CN110607394A - Moloney murine leukemia virus titer detection kit and titer detection method - Google Patents
Moloney murine leukemia virus titer detection kit and titer detection method Download PDFInfo
- Publication number
- CN110607394A CN110607394A CN201810623031.0A CN201810623031A CN110607394A CN 110607394 A CN110607394 A CN 110607394A CN 201810623031 A CN201810623031 A CN 201810623031A CN 110607394 A CN110607394 A CN 110607394A
- Authority
- CN
- China
- Prior art keywords
- seq
- murine leukemia
- moloney murine
- virus
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention discloses a moloney murine leukemia virus titer detection kit and a titer detection method, wherein the detection kit contains a virus specific amplification primer pair, a target virus fragment for amplification of the virus specific amplification primer pair falls on a packaging signal psi of a moloney murine leukemia virus genome, so that whether a virus to be detected contains a fluorescent label or not is not influenced on titer detection, and the virus which is infected with cells and successfully integrated is detected by a qPCR method.
Description
Technical Field
The invention relates to the field of virus molecular biology, in particular to a moloney murine leukemia virus titer detection kit and a titer detection method.
Background
Moloney Murine Leukemia Virus (MMLV) is a species of retrovirus whose genome is two identical positive-stranded RNAs. After infection of a cell by a virus, its RNA genome can be reverse transcribed into DNA for integration into the host genome and stable passage, so MMLV can efficiently transfer the gene of interest (or RNAi) into primary cells or cell lines of mice or other animals. Due to this property of MMLV, recombinant MMLV is widely used in the fields of gene therapy, tumor research, and the like. Recombinant MMLV is produced in the laboratory by co-transfecting cells with an expression vector and a helper packaging plasmid and packaging the virus in the cells. And the packaged pseudovirus particles are secreted into an extracellular culture medium, and an MMLV product is obtained after concentration. The obtained virus can be directly used for in vitro cell experiments, and the virus can also be used for in vivo experiments after being purified.
Viral products need to be titrated prior to use. At present, the titer detection of MMLV mainly adopts a fluorescence titer method and an RT-qPCR method.
The fluorescence titer method is a method capable of accurately determining the titer of MMLV. After the virus liquid is used for infecting cells, the method can accurately reflect the virus titer and the actual infection activity of the virus by detecting the proportion of the successfully infected cells in a sample through a flow cytometer. However, the fluorescence titer method is only applicable to viruses containing fluorescent tags, and viruses without fluorescent tags cannot be detected, so that the method is limited in use.
The RT-qPCR method can detect the virus titer quickly. This method directly extracts total RNA of the virus, followed by RT-qPCR using RNA. The method can detect the nucleic acid content in the virus, and then calculate the virus titer. However, the RT-qPCR method can also count the nucleic acid of virus particles containing nucleic acid but losing infection activity, cannot truly and accurately reflect the true infection activity of the virus, can overestimate the titer of the virus, and therefore, limits the application of the method.
Disclosure of Invention
Based on this, it is necessary to provide a moloney murine leukemia virus titer detection kit and a titer detection method for accurately and rapidly determining the titer of the moloney murine leukemia virus.
A Moloney murine leukemia virus titer detection kit contains a virus specific amplification primer pair, wherein a target virus fragment of the virus specific amplification primer pair for amplification comprises a sequence fragment with a sequence shown as SEQ ID NO.1, or comprises a sequence fragment with a sequence complementary to the sequence shown as SEQ ID NO.1, or comprises a sequence fragment with a sequence shown as SEQ ID NO.1 or a complementary sequence thereof and one or more base deletions, substitutions or insertions.
In one embodiment, the sequences of the two primers of the virus-specific amplification primer pair are shown as SEQ ID NO.2 and SEQ ID NO.3, respectively, or as the corresponding complements of the sequences shown as SEQ ID NO.2 and SEQ ID NO.3, respectively.
