CN104119448A - Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof - Google Patents
Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof Download PDFInfo
- Publication number
- CN104119448A CN104119448A CN201310151609.4A CN201310151609A CN104119448A CN 104119448 A CN104119448 A CN 104119448A CN 201310151609 A CN201310151609 A CN 201310151609A CN 104119448 A CN104119448 A CN 104119448A
- Authority
- CN
- China
- Prior art keywords
- label
- fusion rotein
- albumen
- slit3lrr2
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses fusion protein containing a leucine-rich repetitive sequence, and a preparation method and application thereof. Concretely, the invention relates to fusion protein, and the fusion protein possesses the following structure from N terminal to C terminal: A-X-E-Y1-Y2 (formula Ia) or A-Y2-Y1-E-X (formula Ib), wherein A is an optional secretion signal peptide, X is a member rich in leucine repetitive sequence 2 (LRRs2) of Slit3 protein (neuronal guidance factor 3), E is a restriction enzyme cutting site, Y1 is a first tag peptide member, Y2 is a second tag short peptide member and the second tag short peptide member is His tag member, and '-' represents a peptide bond or a peptide joint for connecting the above members. The fusion protein is beneficial for correct folding of LRR (leucine-rich repeat) and forming active functional polypeptide, and is capable of simply removing two tag members through once resection enzyme cutting, thereby preparing high-purity high-activity LRR sequence.
Description
Technical field
The present invention relates to field of biological molecule, relate in particular to and contain fusion rotein and method for making and the application of being rich in leucine tumor-necrosis factor glycoproteins.
Background technology
Axon guidance factor Slit be a kind of on evolving the secretor type extracellular matrix glycoprotein of high conservative, its gene plays a role in the formation of finding in central nervous system for 1988.Slit is the cell exocrine albumen that one group of relative molecular mass is 170-190kDa, one of aixs cylinder oriented molecule member of family that axon growth and neuronal migration are play the guiding role.
Slit albumen is to bring into play multi-functional guide molecule as the part of Roundabout (Robo), it not only have regulate neural axon growth direction, guide nerve cell migration, the function of the cellular form that affects the nerves differentiation.Research discovery in recent years, Slit also plays a role in the various physiological processes such as vasculogenesis, cardiac shape generation, tumor cell migration.
In vertebrates, there are 3 kinds of Slit genes, i.e. Slitl, Slit2, Slit3, and in various biological tissues wide expression.
The primary structure of Slit albumen comprises the exocytosis signal peptide of N end, 4 continuous leucic tumor-necrosis factor glycoproteins (leucine-rich repeat that are rich in, LRRs), also be named as D1-D4 structural domain, 6-9 EGF (epidermal growth factor) the sample functional zone of series connection, a laminin G spline structure territory and a C-terminal structural domain that is rich in cysteine.
In order to study and to apply, be necessary Slit albumen or its fragment is expressed and separation and purification.Yet because the content of native protein is limited, separation difficulty, therefore need to develop efficient recombinant production technique.
In recombinant production technique, produce efficiently conformation correct and be convenient to the target protein of separated and purifying, be usually comparatively difficult.Although conventional escherichia expression system can be expressed target protein in more efficient ground, usually need complicated renaturation technique, and the activity of the target protein after renaturation is often unsatisfactory.
When adopting eukaryotic expression system to express, although avoided renaturation technique, but target protein correct folding, how to realize high expression level and how effectively separate targets albumen remain difficult point, especially for some small peptide or containing for the polypeptide of tumor-necrosis factor glycoproteins.
Obtained containing after the nutrient solution (or tunning) of target protein, can adopt various means of purification to carry out separation and purification.At present, a kind of method of conventional separation and purification recombinant protein is affinity chromatography technology.
The His label adopting of take is example, 6 * His be specialized designs for the label protein of recombinant protein purifying work, be current modal phraseology, its expression and purification technology is all very ripe, and it is cheap to compare, its advantage is to express conveniently and substantially do not affect the activity of albumen.Conventionally band histidine protein can be adsorbed by nickel sepharose or nickel NTA sepharose in natural situation, but because His label is very little, if be folded to active site of protein in fusion rotein folding process, cause His label to be not easy to expose, be difficult to carry out protein purification work; Really also there is the problem that specificity is inadequate in His label simultaneously.
Conventionally; use the separating obtained lipidated protein of His label technique to be about 90% left and right; and in prior art; the technology and step that albumen is further purified is all comparatively loaded down with trivial details; and the albumen or the peptide Duan Changhui that add cause interference to the activity of target protein, cause that the expression of target protein is inaccurate or impurity is too much.
In sum, for simple and effective prepare high purity, highly active recombinant protein, this area is in the urgent need to the production technique of exploitation high-efficient simple.
Summary of the invention
Object of the present invention is just to provide a kind of method of production foreign protein of high-efficient simple, thereby high purity, highly active recombinant protein are prepared in simple and effective ground.
The invention provides a kind of fusion rotein, described fusion rotein is held to C end and is had the structure described in formula Ia or Ib from N:
A-X-E-Y1-Y2 formula Ia;
A-Y2-Y1-E-X formula Ib;
Wherein,
A is optional secreting signal peptide;
X is the leucic tumor-necrosis factor glycoproteins 2 of being rich in of Slit3 albumen (leucine-rich repeat2, LRR2) element;
E is restriction enzyme site;
Y1 is the first label polypeptide element;
Y2 is the second label small peptide element, and described the second label small peptide element is His label element;
"-" represents to connect peptide bond or the peptide linker of said elements.
