CN115786281A - CV-A5 recombinant virus for expressing photooxidation voltage fluorescent protein and application thereof - Google Patents

Abstract

The invention provides a CV-A5 recombinant virus capable of stably expressing a light oxygen voltage fluorescent protein LOV and application thereof. The CV-A5 recombinant virus capable of stably expressing LOV realizes genetic stability by inserting an LOV gene into a specific site, has the multiplication capacity and virus toxicity which are the same as those of wild virus strains, is convenient for infection or pathogenesis research of CV-A5 infected cells and animals, and can also be used for establishing rapid virus titer determination and rapid and high-throughput screening of neutralizing antibodies for humanized and murine anti-CV-A5 monoclonal therapy. Meanwhile, the construction strategy is also suitable for establishing a rapid neutralization experiment, screening antiviral drugs and researching animal infection or pathogenic mechanism mechanisms of enteroviruses (including but not limited to enteroviruses and coxsackieviruses).

Description

CV-A5 recombinant virus for expressing photooxidation voltage fluorescent protein and application thereof

Technical Field

The invention relates to the technical field of virus application, in particular to a Coxsackie virus A group 5 (CV-A5) recombinant virus for expressing a light oxygen voltage fluorescent protein (LOV) and application thereof.

Background

Coxsackievirus group a type 5 (CV-A5) belongs to the Picornaviridae family (Picornaviridae), the Enterovirus genus (Enterovirus). CV-A5 has triggered multiple outbreaks and epidemics in asia pacific regions since its first report in 1950. CV-A5 infection mainly causes Hand-foot-and-mouth disease (HFMD), herpangina and demethylation.

The CV-A5 genome is about 7.4kb and encodes a polyprotein (poly-protein) containing 2193 amino acids. The genome of CV-A5 is a single-stranded positive-stranded RNA, containing only one Open Reading Frame (ORF). The diameter of CV-A5 virus particle is about 27-30nm, and 20-face symmetrical sphere. The polyprotein comprises structural proteins and non-structural proteins, wherein the structural proteins are VP4, VP2, VP3 and VP1 respectively; nonstructural proteins 2A, 2B, 2C, 3A, 3B, 3C, and 3D. At the 5 and 3 ends of the genome, there are approximately 745nt of the 5 'noncoding region (UTR) and approximately 83nt of the 3' noncoding region, respectively.

At present, HFMD caused by CV-A5 is mainly transmitted through feces-oral transmission, air droplet transmission and contact transmission, children under 5 years old are the main susceptible people, and other people mainly have recessive infection. CV-A5 is in epidemic distribution in various places, and has stronger infection advantages after virus mutation and recombination. At present, no effective vaccine can prevent CV-A5 infection, and specific and efficient antiviral drugs are lacking clinically. Therefore, there is still a need to enhance the work on CV-A5.

The virus tracing is an important research mode of the virus, and is mainly characterized in that virus proteins are assembled into recombinant viruses after being marked by fluorescent proteins, or the recombinant viruses release fluorescent marks in infected cells, so that the virus can be traced and visualized. This fluorescent label tracer technique can be monitored in living cells or in living animals and used to study viruses.

In recent years, GFP has been successfully used for labeling various viruses such as HIV, adeno-associated virus, and herpes virus. However, the genome of an RNA virus cannot accommodate a large fragment of the foreign gene, and the size of the foreign gene does not exceed 10% of the viral genome fragment. Even if a gene of another fluorescent protein is successfully inserted into the genome of the virus at the gene level, the fluorescent protein gene is deleted when the RNA virus is replicated, and the insertion of a foreign gene destabilizes the genome of the RNA virus and affects the replication of the RNA virus itself.

In addition, only enterovirus 71 and CV-A16 are reported in the literature as enteroviruses successfully inserted with exogenous fluorescent protein genes. Both genes were constructed by adding a foreign fluorescent protein gene (eGFP) between the 5'UTR and VP4 protein genes and adding a splicing sequence of 2A, or by adding another viral self-splicing sequence and fluorescent protein sequence between the 3D protein and the 3' UTR sequence, and the foreign protein was cleaved during viral replication, thereby not affecting viral assembly. However, the same inappropriate insertion of a foreign gene destabilizes the genome of the recombinant virus carrying the fluorescent protein, and multiple passages cannot be performed.