In one embodiment, the moloney murine leukemia virus titer detection kit further comprises an internal reference amplification primer pair, wherein the internal reference fragment used for amplification of the internal reference amplification primer pair comprises a sequence fragment with a sequence shown as SEQ ID NO.4 or a sequence fragment with a sequence complementary to the sequence shown as SEQ ID NO. 4.
In one embodiment, the sequences of the two primers of the internal reference amplification primer pair are shown as SEQ ID No.5 and SEQ ID No.6, respectively, or as the corresponding complements of the sequences shown as SEQ ID No.5 and SEQ ID No.6, respectively.
In one embodiment, the moloney murine leukemia virus titer detection kit further comprises standards of known concentrations of the viral fragment of interest.
In one embodiment, the moloney murine leukemia virus titer detection kit further comprises a standard of known concentrations of an internal reference fragment.
A Moloney murine leukemia virus titer detection method using the Moloney murine leukemia virus titer detection kit of any of the above embodiments, the detection method comprising the steps of:
transducing moloney murine leukemia virus into cells, collecting the cells after a predetermined time of transduction, and extracting genomic DNA;
performing PCR amplification by using the extracted genome DNA as a template and the virus specific amplification primer pair, wherein an SYBR Green real-time fluorescent PCR reaction system is used as an amplification system;
and (4) carrying out dissolution curve analysis on the amplification product to obtain the virus titer.
In one embodiment, the method further comprises the step of gradient dilution of the moloney murine leukemia virus solution before the step of transducing the cells with the moloney murine leukemia virus solution, followed by transduction of the cells with the gradient diluted moloney murine leukemia virus solution.
In one embodiment, the moloney murine leukemia virus titer detection method further comprises the steps of performing the same PCR amplification treatment and dissolution curve analysis on the extracted genomic DNA of a standard substance of a virus fragment of interest with a known concentration.
In one embodiment, the procedure of PCR amplification is: circulating for 1 minute at 95 ℃; at 95 ℃ for 15 seconds and at 60 ℃ for 1 minute for 40 cycles.
The Moloney murine leukemia virus vector has various framework types and a complicated structure, and the homology of packaging signal regions among frameworks is found to be the highest through research. Therefore, the invention creatively finds out the target fragment suitable for various vector frameworks through homologous sequence comparison and analysis, designs the virus specific amplification primer pair by the target fragment, and has high universality. Specifically, the target virus fragment for amplification of the moloney murine leukemia virus titer detection kit and the titer detection method provided by the invention falls on a packaging signal psi of a moloney murine leukemia virus genome, so that whether a virus to be detected contains a fluorescent label or not has no influence on titer detection, and the virus which is infected with cells and successfully integrated is detected by a qPCR method, so that the moloney murine leukemia virus titer detection kit and the titer detection method provided by the invention can embody the real infection activity of the virus, are not influenced by the extraction efficiency of cell genome DNA, and have the advantages of rapidness, accuracy and convenience in detection.
Drawings
FIG. 1MMLV dissolution profile;
FIG. 2BMP2 dissolution curves;
FIG. 3 is a standard curve of Moloney murine leukemia virus, wherein the abscissa represents the copy number of the virus fragment of interest and the ordinate represents the Ct value, i.e., the number of cycles that the fluorescence signal in each reaction tube has undergone when it reaches a set threshold;
FIG. 4 is a standard curve of the BMP2 internal reference, in which the abscissa represents the copy number of the internal reference fragment and the ordinate represents the Ct value, i.e., the number of cycles that the fluorescence signal in each reaction tube has undergone when it reaches a set threshold.
Detailed Description
To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
1. Primer design
(1) Amplified target virus fragment and virus specific amplification primer pair:
MMLV-F1:5’-CGTGGTGGAACTGACGAGTT-3’(SEQ ID NO.2)；
MMLV-R1:5’-AGGTTCTCGTCTCCTACCAG-3’(SEQ ID NO.3)。
the sequence of the amplified target virus fragment by using the MMLV shuttle plasmid as a template is as follows: 5'-CGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGACTTCGGGGGCCGTTTTTGTGGCCCGACCTGAGTCCAAAAATCCCGATCGTTTTGGACTCTTTGGTGCACCCCCCTAATAGGAGGGATATGTGGTTCTGGTAGGAGACGAGAACCT-3' (SEQ ID NO.1), length 174 bp.