In another preference, described fusion rotein has the secreting signal peptide that is positioned at N end.
In another preference, described secreting signal peptide is the secreting signal peptide that comes from the secreting signal peptide of Slit3 or come from other albumen.
In another preference, described secreting signal peptide has or does not have initial amino acid Met at its N end.
In another preference, the 46aa of the first described label polypeptide element.
In another preference, the "-" between X and E is peptide bond.
In another preference, between Y1 and Y2 without protease cutting site.
In another preference, the "-" between Y1 and Y2 is peptide bond.
In another preference, described restriction enzyme site is the restriction enzyme site of TEV proteolytic enzyme.
(LeuGluValLeuPheGlnGlyPro,SEQ?ID?NO.:3)
In another preference, described peptide linker length is 3-15 amino acid; 5-10 amino acid preferably.
In another preference, described Slit3 dietary protein origin is in Mammals.
In another preference, described Slit3 dietary protein origin is in people, rat, mouse; More preferably, derive from people.
In another preference, described Y1 comprises the modified form avidin label shown in SEQ ID NO.:2 (Strap II label), streptavidin (Strepavidin) label.
In another preference, described His label element comprises 8 * His label element and 6 * His label element.
In another preference, described Y1 is Strap II label, and Y2 is 8 * His label element.
In another preference, the aminoacid sequence of described Slit3LRR2 is as shown in SEQ ID NO.:5.
Second aspect present invention, provides a kind of polynucleotide of separation, the fusion rotein described in described polynucleotide encoding first aspect present invention.
In another preference, described polynucleotide sequence is as shown in SEQ ID NO.:6.
Third aspect present invention, provides a kind of expression vector, and described expression vector contains the polynucleotide described in second aspect present invention.
In another preference, described expression vector comprises carrier for expression of eukaryon, prokaryotic expression carrier.
Fourth aspect present invention, provides a kind of host cell, the polynucleotide described in second aspect present invention that described host cell has contained expression vector described in third aspect present invention or transfection.
In another preference, described host cell comprises mammalian cell; Preferably comprise Chinese hamster ovary celI, 293 cells.
Fifth aspect present invention, provides a kind of method of the Slit3LRR2 of preparation albumen, and described method comprises step:
(i), under suitable expression condition, cultivate the host cell as described in fourth aspect present invention, thereby express the fusion rotein described in first aspect present invention;
(ii) from culture system, separation and purification goes out the fusion rotein described in first aspect present invention;
(iii), to described fusion rotein, use the proteolytic enzyme for element E to carry out enzymolysis, thereby make Slit3LRR2.
In another preference, in step (ii), first use for the affinity chromatography of Y1 element and carry out separation for the first time; Then use for the affinity chromatography of Y2 element and carry out separation for the second time.
In another preference, in step (iii), also comprise Slit3LRR2 and polypeptide E-Y1-Y2 or Y2-Y1-E are divided out, thereby make the Slit3LRR2 of purifying.
Sixth aspect present invention, provides a kind of method of the Slit3LRR2 of preparation albumen, and described method comprises step:
Described fusion rotein, uses the proteolytic enzyme for element E to carry out enzymolysis, thereby makes Slit3LRR2 to the first aspect of the present invention.
Seventh aspect present invention, provides a kind of Slit3LRR2 albumen of purifying, is by the method manufacture described in the present invention the 5th or the 6th aspect.
In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and can combining mutually between specifically described each technical characterictic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, at this, tire out and state no longer one by one.
Accompanying drawing explanation
Fig. 1 is the collection of illustrative plates of original pcDNA3.1 (-) plasmid;
Fig. 2 has shown the schema of construction process of expression plasmid of the LRR2 structural domain partial sequence of the eukaryotic expression Slit3 albumen in embodiment 1;
Fig. 3 is the RT-PCR amplification electrophorogram of the LRR2 structural domain partial sequence of Slit3 albumen;
Fig. 4 is the pcr amplification electrophorogram of Strap II albumen label, His albumen label and TEV restriction enzyme site sequence;
Fig. 5 is the collection of illustrative plates of pcDNA3.1 (-)/Slit3LRR2 plasmid of building;
Fig. 6 is that Western Blot method detects the protein expression figure that builds plasmid.
Embodiment
The inventor is through extensive and deep research, be surprised to find that first, in one end of LRR sequence (especially C end), add the first label polypeptide element and the second label small peptide element, not only contribute to LRR correctly folding, form activated functional polypeptide, and can just cut two kinds of label element are removed by an enzyme extremely easily, thereby the high purity of making, highly active LRR sequence.Completed on this basis the present invention.
Term
As used herein, " albumen of the present invention ", " fusion rotein of the present invention ", " fusion rotein with formula Ia or Ib " are used interchangeably, all refer to have the fusion rotein of formula Ia or Ib, its N holds to C and holds and contain respectively optional secreting signal peptide, target gene, restriction enzyme site, the first label polypeptide element and the second label small peptide element; Or optional secreting signal peptide, the second label small peptide element, the first label polypeptide element, restriction enzyme site and target gene.A distinguishing feature of fusion rotein of the present invention is to have and can cut the continuous series connection label element of removing by enzyme at C end or N end.In addition, should be understood that described term also comprises active fragments and the derivative of recombination fusion protein.