Disclosure of Invention

Based on the above, there is a need to provide a coxsackievirus group A5 type (CV-A5) recombinant virus capable of expressing a light-oxygen voltage fluorescent protein (LOV) and applications thereof, which have genetic stability and can ensure the multiplication capacity and virus virulence simultaneously.

The invention adopts the following technical scheme:

the invention provides a CV-A5 recombinant virus capable of expressing LOV, which is formed by inserting an LOV gene with a sequence shown as SEQ ID NO.1 between a VP1 protein gene and a 2A protease gene of a CV-A5-M14-611 genome of a parent virus, wherein the whole gene sequence is shown as SEQ ID NO. 12.

CV-A5 recombinant virus capable of expressing LOV is preserved in China center for type culture Collection (CCTCC No. V202251) at 27.6.2022, the preservation address is university of Wuhan, china, and the classification name is human enterovirus CV-A5-M14-611-LOV.

The LOV-expressible CV-A5 recombinant virus is capable of growing on RD cells.

The invention also provides a construction method of the CV-A5 recombinant virus capable of expressing LOV, which comprises the following steps: performing inverse PCR by using KOD high fidelity polymerase (TOYOBO) to amplify gene fragments of pBR322 vector, 5'UTR-VP1 region, LOV region and 2A-3' UTR region, wherein adjacent fragments have 20bp homology arms; the PCR product was mixed with the vector, subjected to homologous recombination using In-Fusion HD cloning kit (Takara), transformed into E.coli, positive colonies were screened, and positive samples were sequenced and compared to obtain CV-A5-M14-611-LOV recombinant clone.

Furthermore, the construction method also comprises the step of rescuing the CV-A5-M14-611-LOV recombinant clone by using the RD cell.

In some of the examples, the primer sequences used for screening positive colonies are shown as SEQ ID NO.10 and SEQ ID NO.11, respectively.

In some embodiments, the cloning primer sequences used for the PCR amplification are shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, respectively.

The invention also provides a method for testing the titer of the CV-A5 recombinant virus capable of expressing LOV, which comprises the following steps: adding the cell suspension into a cell culture plate, adding a recombinant virus diluent, sequentially discarding supernatant from day 1 to day 7 after virus inoculation, scanning and reading fluorescence, setting an excitation wavelength to 520nm, and calculating the virus titer.

The invention also provides a method for detecting the neutralizing antibody or antibody titer of a micro sample by using the CV-A5 recombinant virus capable of expressing LOV, which comprises the following steps: culturing cells by adopting a cell pore plate to reach 60-90% cell fusion degree, adding recombinant virus and serum with different dilution times into the cell pore plate, discarding supernatant after the virus is infected for 48h, and washing the cells once by using PBS buffer solution; setting the excitation wavelength to 520nm, measuring the fluorescence intensity of the sample of each detection hole, and calculating the serum titer.

The CV-A5 recombinant virus capable of expressing LOV is applied to screening antiviral drugs and researching the infection pathogenic mechanism of CV-A5 infected cells or animals.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a Coxsackie virus A group 5 type recombinant virus capable of expressing an optical oxygen voltage fluorescent protein LOV gene, which is proved to have genetic stability through 10 passages of RD cells and the same proliferation capacity and virus virulence as wild virus strains. The fluorescence labeling recombinant virus can be used for establishing rapid determination of virus titer and rapid and high-throughput screening of neutralizing antibodies for human-derived and murine anti-CV-A5 monoclonal therapy by using an IMMUNSPOT instrument. The method can also be used for establishing a high-throughput screening platform of the antiviral drugs by an enzyme-linked immunosorbent assay detector, and can also be used for researching the infection or pathogenic mechanism of CV-A5 infected cells and animals.

Drawings

FIG. 1 is a schematic diagram of the construction of CV-A5-M14-611-LOV recombinant clones.

FIG. 2 shows the fluorescent expression of CV-A5-M14-611-LOV recombinant virus in P1, P10 and parental strain 611.

FIG. 3 shows genetic stability analysis of CV-A5-M14-611-LOV recombinant virus.

FIG. 4 shows structural protein cleavage analysis of CV-A5-M14-611-LOV recombinant virus.

FIG. 5 shows fluorescence measurements of different degrees of cytopathic effect.