(2) Internal reference and internal reference amplification primer pair
BMP2(Homo sapiens bone morphogenetic protein 2) is used as the internal reference, and the sequences of the internal reference amplification primer pair are as follows:
BMP2-F1:5’-TAGGGTAGACAGAGCCAAGG-3’(SEQ ID NO.5)；
BMP2-R1:5’-AGCACAGGACAAGAAAGTCATTG-3’(SEQ ID NO.6)。
the genome DNA extracted from human-derived cells is taken as a template, and the sequence of the amplified reference fragment is as follows: 5'-TAGGGTAGACAGAGCCAAGGGCAGAGTTTTCAGAGATAGTATTGAAAAATCAAAGCCCAGGGCCCCAAAGTCTTTCTAATTTATAGTTGATCTGGGCCTGGTTTGGAAGATTTTGAATCCCAATCTAATCCCCGTGGGAGATCAATACTACAATCAATCTTATTGTTTCCACAATGACTTTCTTGTCCTGTGCT-3' (SEQ ID NO.4), length 194 bp.
It is understood that in other embodiments, the sequence of the amplified virus fragment of interest is not limited thereto, and the virus-specific amplification primer pair of the virus may be other sequence fragments including a sequence fragment having a sequence shown in SEQ ID NO.1, or a sequence fragment having a sequence complementary to the sequence shown in SEQ ID NO.1, or a sequence fragment having one or more base deletions, substitutions or insertions with the sequence shown in SEQ ID NO.1 or its complementary sequence. The internal reference amplification primer pair has the same principle.
Preparation of qPCR Standard
Respectively cloning the amplified target fragments to pMD by using the two primer pairs and utilizing a molecular cloning technologyTM18-T carrier. The constructed recombinant vector is subjected to double enzyme digestion by AhdI and NdeI, and the required large fragment is recovered and the concentration and the purity of the large fragment are determined by using NanoDrop. And (3) calculating the number of molecules of the sample meeting the purity according to the molecular weight of the fragment and the Avogastron constant, and taking the number of molecules as a virus quantitative standard substance. The specific calculation formula is as follows: sample copy number per 1 μ L fragment axnxn × 10-9and/M. A is the measured DNA concentration in ng/. mu.L; n is an Avogastron constant (6.02X 10)23Mol); m is the molecular weight of the fragment.
3. Viral transduction of 293T
(1) At a rate of 3X 10 per hole5The 293T cells were seeded into 6-well plates, and cells from one well were trypsinized and counted the next day before virus transduction, and the count was stored as B.
(2) mu.L of MMLV virus solution was diluted to 100. mu.L using 293T complete medium, 50. mu.L of the diluted virus solution was added to one well of a 6-well plate, 10. mu.L of polybrene (polybrene) was added at a concentration of 0.5mg/mL to facilitate transduction, one well was left untransduced by any virus as a negative control, and then returned to the incubator at 37 ℃ with 5% CO2The cultivation is continued under saturated humidity conditions.
4. Extraction of genomic DNA from cells
After 48 hours of viral transduction, cells were collected and genomic DNA was extracted using a blood tissue cell genome extraction kit (Tiangen Biochemical technology, Inc., model DP 304).
5. Dilution of standards
Diluting virus quantitative standard and internal reference standard to 10 degree with deionized water7、106、105、104、103copies/. mu.L. The detection method is at 103～107Has good linear relation in the range of the order of copies/interaction, and the correlation coefficient R2＞0.99。
Establishment of qPCR
And (3) taking the extracted cell genome DNA infected by the virus as a template, and respectively carrying out qPCR analysis on the virus genome and the reference gene in the target cell.