As used herein, " separated " refers to that material separates (if natural substance, primal environment is natural surroundings) from its primal environment.As the polynucleotide under the native state in active somatic cell and polypeptide do not have separation and purification, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, for separation and purification.
As used herein, term " label protein ", " label ", " label protein element ", " label element " are used interchangeably, and all refer to can be used for the label polypeptide that separation and purification has the fusion rotein of formula Ia of the present invention or Ib.
Slit3 albumen and LRR thereof
The full length sequence of Slit3 albumen is as shown in SEQ ID NO.:15, and the nucleotide sequence of its albumen of encoding is as shown in SEQ ID NO.:14.The sequence of Slit3LRR2 albumen of the present invention is as shown in SEQ ID NO.:5, and the nucleotide sequence of its albumen of encoding is as shown in SEQ ID NO.:4.
Slit3 dietary protein origin of the present invention, in Mammals, preferably, derives from people, rat, mouse.
As used herein, " Slit3LRR2 albumen " refers to the LRR2 structural domain of Slit3 albumen.
As used herein, " the Slit3LRR2 albumen of purifying " refers to that Slit3LRR2 albumen does not basically contain natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can be purified Slit3LRR2 albumen with the purified technology of protein of standard.Substantially pure albumen can produce single master tape on non-reduced polyacrylamide gel.
Peptide bond or peptide linker
Between each element of fusion rotein with formula Ia or Ib of the present invention, can directly with peptide bond, be connected, or connect by peptide linker.As a kind of preferred mode of the present invention, between described each element of the fusion rotein with formula Ia or Ib by connecting between peptide bond, thereby form fusion rotein.
Conventionally, too short peptide linker can cause in fusion rotein inside sterically hindered, affects the correct folding of albumen, and long peptide linker may increase the immunogenicity of fusion rotein, also may affect activity and the function of fusion rotein.Therefore, can be used for peptide linker of the present invention and generally comprise 3-15 amino acid; Be preferably 5-10 amino acid.
The fusion rotein with continuous series connection label element
The aminoterminal of fusion rotein of the present invention (or carboxyl terminal) contains two label element (shown in Ia or Ib) continuously.
A-X-E-Y1-Y2 formula Ia
A-Y2-Y1-E-X formula Ib
Wherein, the definition of A, X, E, Y1, Y2 as mentioned above.
For the first label polypeptide element Y1, preferred Y1 is selected from lower group: modified form avidin label (Strap II label) (length is 46aa), streptavidin (Strep II label) (length is 9aa).
Modified form avidin label (Strap II label) is a kind of label protein of improveing on the basis of streptavidin (Strep II label), its peptide sequence is as shown in SEQ ID NO.:2, and the nucleotide sequence of its polypeptide of encoding is as shown in SEQ ID NO.:1.
Strap II label of the present invention can be identical or basic identical with the purifying mode of Strep II label, by the avidity with vitamin H, carries out chromatography.Compare with Strep II label, Strap II label (SEQ ID NO.:2) has increased the affinity of label, and its advantage is that purge process carries out under physiological condition, and the wash-out of the desthiobiotin mildness of use has been protected the activity of target protein.And, avoided the purification technique of conventional Strep II label need to carry out sealing treatment step.
Y2 is the second label small peptide element, and is His label element.Can be used for His label element of the present invention and comprise 6 * His or 8 * His small peptide, preferred, be 8 * His label element.
In addition between Y1 and Y2, without protease cutting site, and directly connect with peptide bond.
The protein expression scheme of continuous series connection label, be the advantage in conjunction with two kinds of carriers on the one hand, avoid the problem of existence, can optimize protein purification step on the other hand, after raising purifying, the purity of albumen reduces from the ionic pollution in animal derived pollution and purge process as far as possible.
In fusion rotein of the present invention, between element Y1 and X, be proteolytic enzyme restriction enzyme site, can comprise the restriction enzyme site for separating of purifying protein that this area is conventional, as TEV proteolytic enzyme, Hrv3C proteolytic enzyme.Supplementary condition are, in other element sequences of fusion rotein of the present invention, not contain this restriction enzyme site.
TEV proteolytic enzyme is the proteolytic enzyme of the 50kDa of Nla proteolytic enzyme after improving that derive from marmor erodens (TEV), and after design, to compare its stability better with natural TEV proteolytic enzyme.This proteolytic enzyme is used to excise the affinity tag of purifying rear fusion protein; And this enzyme is via 6 * His label purifying, to obtain (containing histidine-tagged), and purity reaches 99%, after cleavage reaction, can remove by Ni affinity chromatography.At PH7.0, in the time of 30 ℃, can reach optimum activity, but TEV proteolytic enzyme all there is activity in the broad range of PH5.5-8.5 and 4-30 ℃, and the selection of reaction conditions can be revised according to the situation of target protein.
Can be used for proteolytic enzyme restriction enzyme site of the present invention is a TEV proteolytic enzyme, as shown in SEQ ID NO.:3.
In addition,, at the N of fusion rotein of the present invention end, can there is or not have secreting signal peptide.When thering is secreting signal peptide, contribute to realize the secreting, expressing of fusion rotein, to improve purification efficiency.In the present invention, applicable secreting signal peptide comprise come from the secreting signal peptide of Slit3 or come that external source imports from the secreting signal peptide of other albumen.Wherein, derive from the nucleotide sequence of secreting signal peptide of Slit3 as shown in SEQ ID NO.:16, the signal peptide sequence of its coding is as shown in SEQ ID NO.:17.