FIG. 6 shows the P1-P10 titer of CV-A5-M14-611-LOV recombinant virus compared to the parental stock strain.

FIG. 7 is a comparison of the fluorescence method with a non-fluorescent conventional neutralization test method (conventional method).

FIG. 8 is a comparison of the construction strategy of two different fluorescent proteins at the same insertion site in comparative example 1; wherein, the injection of "√": indicating the presence of CPE; "-" means no fluorescence was observed; "+": indicating that a single or small amount of fluorescence was observed; "+++": indicating that more fluorescence spots were observed.

Detailed Description

The present invention is further described in detail below with reference to specific examples so that those skilled in the art can more clearly understand the present invention.

The following examples are provided only for illustrating the present invention and are not intended to limit the scope of the present invention. All other embodiments obtained by a person skilled in the art based on the specific embodiments of the present invention without any inventive step are within the scope of the present invention.

In the examples of the present invention, all the raw material components are commercially available products well known to those skilled in the art, unless otherwise specified; in the examples of the present invention, unless otherwise specified, all technical means used are conventional means well known to those skilled in the art.

Parental virus CV-A5-M14-611 (abbreviation 611): is obtained by repeatedly passing CV-A5 in vivo of suckling mice of different ages of days and purifying by plaque. Patent 2020100975882 and articles Jin WP, lu J, zhang XY, et al, efficacy of Coxsackievirus A5 Vaccine Candidates in an activity Immunized Mouse model J Virol.2021;95 (6) e01743-20.Model discloses this parental information.

pBR322 vector: from NCBI database, serial number J01749.1.

The nucleotide sequence of the LOV gene is as follows:

wherein in the above sequence

A 15 nucleotide sequence corresponding to 5 amino acids downstream of the synonymously mutated 2A protease site,

is an 18 nucleotide sequence corresponding to 6 amino acids upstream of the synonymously mutated 2A protease site.

The middle part sequence is an LOV region from NCBI database with sequence number KJ806995.1.

Example 1

As shown in FIG. 1, this example provides a construction method of recombinant CV-A5-M14-611-LOV clone, which includes the following steps:

according to the full-length sequence analysis of parent virus CV-A5-M14-611 (611 for short), an LOV gene (SEQ ID NO. 1) is selected to be added between VP1 protein and 2A protease genes of a virus genome. Wherein, 15 nucleotides of five synonymous mutated amino acid sequences GKFGQ (from 2A protein N-terminal amino acid) at the downstream of a 2A protein enzyme cutting site (TSITTTGKFGQ) are added at the N terminal of the LOV gene, and 18 nucleotides of six synonymous mutated amino acid sequences TSITTT (from VP1 protein C-terminal amino acid) at the upstream of the 2A protein enzyme cutting site are added at the C terminal of the LOV gene. Then, the 5'UTR region and the 3' UTR region of the virus were ligated to the pBR322 vector in a head-to-tail manner.

The pBR322 vector, the 5'UTR-VP1 region, the LOV region and the 2A-3' UTR region were reversely amplified by KOD high fidelity polymerase (TOYOBO) to obtain 4 segments, which correspond to the A, B, C and the D fragment during PCR amplification, respectively, and the adjacent fragments have 20bp homologous arms, and the amplification primers are shown in the following table:

construction of cloning primer Table for recombinant viruses

The PCR product was mixed with the vector according to 2:2:2:1, were mixed. Experiments were performed using In-Fusion HD cloning kit (Takara) for homologous recombination, by means of chemical transformation into Escherichia coli. Screening positive colonies by screening and identifying primers, and sequencing and comparing positive samples to obtain CV-A5-M14-611-LOV recombinant clones.

The screening and identifying primer sequences are shown in the following table:

cloning primer for screening and identifying inserted LOV gene

Screening recombinant cloning primer nomenclature	Sequence (5 '-3')
		22F	ATGTATGTTCCACCCGGAGC(SEQ ID NO.10)
22R	AACCAGTCCCAAATGCGTCA(SEQ ID NO.11)

This example further provides a method for rescuing recombinant CV-A5-M14-611-LOV virus, comprising the steps of: in the experiment, a plasmid kit is used for extracting the CV-A5-M14-611-LOV recombinant plasmid, and MluI restriction enzyme (NEB) is used for enzyme digestion of the recombinant plasmid to obtain the linearized CV-A5-M14-611-LOV recombinant plasmid. Viral RNA was transcribed according to the T7 in vitro transcription kit (Promega) and designated rCV-A5-M14-611-LOV. rCV-A5-M14-611-LOV was transfected into RD cell culture plates (6 well plates) with a cell confluency of 60% at a transfection dose of 5. Mu.g according to the Lipofectamine 3000 transfection reagent instructions, and the transfected six well plates were incubated at 37 ℃ in A5-vol CO2 incubator for 48 hours with a CPE of 90%, and the fluorescence expression was observed.