The reaction system is as follows: SYBR Green Real-time PCR Master Mix 10. mu.L, primers (10. mu.M concentration) 0.25. mu.L each, MMLV-transduced target cell genomic DNA 500ng or standard 1. mu.L, deionized water was added to a total volume of 20. mu.L. To reduce errors, more than 2 duplicate wells per sample should be used, with sterile water as a parallel control.
The qPCR adopts a two-step method, and the used instrument is an Applied Biosystems 7500 real-time fluorescent quantitative PCR instrument. The specific reaction procedure is as follows: circulating for 1 minute at 95 ℃; after 40 cycles of 15 seconds at 95 ℃ and 1 minute at 60 ℃ the dissolution curve was analyzed, see FIGS. 1 and 2.
7. Analysis of results
After the detection is finished, the Software (7500Software v2.0.5) carried by the apparatus is used for drawing a standard curve, as shown in fig. 3 and 4, wherein fig. 3 is the standard curve of MMLV, and fig. 4 is the standard curve of BMP 2.
And calculating the MMLV genome copy number Y1, BMP2 copy number Y2 and Y1/Y2 of the sample to be detected according to the standard curve, wherein the MMLV genome copy number Y1 and the BMP2 copy number Y2 are the relative content M1 of the MMLV genome to the cell genome. The titer of the sample to be tested is calculated by the formula:
the following is the qPCR test result, the number of experimental cells B is 1000000, the dilution factor of virus is 10, the volume of virus added is 50 μ L, the virus titer is calculated according to the formula, the virus titer of the sample is 1.71 × 108TU/mL。
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Yun boat Biotechnology (Guangzhou) Ltd
<120> Moloney murine leukemia virus titer detection kit and titer detection method
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 174
<212> DNA
<213> Moloney murine leukemia virus (Moloney murine leukemia virus)
<400> 1
cgtggtggaa ctgacgagtt cggaacaccc ggccgcaacc ctgggagacg tcccagggac 60
ttcgggggcc gtttttgtgg cccgacctga gtccaaaaat cccgatcgtt ttggactctt 120
tggtgcaccc ccctaatagg agggatatgt ggttctggta ggagacgaga acct 174
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cgtggtggaa ctgacgagtt 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aggttctcgt ctcctaccag 20
<210> 4
<211> 194
<212> DNA
<213> bone morphogenetic protein 2(Homo sapiens bone morphogenetic protein 2)
<400> 4
tagggtagac agagccaagg gcagagtttt cagagatagt attgaaaaat caaagcccag 60
ggccccaaag tctttctaat ttatagttga tctgggcctg gtttggaaga ttttgaatcc 120
caatctaatc cccgtgggag atcaatacta caatcaatct tattgtttcc acaatgactt 180
tcttgtcctg tgct 194
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tagggtagac agagccaagg 20
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
agcacaggac aagaaagtca ttg 23
Claims (10)
1. A Moloney murine leukemia virus titer detection kit is characterized by comprising a virus specific amplification primer pair, wherein a target virus fragment for amplification of the virus specific amplification primer pair comprises a sequence fragment with a sequence shown as SEQ ID NO.1, or a sequence fragment with a sequence complementary to the sequence shown as SEQ ID NO.1, or a sequence fragment with a sequence shown as SEQ ID NO.1 or a complementary sequence thereof and having one or more base deletions, substitutions or insertions.
2. The Moloney murine leukemia virus titer detection kit according to claim 1, wherein the sequences of the two primers of the virus specific amplification primer pair are shown as SEQ ID No.2 and SEQ ID No.3, respectively, or the corresponding complementary sequences of the sequences shown as SEQ ID No.2 and SEQ ID No.3, respectively.
3. The Moloney murine leukemia virus titer detection kit according to claim 1, further comprising an internal reference amplification primer pair, wherein the internal reference fragment used for amplification of the internal reference amplification primer pair comprises a sequence fragment having a sequence shown in SEQ ID No.4 or a sequence fragment having a sequence complementary to the sequence shown in SEQ ID No. 4.