Encoding sequence and recombinant production
For fusion rotein of the present invention, polynucleotide of the present invention can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.
The invention still further relates to the varient of above-mentioned polynucleotide, it is encoded protein fragments, analogue and the derivative of identical aminoacid sequence with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural occurs.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing in fact the function of its coded polypeptide.
As used herein, term " primer " refer to template pairing, under the effect of archaeal dna polymerase, can take that it synthesizes and the general name of the Nucleotide of living alone as a widow of the DNA chain of template complementation for starting point.Primer can be natural RNA, DNA, can be also any type of natural nucleotide.Primer can be even that non-natural Nucleotide is as LNA or ZNA etc.A special sequence in primer " haply " (or " substantially ") and template on a chain is complementary.Primer must with template on an abundant complementation of chain could start to extend, but the sequence of primer needn't with the sequence complete complementary of template.Such as, at 3' end and the 5' end of the primer of template complementation, add the preceding paragraph sequence not complementary with template, such primer still haply with template complementation.As long as have sufficiently long primer can with the sufficient combination of template, the primer of non-complete complementary also can form primer-template composite with template, thereby increases.
The Nucleotide full length sequence of each element of fusion rotein of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic conventionally.For pcr amplification method, can be according to published relevant nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually need to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplified is stitched together by proper order.
Once obtain relevant sequence, just can obtain in large quantity relevant sequence with recombination method.This is normally cloned into carrier, then proceeds to cell, then by ordinary method separation from the host cell propagation, obtains relevant sequence.
In addition, also can synthesize relevant sequence by the method for synthetic, especially fragment length more in short-term.Conventionally, by first synthetic a plurality of small segments, and then connect and can obtain the fragment that sequence is very long.
The method of application round pcr DNA amplification/RNA is optimized for and obtains gene of the present invention.Primer for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment of and purifying amplification separated by gel electrophoresis.
The present invention also relates to the carrier that comprises polynucleotide of the present invention, and the host cell producing through genetically engineered with carrier of the present invention or fusion rotein encoding sequence, and the method for preparing fusion rotein of the present invention.
By conventional recombinant DNA technology, can utilize polynucleotide sequence of the present invention to can be used to express or Restruction albumen.In general there are following steps:
(1). with the polynucleotide (or varient) of code book invention albumen of the present invention, or transform or the suitable host cell of transduceing with the recombinant expression vector that contains these polynucleotide;
(2). the host cell of cultivating in suitable substratum;
(3). separated, protein purification from substratum or cell.
Method well-known to those having ordinary skill in the art can be for building containing the DNA sequences encoding of albumen of the present invention and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, to instruct mRNA synthetic.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
Comprise above-mentioned suitable DNA sequence dna and the suitable carrier of promotor or control sequence, can be for transforming suitable host cell, with can marking protein.
Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, the bacterial cell of streptomyces; Fungal cell is as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS or 293 cells etc.
With recombinant DNA transformed host cell, can carry out with routine techniques well known to those skilled in the art.When host is prokaryotic organism during as intestinal bacteria, the competent cell that can absorb DNA can, in exponential growth after date results, be used CaCl
2method is processed, and step used is well-known in this area.Another kind method is to use MgCl
2.If needed, the also method of available electroporation that transforms is carried out.When host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical method is as microinjection, electroporation, liposome packing etc.
The transformant obtaining can be cultivated by ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to host cell used, substratum used in cultivation can be selected from various conventional mediums.Under the condition that is suitable for host cell growth, cultivate.When host cell grows into after suitable cell density, the promotor of selecting with suitable method (as temperature transition or chemical induction) induction, cultivates cell for some time again.
Extracellular can be expressed or be secreted into protein in the above methods in cell or on cytolemma.If needed, can utilize its physics, chemistry with other characteristic by various separation methods separated and purifying protein.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation processes, with protein precipitant, process the combination of (salt analysis method), centrifugal, the broken bacterium of infiltration, super processing, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
Expression vector
After having obtained the DNA sequence dna of code book invention fusion rotein, be connected into suitable expression vector, then proceeded to suitable host cell.Host cell after finally transforming by cultivation, obtains fusion rotein of the present invention by separation and purification.
Therefore, the present invention also provides the carrier of the nucleic acid molecule that comprises encoding said fusion protein.Described carrier also can comprise the expression regulation sequence being connected with the series of operations of described nucleic acid molecule, so that the expression of described fusion rotein.
As used herein, " operability is connected " or " being operationally connected in " refer to a kind of like this situation, and some part of linear DNA sequence can affect the activity of same linear DNA sequence other parts.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA is operationally connected in polypeptid DNA so; If transcribing of promotor control sequence, it is exactly to be operationally connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is to be operationally connected in encoding sequence so.Generally " be operationally connected in " mean adjoining, for secretion leader sequence mean in reading frame adjacent.
In the present invention, any suitable carrier can be used, such as some are for the clone of bacterium, fungi, yeast and mammalian cell and the carrier of expression, as Pouwels etc., cloning vector: described in laboratory manual (Elsevier latest edition).Can select various carrier known in the art as commercially available carrier.Such as, select commercially available carrier, the nucleotide sequence of then code book being invented to new fusion rotein is operationally connected in expression regulation sequence, forms protein expression vector.