The harvested virus was designated CV-A5-M14-611-LOV-P0.

The whole nucleotide sequence of the recombinant viral gene obtained in this example was as follows:

italicized with bolder

As a primer sequence, an inaccurate viral sequence.

The complete amino acid sequence of the recombinant virus is as follows: .

MGAQVSTTKTGSHENGNIATGGSTINYTNINYYRDSYAAAATRQDFTQDPNKFTSPVLDALREVAPPLKSPSAEACGYSDRVAQLTVGNSTITTQEAANIIVGYGEWPEYCPDVDATAVDKPTRPDVSVNRFYTLSAKMWQKESKGWYWKFPDILTEKGVFGQNVQFHYLYRSGFCVHVQCNASKFHQGALLVALMPEHVVAGMGAGDKPSTAPHPDYKATQPGPDGAELQYPYVLDCGVPISQLLICPHQWINLRTNNCATIIMPYINSVPYDSAINHCNFTLFVIPVSPLNYDAGATAAIPITVTVAPLCAEFGGLRQAVSQGLPVEIKPGSYQFLTTDDEVSAPILPGFQPTPEIHIPGEVRNLLELCQVETILEINNTTDTHGMSRLLIPVSAQTAADKLCASFRVDPGRSGPWESTLLGQICRYYTQWSGSLEVTFMFTGSFMATGKMLIAYTPPGGEQPKTRDVAMLGTHVIWDFGLQSSVTLVIPWISNSHYRTVETGGIFDYYSTGIVTIWYQTNFVVPTGAPTSAYIIALGAAQKNFTLKLCRDTESVSQTAILQGDPIADIIEGAVTQTTNRAISGPIQPVTAANTQPSSHRLGTGQVPALQAAETGATSNATDESMIETRCVVNRHGVMETSVEHFFSRSGLAGILIIEDSGTSTKGYATWEIDVMGFVQLRRKLEMFTYMRFDAEFTFITAERNGKTSPILVQYMYVPPGAPVPTGRDTFQWQTATNPSVISKMTDPPAQVSVPFMSPASTYQWFYDGYPTFGEVPVTTNLNYGQCPNNKMGTFCIRMVSGVSTGKDVTVRIFMKLKHV