4. The Moloney murine leukemia virus titer detection kit according to claim 3, wherein the sequences of the two primers of the internal reference amplification primer pair are shown as SEQ ID No.5 and SEQ ID No.6, respectively, or the corresponding complementary sequences of the sequences shown as SEQ ID No.5 and SEQ ID No.6, respectively.
5. The Moloney murine leukemia virus titer detection kit according to any one of claims 1 to 4, further comprising a standard of a known concentration of the virus fragment of interest.
6. The Moloney murine leukemia virus titer detection kit according to any one of claims 1 to 4, further comprising a standard of a known concentration of an internal reference fragment.
7. A Moloney murine leukemia virus titer detection method, using the Moloney murine leukemia virus titer detection kit according to any one of claims 1 to 6, the detection method comprising the steps of:
transducing moloney murine leukemia virus into cells, collecting the cells after a predetermined time of transduction, and extracting genomic DNA;
performing PCR amplification by using the extracted genome DNA as a template and the virus specific amplification primer pair, wherein an SYBR Green real-time fluorescent PCR reaction system is used as an amplification system;
and (4) carrying out dissolution curve analysis on the amplification product to obtain the virus titer.
8. The method of claim 7, further comprising the step of diluting the moloney murine leukemia virus solution in a gradient prior to transducing the cells with the moloney murine leukemia virus, and subsequently transducing the cells with the diluted solution.
9. The method of claim 7 or 8, further comprising the steps of performing PCR amplification and melting curve analysis on a standard sample of the target virus fragment at a known concentration.
10. The method of claim 7 or 8, wherein the PCR amplification procedure comprises: circulating for 1 minute at 95 ℃; at 95 ℃ for 15 seconds and at 60 ℃ for 1 minute for 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810623031.0A CN110607394A (en) | 2018-06-15 | 2018-06-15 | Moloney murine leukemia virus titer detection kit and titer detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810623031.0A CN110607394A (en) | 2018-06-15 | 2018-06-15 | Moloney murine leukemia virus titer detection kit and titer detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110607394A true CN110607394A (en) | 2019-12-24 |
Family
ID=68888593
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810623031.0A Pending CN110607394A (en) | 2018-06-15 | 2018-06-15 | Moloney murine leukemia virus titer detection kit and titer detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110607394A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113564277A (en) * | 2021-06-15 | 2021-10-29 | 中国计量科学研究院 | Evaluation method for nucleic acid extraction efficiency of new coronavirus (2019-nCoV) |
| CN116179762A (en) * | 2022-12-20 | 2023-05-30 | 云舟生物科技(广州)股份有限公司 | Primer group, detection product and detection method for virus titer |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5707865A (en) * | 1994-12-21 | 1998-01-13 | Kohn; Donald B. | Retroviral vectors for expression in embryonic cells |
| CN101403015A (en) * | 2008-10-29 | 2009-04-08 | 崔晓兰 | Standard article and method for detecting carry quantity of leucovirus |
| CN102134613A (en) * | 2010-12-31 | 2011-07-27 | 中国人民解放军第三军医大学 | Detection method of titer of recombinant lentivirus |
| CN102337359A (en) * | 2011-11-02 | 2012-02-01 | 舒泰神（北京）生物制药股份有限公司 | Primers and probe for detecting mouse leukemia virus and method thereof |
-
2018
- 2018-06-15 CN CN201810623031.0A patent/CN110607394A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5707865A (en) * | 1994-12-21 | 1998-01-13 | Kohn; Donald B. | Retroviral vectors for expression in embryonic cells |
| CN101403015A (en) * | 2008-10-29 | 2009-04-08 | 崔晓兰 | Standard article and method for detecting carry quantity of leucovirus |