Can be used for a kind of preferred carrier for expression of eukaryon of the present invention can be pcDNA3.1 (-) (purchased from Invitrogen company).
Expression vector comprises and is connected with suitable fusion rotein DNA sequence dna of transcribing with translational control sequence, as derives from the gene of Mammals, microorganism, virus or insect.Regulating and controlling sequence can comprise that transcripting promoter, operon, enhanser, ribosome bind site or control transcribes the proper sequence with translation initiation and termination.When fusion rotein sequence need to regulate functional nucleotide sequence, connect suitable regulating and controlling sequence.Like this, promoter sequence is connected encoding fusion protein DNA sequence dna front end.The ability copying in host cell is conventionally by replication initiation point control.Screening-gene for transformant identification also can add expression vector.
In addition, the encoding sequence of the signal peptide of non-natural Slit3 albumen can be introduced expression vector.For example: signal peptide (secretion guidance) sequence can with merge with fusion rotein encoding sequence, thereby make the fusion rotein of translation can be secreted into extracellular.Signal peptide can strengthen host cell to exocytosis chimeric polyeptides.Signal peptide can be cut from cell internal secretion process out at polypeptide.
Produce the method for Slit3LRR2 albumen
The present invention also comprises the method for the Slit3LRR2 albumen of producing fusion rotein and purifying, described method comprises cultivates the host cell that contains fusion rotein coding nucleic acid, thereby cultivate fusion rotein of the present invention, from culture system, separation and purification goes out fusion rotein claimed in claim 1; And to described fusion rotein, use the proteolytic enzyme for element E to carry out enzymolysis, thereby make the Slit3LRR2 albumen of purifying.
When the label element of separated fusion rotein of the present invention, can use respectively and carry out after twice separation for the affinity chromatography of different label element, the proteolytic enzyme re-using for restriction enzyme site carries out enzymolysis, thereby isolates the Slit3LRR2 albumen that purity is higher.
Described fusion rotein comprises Slit3LRR2 or its active fragments.Described method can comprise the fusion rotein that allows cell expressing encode, and the renaturation that makes the fusion rotein of expression.In addition described method also can comprise separation and/or the purifying of the fusion rotein of renaturation.
The character that can be basic homogeneous by the above-mentioned fusion protein purification preparing, for example, be single band on SDS-PAGE electrophoresis.For example, when recombinant protein is secreting, expressing, can adopt commercial ultra-filtration membrane to carry out separated described albumen, the product such as the company such as Millipore, Pellicon, first will express supernatant and concentrate.The method that concentrated solution can adopt gel chromatography is purifying in addition further, or adopts the method purifying of ion exchange chromatography.Such as anion-exchange chromatography (DEAE etc.) or cation-exchange chromatography.Gel matrix can be the matrix that agarose, dextran, polymeric amide etc. are usually used in protein purification.Q-or SP-group are comparatively desirable ion-exchange groups.Finally, available hydroxyapatite adsorption chromatography also, metal chelate chromatography, the methods such as hydrophobic interaction chromatography and RPLC (RP-HPLC) are to the further refining purifying of above-mentioned purified product.
Can utilize the affinity column of the specific antibody, acceptor or the part that contain Slit3LRR2 structural domain to carry out purifying to the amalgamation polypeptide of expressing.According to the characteristic of used affinity column, can utilize conventional method, as the amalgamation polypeptide of method elution of bound on affinity column such as high-salt buffer, change pH.
The nucleic acid of recombinant protein and this recombinant protein of encoding can utilize appropriate means preparation, for example, chemosynthesis, recombinant expressed, or it merges application.Referring to John Wiley & Sons, the < < Current Protocols in Molecular Biology > > that Inc2000 publishes, and the < < Molecular Coning:A Laboratory Manual > > of Cold Spring Harbor Laboratory Press1989 publication.
Beneficial effect of the present invention
1. the continuous series connection label element design of fusion rotein uniqueness of the present invention, especially through improvement Strap II label, it is of convenient length, make the albumen of expressing can access various modifications in host cell, can be in the situation that not affecting protein folding, farthest reduce its native conformation, Slit3LRR2 albumen can be expressed in host cell, its expression amount is high, and express complete, accurate.
2. the design of the continuous series connection label element of fusion rotein of the present invention makes the easier purifying of target protein, and label element can cut complete resection by an enzyme, and preparation technology is simple, and the Slit3LRR2 purity of protein making is high, active strong.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition, such as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber are weight percent and parts by weight.
Embodiment 1 builds pcDNA3.1 (-)/Slit3LRR2 carrier
Method: adopt circumscribed enzyme process to build plasmid.Build the process of plasmid, 3 sections of fragments of pcr amplification (signal peptide sequence, target sequence, restriction enzyme site+label protein sequence), carry out 3 fragments and connect insertion altogether.The primer using is respectively Primer1, Primer2 and Primer3.
Circumscribed enzyme process concrete steps:
1, preparation reaction system: carrier segments (BamHI enzyme is cut rear glue and reclaimed and measure concentration) and each 50ng of PCR fragment (after PCR, glue reclaims and measure concentration), 1ul10x excision enzyme buffer, supplements ddH
2o to 10ul;
2, place 5min on ice, add 1ul to be diluted to the exonucleaseⅢ (Takara company) of 20U/ul, after mixing, place 60min on ice;
3, add 1ul0.5M EDTA (pH8.0) solution termination reaction, afterwards 65 ℃ of water-bath 5min;
4, after water-bath, place 5min on ice;
5, transform and connect product.
