (v/v).

In conclusion, under the test conditions, the sample polypeptide has remarkable anti-wrinkle effect at the concentration of 0.20% (v/v), 0.06% (v/v) and 0.02% (v/v).

Industrial applicability

The wrinkle-removing short peptide 3T6 prepared by the method of the application consists of 13 amino acids, and the amino acid sequence of the wrinkle-removing short peptide is GEEMQRRENLYFQ (SEQ ID NO. 1). The application utilizes the escherichia coli fermentation process to prepare the short peptide 3T6 by recombinant expression, has simple production process and low cost, and is easy to popularize. The short peptide 3T6 has remarkable anti-wrinkle effect.

Claims (22)

1. A short peptide is characterized in that the amino acid sequence of the short peptide is shown as SEQ ID NO. 1.

2. A polynucleotide encoding the short peptide of claim 1, wherein the polynucleotide has the sequence shown in SEQ ID No.2 and is codon optimized according to the host cell expression system.

3. A recombinant expression vector comprising n repeats of the polynucleotide of claim 2, n being an integer greater than or equal to 1, wherein each repeat is directly linked to a polynucleotide when n is an integer greater than or equal to 2.

4. The recombinant expression vector of claim 3, wherein the recombinant expression vector comprises a pET series vector, a shuttle vector, or a viral vector.

5. The recombinant expression vector of claim 3, wherein the recombinant expression vector is a phage.

6. The recombinant expression vector of claim 3, wherein the recombinant expression vector is pET-32a.

7. The recombinant expression vector according to claim 3, wherein n is equal to 2.

8. The recombinant expression vector according to claim 3, further comprising a polynucleotide I, which is a polynucleotide encoding an amino acid sequence that is capable of being excised by TEV protease.

9. The recombinant expression vector of claim 8, wherein the polynucleotide I is directly linked to the 5' end of the first repeat polynucleotide.

10. The recombinant expression vector according to any one of claims 3 to 9, further comprising a polynucleotide II, which is a polynucleotide encoding an amino acid sequence as shown in SEQ ID No. 3.

11. The recombinant expression vector of claim 10, wherein the polynucleotide II is directly linked to the 3' end of the last repeat polynucleotide.

12. A recombinant host cell comprising the recombinant expression vector of any one of claims 3-11.

13. The recombinant host cell of claim 12, wherein the recombinant host cell is a prokaryotic cell or a eukaryotic cell.

14. The recombinant host cell of claim 12, wherein the recombinant host cell is a yeast.

15. The recombinant host cell according to claim 12, wherein the recombinant host cell is e.coli BL21 (DE 3).

16. A process for producing the short peptide according to claim 1, comprising the steps of:

s1: introducing the recombinant expression vector according to any one of claims 3 to 11 into a host cell;

s2: culturing the host cell in a production medium and producing the short peptide;

s3: the short peptides were harvested and purified.

17. The method according to claim 16, wherein in the step S3, the short peptide is purified by affinity column chromatography.

18. The method of producing according to claim 16, characterized in that the method further comprises the steps of:

s4: and (3) performing enzyme digestion on the protein.

19. The method according to claim 18, wherein in step S4, the short peptide is cleaved with TEV protease.

20. A composition comprising the short peptide of claim 1.

21. The composition of claim 20, wherein the composition is a tissue engineering product, a cosmetic or a pharmaceutical.

22. Use of the short peptide according to claim 1 for the preparation of a wrinkle-removing product.