RAWVPRPIRSQPYLLKNYPNFDKANIVDASFNRTSITTTGKFGQQIEKNFVITDPRLPDNPIIFASDGFLELTEYSREEILGRNARFLQGPETDQATVQKIRDAIRDQRETTVQLINYTKSGKKFWNLLHLQPVRDQKGELQYFIGVQLDGSDHVTSITTTGKFGQQSGAVYVGNYRVVNRHLATHNDWANLVWEDSSRDLLVSSTTAQGCDTIARCNCQTGVYYCNSKRKHYPVSFSKPSLIFVEANEYYPARYQSHLMLAVGHSEPGDCGGILRCQHGVVGIVSTGGNGLVGFASVRDLLWLDEEAMEQGVSDYIKGLGDAFGTGFTDAVSREVEALKNYLIGSEGAVEKILKNLIKLISALVIVIRSDYDMVTLTATLALIGCHGSPWAWIKAKTASILGIPIAQKQSASWLKKFNDMANAAKGLEWVSNKISKFIDWLKEKIIPAAKEKVEFLNNLKQLPLLENQISNLEQSAASQEDLEAMFGNVSYLAHFCRKYQPLYATEAKRVYTLEKRMNNYMQFKSKHRIEPVCLIIRGSPGTGKSLATGIIARAIADKYHSSVYSLPPDPDHFDGYKQQVVTVMDDLCQNPDGKDMSLFCQMVSTVDFIPPMASLEEKGVSFTSKFVIASTNASNIIVPTVSDSDAIRRRFYMDCDIEVTDSYKTDLGRLDAGRAAKLCSENNTANFKRCSPLVCGKAIQLRDRKSKVRYSVDTVVSELIREHNNRSAIGNTIEALFQGPPKFRPIRISLEEKPAPDAISDLLASVDSEEVRQYCRDQGWIIPETPTNVERHLNRAVLVMQSIATVVAVVSLVYVIYKLFAGFQGAYSGAPKQVLKKPILRTATVQGPSLDFALSLLRRNIRQVQTDQGHFTMLGVRDRLAVLPRHSQPGKTIWIEHKLVNVLDAVELVDEQGVNLELTLVTLDTNEKFRDITKFIPESISAASDATLVINTEHMPSMFVPVGDVVQYGFLNLSGKPTHRTMMYNFPTKAGQCGGVVTSVGKVIGIHIGGNGRQGFCAGLKRSYFASEQGEIQWVKPNKETGRLNINGPTRTKLEPSVFYDVFKGNKEPAVLHSKDPRLEVDFEQALFSKYVGNTLHEPDEYVREAALHYANQLKQLDIDTTQMSMEEACYGTDNLEAIDLHTSAGYPYSALGIKKRDILDPTTRDVSKMKFYMDKYGLDLPYSTYVKDELRSIDKIKKGKSRLIEASSLNDSVYLRMAFGHLYETFHANPGTVTGSAVGCNPDVFWSKLPILLPGSLFAFDYSGYDASLSPVWFRALELVLREIGYGEEAVSLIEGINHTHHVYRNKTYCVLGGMPSGCSGTSIFNSMINNIIIRTLLIKTFKGIDLDELNMVAYGDDVLASYPFPIDCLELARTGKEYGLTMTPADKSPCFNEVNWENATFLKRGFKPDEQFPFLIHPTMPMKEIQESIRWTKDARNTQDHVRSLCLLAWHNGKQEYEEFVSTIRSVPVGKALAIPNYENLRRNWLELF*(SEQ ID NO.13)。

The sequences of CV-A5 recombinant viruses expressing LOV are characterized as follows:

the genome length of CV-A5-M14-611-LOV virus strains is 7768 nucleotide residues, the non-coding regions 5' -UTR and 3' -UTR have poly A tails with undetermined length after 1-745 and 7688-7768,3' -UTR respectively at the nucleotide positions of the genome, and the length of the coded poly protein (Polyprotein) is 2313 amino acid residues.

Wherein the amino acid sequences and positions of CV-A5-M14-611-LOV virus protein and LOV protein are respectively as follows:

the VP4 protein is an amino acid sequence from 1 st to 69 th as shown in SEQ ID NO. 13;

the VP2 protein is an amino acid sequence from 70 th to 324 th shown in SEQ ID NO. 13;

the VP3 protein is an amino acid sequence from 325 to 564 shown in SEQ ID NO. 13;

the VP1 protein is an amino acid sequence from 565 th position to 860 th position shown in SEQ ID NO. 13;

the LOV protein is an amino acid sequence from 861 to 983 shown in SEQ ID NO. 13;

the 2A protein is an amino acid sequence from 984 th to 1132 th positions shown in SEQ ID NO. 13;

the 2B protein is an amino acid sequence from 1133 to 1231 shown in SEQ ID NO. 13;

the 2C protein is an amino acid sequence from 1232 to 1560 shown in SEQ ID NO. 13;

the 3A protein is an amino acid sequence 1561-1646 shown in SEQ ID NO. 13;

the 3B protein is an amino acid sequence of 1647-1668 shown in SEQ ID NO. 13;

the 3C protein is an amino acid sequence at position 1669-1851 shown in SEQ ID NO. 13;

the 3D protein is the amino acid sequence of 1852-2313 shown in SEQ ID NO. 13.

Example 2

This example provides genetic stability analysis of the gene of CV-A5-M14-611-LOV recombinant virus, the analysis method comprising the steps of:

(1) The virus harvested in example 1 was designated CV-A5-M14-611-LOV-P0, and was subjected to serial passage for 10 times, and designated CV-A5-M14-611-LOV-P1 to CV-A5-M14-611-LOV-P10 (designated as 611-LOV-P1 to 611-LOV-P10 in sequence), and the virus was harvested, observed for fluorescence and photographed, and the results are shown in FIG. 2.