Primer:
Primer1-F：CCACACTGGACTAGTTGCCCCACCAAGTGTACCTG?SEQ?ID?NO.:8
Primer1-R：ACCGAGCTCGGATCCTTAGGCGACGGCTGGAGGCCCA?SEQ?ID?NO.:9
Primer2-F：CCTCCAGCCGTCGCCATCTCCTGCCCTTCGCCCT?SEQ?ID?NO.:10
Primer2-R：ACCGAGCTCGGATCCTTAGAAGCACTCGCTGCTGAACC?SEQ?ID?NO.:11
Primer3-F：AGCAGCGAGTGCTTC?CTGGAAGTGCTGTTCCAG?SEQ?ID?NO.:12
Primer3-R：ACCGAGCTCGGATCCTTAGTGGTGGTGGTGGTGGTG?SEQ?ID?NO.:13
Result: shown in amplification Fig. 3 and 4 of target sequence, restriction enzyme site+label protein sequence, visible in figure, target sequence, the success of restriction enzyme site+label protein sequence amplification.
The successful expression of embodiment 2pcDNA3.1 (-)/Slit3LRR2
Method: for the plasmid that detects structure successful expression whether, by plasmid transfection in AD293 cell, through label protein 8 * His, be Western Blot afterwards, detect whether successful expression of fusion rotein.
Material: High glucose DMEM substratum, foetal calf serum are all purchased from HyClone company; Transfection reagent Magetran is purchased from Origene company; AD293 cell is cultivated with the High glucose DMEM nutrient solution containing 10% foetal calf serum.Inverted microscope is Olympus product, and fluorescence inverted microscope is Nikon company product.
Step:
2.1. frozen cell recovery is cultivated, gone down to posterity and make cell reach good growth conditions 3 to 4 times, carry out bed board detection.Magetran reagent transfection attached cell.
2.2. inoculate AD293 cell to 6 orifice plate, by the High glucose DMEM culture medium culturing containing 10% foetal calf serum, when density is about 70%-80%, can be used for transfection.By Magetran reagent and plasmid pcDNA3.1 (-)/Slit3LRR2 solution equilibria to room temperature, in centrifuge tube, prepare following mixed solution: 200 μ lopti-DMEM, 2 μ g plasmids, 6 μ l Magetran transfection reagents, concussion mixes rear standing incubated at room 10min.After the substratum of more renewing to cell, mixed solution is added in culture plate, shake up.Being placed in 37 ℃, 5%CO2 incubator cultivates, cultivate 12 and as a child removed substratum, be replaced by the fresh High glucose DMEM substratum containing 10% foetal calf serum and continue to cultivate, after transfection 48h, receive albumen and for Western Blot, detect the protein expression situation of plasmid.
2.3 add 4 ℃ of PBS that cell is scraped off and puts into 1.5ml centrifuge tube with cell after removing substratum, and 2000 to turn 5min centrifugal, remove supernatant.Then start lysing cell, by RIPA fine melt liquid and proteinase inhibitor, the ratio of 100:1 is added in cell precipitation after mixing, and 4 ℃ are rocked after cracking 1h, and 4 ℃, the centrifugal 30min of 14000g, getting supernatant is sample.Last test sample product protein concentration, and add Loading buffer to boil 8min, then leveling applied sample amount runs glue with SDS-polyacrylate hydrogel electrophoresis.Electrophoresis 3 hours, transferring film 2 hours, antibody incubation afterwards, primary antibodie 2 hours, colour developing exposure.
Result: Western Blot detected result as shown in Figure 6.Transfection plasmid histone is expressed normal, and the unloaded group of transfection does not detect protein expression, illustrates that constructed eukaryon expression plasmid can be normally at eukaryotic expression, plasmid construction success.
The test of embodiment 3 expression amounts
The HisGFP albumen of the concentration known that a purifying is obtained (20 μ g/ml) in contrast, carries out the mensuration of expressing quantity by the method for Western Blot.
Concrete grammar is with embodiment 2, and first transfectional cell, is afterwards Western Blot and detects.Difference is, while running SDS-PAGE electrophoresis, adds the HisGFP albumen of certain known quantity as positive control.
Exposure obtains after result, by band is carried out to gray analysis, calculates the expression amount of albumen.
The purifying of embodiment 4Slit3LRR2 albumen
Method and material: because the protein expression system adopting is Mammals efficient expression system, the cell of selecting is the Chinese hamster ovary cell CHO-S through optimizing that is widely used in protein expression, and in expression vector, there is the exocytosis of adding signal peptide, therefore adopt the method for suspension culture, make cell under high density case, secrete albumen as much as possible in nutrient solution, collect nutrient solution for follow-up protein purification.
Purification process:
4.1 first use the vitamin H affinity column for the first label polypeptide element to carry out chromatography, then use the Ni affinity column for the second label small peptide element to carry out chromatography; Or
4.2 first use the Ni affinity column for the second label small peptide element to carry out chromatography, then use the vitamin H affinity column for the first label polypeptide element to carry out chromatography.
First, the protein fragments that purifying is obtained carries out quantitatively, and the pro rata TEV of adding proteolytic enzyme carries out enzyme to be cut, and removes albumen label.