| CN102134613A (en) * | 2010-12-31 | 2011-07-27 | 中国人民解放军第三军医大学 | Detection method of titer of recombinant lentivirus |
| CN102337359A (en) * | 2011-11-02 | 2012-02-01 | 舒泰神（北京）生物制药股份有限公司 | Primers and probe for detecting mouse leukemia virus and method thereof |
Non-Patent Citations (4)
| Title |
|---|
| M. A. BENDER等: "Evidence that the Packaging Signal of Moloney Murine Leukemia Virus Extends into the gag Region", 《JOURNAL OF VIROLOGY》 * |
| TAKARA: "Retrovirus Titer Set (for Real Time PCR)", 《豆丁网HTTPS://WWW.DOCIN.COM/P-894383490.HTML》 * |
| TAKARA: "Retro-X qRT-PCR Titration Kit User Manual (PT3952-1)_050919", 《TAKARA BIO USA TAKARABIO.COM》 * |
| 单易非等: "小鼠白血病病毒核酸的直接检测", 《病毒学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113564277A (en) * | 2021-06-15 | 2021-10-29 | 中国计量科学研究院 | Evaluation method for nucleic acid extraction efficiency of new coronavirus (2019-nCoV) |
| CN116179762A (en) * | 2022-12-20 | 2023-05-30 | 云舟生物科技(广州)股份有限公司 | Primer group, detection product and detection method for virus titer |
| CN116179762B (en) * | 2022-12-20 | 2023-11-17 | 云舟生物科技(广州)股份有限公司 | Primer group, detection product and detection method for virus titer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rosseel et al. | Evaluation of convenient pretreatment protocols for RNA virus metagenomics in serum and tissue samples | |
| CN108559792B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting titer of lentivirus | |
| CN107660234A (en) | The method of prediction organ-graft refection is sequenced using two generations | |
| CN106957927A (en) | African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application | |
| WO2020224395A1 (en) | Probe, primer pair, fluorescent quantitative pcr kit and method for detecting replicative lentivirus | |
| WO2020224394A1 (en) | Fluorescent probe, primer pair, fluorescent quantitative pcr kit and detection method for detecting lentivirus | |
| WO2022160562A1 (en) | Lentivirus titer detection primer, kit and detection method | |
| CN110964857A (en) | Kit for detecting bovine sarcoidosis virus by excluding capripoxvirus, preparation method and application thereof | |
| CN104673934A (en) | Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof | |
| US9617606B2 (en) | Oligonucleotide for HIV detection, HIV detection kit, and HIV detection method | |
| CN110607394A (en) | Moloney murine leukemia virus titer detection kit and titer detection method | |
| CN116676428A (en) | Fluorescent quantitative PCR primer and method for detecting type A and type B of pangolin respiratory syncytial virus | |
| CN113186226B (en) | RNA virus nucleic acid detection reference standard and application thereof | |
| CN113186347A (en) | H3N2 avian influenza virus detection kit | |
| CN105950785A (en) | Ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes | |
| CN113817870B (en) | Primer composition for simultaneously detecting seven respiratory tract related viruses and application thereof | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN105936943A (en) | Rapid and sensitive method for detection of Marburg virus RT-LAMP | |
| CN112159866A (en) | Preparation method of HIV-1 nucleic acid detection quality control product based on influenza virus vector | |
| KR20150134004A (en) | Nucleic acid test based avian influenza virus detection kit with improved detection accuracy | |
| CN116179762B (en) | Primer group, detection product and detection method for virus titer | |
| CN113699278A (en) | Primer, kit and detection method for detecting replication-competent retrovirus based on q-PCR method | |
| CN101538618A (en) | Fluorescence quantitative detection kit for human metapneumovirus | |
| CN107513586B (en) | A kind of amplification system and method detecting japanese encephalitis virus RNA | |
| RU2592675C1 (en) | METHOD OF DETERMINING LEVEL OF CHIMERIC GENE Trim5a EXPRESSION |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191224 |
|
| RJ01 | Rejection of invention patent application after publication |