As can be seen from fig. 2: no fluorescence was observed after infection of cells with parental virus 611. 611-LOV-P1 and 611-LOV-P10, and observed significant fluorescence, thus confirming that CV-A5-M14-611-LOV recombinant virus stably expressed LOV protein, and the genome was stable for at least 10 generations.

(2) Viral RNA of 611-LOV-P1 and 611-LOV-P10 was extracted using a column-type viral RNA extraction and purification kit (Bio-Rad). After obtaining the virus RNA, the virus RNA utilizes a TaKaRa reverse transcription kit to obtain cDNA, the cDNA is used as a template, the identification recombinant cloning primer is used for identifying whether the LOV sequence is inserted or not, and the amplified PCR product is subjected to electrophoresis observation and sequence determination.

The electrophoresis results are shown in FIG. 3: the results showed that the LOV gene of virus 611-LOV-P10 still stably existed in the viral genome.

In addition, the sequencing results showed correct LOV gene insertion and sequence, with no mutations.

Example 3

This example was carried out on the viral proteins of CV-A5-M14-611-LOV recombinant virus, and the identification method included the following steps:

611-LOV-P1, 611-LOV-P10 and parental 611 were infected with RD cells grown in six well plates in full monolayers. When CPE was 90%, cell supernatant was aspirated and cells were lysed with SDS lysate (Bilun day). Lysed cells were aspirated and centrifuged at 10000 × g for 5 min. And (4) sucking the supernatant, and performing a subsequent Western blotting experiment. The primary antibody used in the Western blotting experiment is rabbit serum resisting CV-A5 whole virus, and the dilution is 1:10000; the secondary antibody is goat anti-rabbit antibody, and the dilution is 1:10000. the results of the experiment are shown in FIG. 4. The structural proteins of the corresponding virus in the 611-LOV-P10 generation are normally cleaved, i.e., the 2A protease successfully cleaves the N and C ends of the LOV protein and separates from the VP1 protein and the 2A protein, i.e., the recombinant virus is not formed into protein chimeric.

The above experimental tests show that: in the continuous passage process of the 611-LOV recombinant virus on RD cells, the LOV protein expressed by the 10 th generation virus has no obvious difference with the 1 st generation virus, and the phenomena that the LOV gene is lost in virus passage, the structural protein of the virus is abnormally sheared and the like do not occur.

Example 4

This example establishes a rapid assay for CV-A5-M14-611-LOV recombinant virus titer comprising the steps of:

2 x 10 to ⁵ one/mL of cell suspension was added to a 96-well cell culture plate and the next day a 10-fold serial dilution of virus was added. And sequentially discarding the supernatant from the 1 st day to the 7 th day after virus inoculation, scanning by using an IMMUNSPOT instrument to read fluorescence, setting the excitation wavelength to 520nm, recording the virus titer, and simultaneously determining the virus titration result by using a Karber method, thereby comparing the two methods. The test results are shown in FIG. 5.

In the experimental process, the measured virus titration result is close to that of the Karber method in days 2-3 after virus inoculation, and the detection time is short. The results were judged 2 to 3 days earlier than by Karber method by 4 to 5 days.

Example 5

This example compares CV-A5-M14-611-LOV recombinant virus to parental virus 611 titers, and includes the following steps:

1 × 10 a day in advance ⁵ one/mL of cell suspension was added to a 96-well cell culture plate at 100. Mu.L/well. The harvested 611-LOV-P1 to 611-LOV-P10 and the parental 611 virus were subjected to three independent 10-fold dilutions, and the calculation of virus titer was performed according to Karber's method, and the results are shown in FIG. 6.

The results show that: 611-the titer of the LOV recombinant virus is not obviously different from that of the parent virus, and the existence of the LOV gene does not have obvious influence on the propagation of the virus.

Example 6

In this embodiment, a method for detecting a trace amount of a sample neutralizing antibody or an antibody titer is established, and the specific operations are as follows: culturing cells in a 96-well plate until the cell fusion degree is 60-90%, adding a quantitative virus and 10 mouse serum samples with different dilution times into the cell-well plate, after the virus infection for 48h, discarding the supernatant, and washing the cells once by using PBS. And (3) scanning in an IMMUNSPOT instrument at the later stage, setting the excitation wavelength to be 520nm and the exposure value to be 3, detecting the fluorescence intensity of the sample holes one by the instrument to quickly calculate the serum titer, and setting a non-fluorescent conventional neutralization experimental method (referred to as a conventional method, refer to Jin WP, lu J, zhang XY, et al. Efficiency of Coxsackievirus A5 Vaccine amplified Mouse model. J Virol.2021;95 (6): e01743-20. Model) to compare with the result shown in figure 7.