Enzyme cutting buffering liquid: 50mMTris7.5,500mM NaCl, the reaction system of 5%Glycerol, cuts in 4 ℃ of enzymes that spend the night.
Label protein fragment and TEV proteolytic enzyme that enzyme is cut in system later all can be removed by Ni affinity chromatography.
The mensuration of the Slit3LRR2 of embodiment 5 purifying
Method: after purifying obtains Slit3LRR2 albumen, employing Cell Biology Experiment is carried out to Function detection.Wherein, the preliminary judgement of protein function is carried out in cell scratch experiment and Transwell cell migration experiment.
Scratch experiment has been used for reference the cell in vitro healing experimental model of causing injury, and on the monolayer cell of cultivating in vitro, cut is caused injury, and then adds the ability of its inhibition tumor cell migration of observed drug.
Trysinization logarithmic phase cell, it is 2-10 * 10 that counting is adjusted cell concn
5individual/ml, the 24 every holes of orifice plate add 500ul cell suspension, in 37 ℃ of cell culture incubators, cultivate 24h, make cell attachment.With 10uL liquid-transfering gun rifle head (or aseptic toothpick), on monolayer cell, be " one " stroke trace, with PBS, clean 3 times, then add different Slit3LRR2 protein fragments (concentration gradient can the be set) solution preparing with 2%FBS substratum, get 3-4 parallel samples, invasive ability according to tumour cell is different, cultivates 12-24h for 37 ℃.Under mirror, take pictures and measure the area of cell migration.
The main 24 orifice plate cells that adopt of Transwell cell migration experiment.By coated Transwell cell (Millipore company) bottom film of collagen (collagen).Peptic cell, PBS washes 1-2 time, with the serum free medium re-suspended cell containing 0.2%BSA, adjusts cell density to 1-10 * 10 after counting
5, obtained cell suspension 200 μ l add Transwell cell, and under 24 orifice plates, chamber adds 500 μ l containing the substratum of serum, wherein adds different Slit3LRR2 protein fragments.Invasive ability according to tumour cell is different, cultivates 12-48h for 37 ℃.Adopt violet staining cell, under mirror, take pictures counting through cell count, evaluate the impact of Slit3LRR2 protein fragments on tumor cell invasion ability.
All documents of mentioning in the present invention are all quoted as a reference in this application, just as each piece of document, are quoted as a reference separately.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (11)
1. a fusion rotein, is characterized in that, described fusion rotein is held to C end and had the structure described in formula Ia or Ib from N:
A-X-E-Y1-Y2 formula Ia;
A-Y2-Y1-E-X formula Ib;
Wherein,
A is optional secreting signal peptide;
X is the leucic tumor-necrosis factor glycoproteins 2 of being rich in of Slit3 albumen (leucine-rich repeat2, LRR2) element;
E is restriction enzyme site;
Y1 is the first label polypeptide element;
Y2 is the second label small peptide element, and described the second label small peptide element is His label element;
"-" represents to connect peptide bond or the peptide linker of said elements.
2. fusion rotein as claimed in claim 1, is characterized in that, described Y1 comprises the modified form avidin label shown in SEQ ID NO.:2 (Strap II label), streptavidin (Strepavidin) label.
3. fusion rotein as claimed in claim 1, is characterized in that, described Y1 is Strap II label, and Y2 is 8 * His label element.
4. fusion rotein as claimed in claim 1, is characterized in that, the aminoacid sequence of described Slit3LRR2 is as shown in SEQ ID NO.:5.
5. separated polynucleotide, is characterized in that, described polynucleotide encoding fusion rotein claimed in claim 1.
6. an expression vector, is characterized in that, described expression vector contains polynucleotide claimed in claim 5.
7. a host cell, is characterized in that, described host cell has contained expression vector claimed in claim 6 or transfection polynucleotide claimed in claim 5.
8. host cell as claimed in claim 7, is characterized in that, described host cell comprises mammalian cell; Preferably comprise Chinese hamster ovary celI, 293 cells.
9. a method of preparing Slit3LRR2 albumen, is characterized in that, described method comprises step:
(i), under suitable expression condition, cultivate host cell as claimed in claim 8, thereby express fusion rotein claimed in claim 1;
(ii) from culture system, separation and purification goes out fusion rotein claimed in claim 1;
(iii), to described fusion rotein, use the proteolytic enzyme for element E to carry out enzymolysis, thereby make Slit3LRR2.
10. a method of preparing Slit3LRR2 albumen, is characterized in that, described method comprises step:
To fusion rotein claimed in claim 1, use the proteolytic enzyme for element E to carry out enzymolysis, thereby make Slit3LRR2.