The results show that: the results of the fluorescence method and the conventional neutralization experimental method have no statistical significance by using a statistical method t test, and the established fluorescence method can replace the conventional neutralization experiment, namely the rapid trace neutralization method established according to the CV-A5-611-LOV recombinant virus can improve the detection time of the antibody titer, avoid errors caused by manual observation of CPE and improve the accuracy.

Comparative example 1

Referring to the above experimental examples, this comparative example provides a comparative construction strategy study of fluorescent protein RFP and LOV gene at the same insertion position, and the detailed construction strategy and results are shown in FIG. 8.

The research result shows that red fluorescent protein gene (RFP) is inserted between VP1 and 2A protease, and recombinant virus capable of stably expressing RFP is not obtained. Under the same strategy, an LOV gene is inserted between VP1 and 2A protease, and the LOV gene can be stably expressed and fluorescence can be observed, so that the recombinant virus for detection experiments can be obtained.

It should be noted that the above examples are only for further illustration and description of the technical solution of the present invention, and are not intended to further limit the technical solution of the present invention, and the method of the present invention is only a preferred embodiment, and is not intended to limit the protection scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. A CV-A5 recombinant virus capable of expressing LOV is characterized in that the recombinant virus is formed by inserting an LOV gene with a sequence shown as SEQ ID NO.1 between a VP1 protein gene and a 2A protease gene of a parental virus genome, and the whole gene sequence is shown as SEQ ID NO. 12.

2. The recombinant virus CV-A5 expressing LOV according to claim 1, wherein the accession number is CCTCC No. V202251.

3. The LOV-expressible CV-A5 recombinant virus of claim 1, wherein said LOV-expressible CV-A5 recombinant virus is capable of growing in RD cells.

4. A method for constructing a recombinant CV-A5 virus capable of expressing LOV according to any one of claims 1 to 3, comprising the steps of:

performing reverse PCR amplification on gene fragments of the pBR322 vector, 5'UTR-VP1 region, LOV region and 2A-3' UTR region by using KOD high fidelity polymerase (TOYOBO), wherein adjacent fragments have 20bp homology arms;

the PCR product was mixed with the vector, subjected to homologous recombination using In-Fusion HD cloning kit (Takara), transformed into E.coli, positive colonies were screened, and positive samples were sequenced and compared to obtain CV-A5-M14-611-LOV recombinant clone.

5. The method of claim 4, further comprising the step of rescuing the recombinant CV-A5-M14-611-LOV clone with RD cells.

6. The construction method according to claim 4, wherein the primer sequences adopted by the screening of the positive colonies are shown as SEQ ID NO.10 and SEQ ID NO.11 respectively.

7. The construction method according to claim 4, wherein the cloning primer sequences adopted in the PCR amplification are respectively shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO. 9.

8. A method for testing the titer of CV-A5 recombinant viruses expressing LOV according to claims 1 to 3, comprising the steps of:

adding the cell suspension into a cell culture plate, adding a recombinant virus diluent, sequentially discarding supernatant from day 1 to day 7 after virus inoculation, scanning and reading fluorescence, setting an excitation wavelength to 520nm, and calculating the virus titer.

9. A method for detecting neutralizing antibodies or antibody titers in microsamples by using the LOV-expressible CV-A5 recombinant virus of claims 1 to 3, comprising the steps of:

culturing cells by adopting a cell pore plate to 60-90% of cell fusion degree, adding recombinant virus and serum with different dilution times into the cell pore plate, discarding supernatant after the virus is infected for 48 hours, and washing the cells once by using PBS buffer solution;

setting the excitation wavelength to 520nm, measuring the fluorescence intensity of the sample of each detection hole, and calculating the serum titer.

10. Use of the LOV-expressible CV-A5 recombinant virus of claims 1 to 3 for screening antiviral drugs, studying pathogenesis of infection of CV-A5 infected cells or animals.

Images