The Slit3LRR2 albumen of 11. 1 kinds of purifying, is characterized in that, is by the method manufacture described in claim 9 or 10.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310151609.4A CN104119448A (en) | 2013-04-26 | 2013-04-26 | Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310151609.4A CN104119448A (en) | 2013-04-26 | 2013-04-26 | Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104119448A true CN104119448A (en) | 2014-10-29 |
Family
ID=51765105
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310151609.4A Pending CN104119448A (en) | 2013-04-26 | 2013-04-26 | Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104119448A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113544142A (en) * | 2019-02-27 | 2021-10-22 | 株式会社大熊制药 | Composition for preventing or treating muscle diseases comprising LRRD2 of Slit3 protein bound to albumin |
| JP2022522725A (en) * | 2019-02-27 | 2022-04-20 | デウン ファーマシューティカル カンパニー リミテッド | A composition for the prevention or treatment of bone-related diseases containing LRRD2, a Slit3 protein bound to albumin. |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101821283A (en) * | 2007-09-14 | 2010-09-01 | Scil技术股份有限公司 | Use of SLIT, NEPHRIN, ephrin or semaphorin for treatment of cartilage diseases |
| WO2012085178A1 (en) * | 2010-12-23 | 2012-06-28 | Sanofi | Robo1-fc fusion protein for use in the treatment of hepatocarcinoma |
-
2013
- 2013-04-26 CN CN201310151609.4A patent/CN104119448A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101821283A (en) * | 2007-09-14 | 2010-09-01 | Scil技术股份有限公司 | Use of SLIT, NEPHRIN, ephrin or semaphorin for treatment of cartilage diseases |
| WO2012085178A1 (en) * | 2010-12-23 | 2012-06-28 | Sanofi | Robo1-fc fusion protein for use in the treatment of hepatocarcinoma |
Non-Patent Citations (2)
| Title |
|---|
| CLARK，H.F.等: "GenBank：AAQ89243.1", 《GENBANK》 * |
| URSULA SCHAFFER等: "SnAvi－a new tandem tag for high-affinity protein-complex purification", 《NUCLEIC ACIDS RES.》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113544142A (en) * | 2019-02-27 | 2021-10-22 | 株式会社大熊制药 | Composition for preventing or treating muscle diseases comprising LRRD2 of Slit3 protein bound to albumin |
| JP2022522725A (en) * | 2019-02-27 | 2022-04-20 | デウン ファーマシューティカル カンパニー リミテッド | A composition for the prevention or treatment of bone-related diseases containing LRRD2, a Slit3 protein bound to albumin. |
| JP2022522723A (en) * | 2019-02-27 | 2022-04-20 | デウン ファーマシューティカル カンパニー リミテッド | A composition for the prevention or treatment of muscle diseases containing LRRD2, a Slit3 protein bound to albumin. |
| JP7295261B2 (en) | 2019-02-27 | 2023-06-20 | デウン ファーマシューティカル カンパニー リミテッド | Composition for prevention or treatment of muscle disease containing LRRD2 of Slit3 protein bound to albumin |
| JP7340027B2 (en) | 2019-02-27 | 2023-09-06 | デウン ファーマシューティカル カンパニー リミテッド | Composition for prevention or treatment of bone-related diseases containing LRRD2 of Slit3 protein bound to albumin |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Song et al. | Cultivation at 6–10 C is an effective strategy to overcome the insolubility of recombinant proteins in Escherichia coli | |
| CN108239633B (en) | Mutant of D-psicose-3-epimerase with improved catalytic activity and application thereof | |
| CN114805551B (en) | Recombinant type III collagen and preparation method thereof | |
| AU2012300885A1 (en) | Protein expression | |
| CN108912221A (en) | For producing auxilin, encoding gene, recombination fusion protein, recombinant expression carrier and the preparation method of recombination fusion protein | |
| CN113631712A (en) | Introduction of unnatural amino acids in proteins using a two-plasmid system | |
| CN105296454A (en) | Alginate lyase gene algp and its preparation method and expression | |
| CN104119445A (en) | Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof | |
| CN108239632B (en) | Mutant of D-psicose-3-epimerase with improved thermal stability and application thereof | |
| RU2354702C2 (en) | RECOMBINANT PLASMID DNA pHINS11 CODING HYBRID PROTEIN-HUMAN INSULIN PRECURSOR, Escherichia coli CELL, TRANSFORMED WITH RECOMBINANT PLASMID DNA pHINS11, Escherichia coli BACTERIA STRAIN JM109/pHINS11 - PRODUCER OF HYBRID PROTEIN-HUMAN INSULIN PRECURSOR, AND METHOD OF OBTAINING HUMAN INSULIN | |
| CN112941081A (en) | Coding sequence of fibronectin mutant with high expression quantity and strong activity and application thereof | |
| CN107937408B (en) | Epinephelus coioidesinsulinGene, encoded protein and application thereof | |
| CN104119448A (en) | Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof | |
| WO2017181920A1 (en) | Method for preparing recombinant human granulocyte colony-stimulating factor | |
| CN104119447A (en) | Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof | |
| Peng et al. | Preparation and characterization of monomers to tetramers of a collagen-like domain from Streptococcus pyogenes | |
| CN109136209B (en) | Enterokinase light chain mutant and application thereof | |
| CN110079539B (en) | Preparation method of prostatic acid phosphatase/granulocyte-macrophage colony stimulating factor | |
| CN114540399B (en) | Method for preparing L-valine, and gene mutant and biological material used by same | |
| CN104119446A (en) | Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof | |
| CN112522222B (en) | Novel tryptophan hydroxylase mutant and application thereof | |
| KR101724614B1 (en) | New Catalase Signal Sequences and Expression Method Using The Same | |
| KR20130141001A (en) | A novel vector system for isolation and purification of target proteins | |
| CN101775404A (en) | Method for highly expressing basic protein with prokaryotic expression system | |
| RU2376368C2 (en) | STRAIN OF BACTERIA Escherichia coli JM109/pHINS21 - PRODUCER OF HYBRID PROTEIN WITH HUMAN PROINSULIN AND METHOD FOR PRODUCTION OF HUMAN PROINSULIN |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141029 |