CN108559792B - Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting titer of lentivirus - Google Patents
Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting titer of lentivirus Download PDFInfo
- Publication number
- CN108559792B CN108559792B CN201810564086.9A CN201810564086A CN108559792B CN 108559792 B CN108559792 B CN 108559792B CN 201810564086 A CN201810564086 A CN 201810564086A CN 108559792 B CN108559792 B CN 108559792B
- Authority
- CN
- China
- Prior art keywords
- virus
- bmp2
- quantitative pcr
- env
- titer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention discloses a real-time fluorescent quantitative PCR primer, a kit and a method for detecting the titer of a lentivirus, wherein the primer of the invention falls on the envelope of the lentivirus, and the titer can be detected without a fluorescent label. In addition, the invention detects the virus which is infected with the cell and successfully integrated, can embody the real infection activity of the virus, is not influenced by the extraction efficiency of cell genome DNA, and has the characteristics of simple and convenient operation and high sensitivity.
Description
Technical Field
The invention relates to the technical field of lentivirus titer detection, in particular to a real-time fluorescent quantitative PCR primer, a kit and a method for detecting lentivirus titer.
Background
Lentivirus (LVs) is a virus vector system which is transformed on the basis of HIV-1 (human immunodeficiency virus I), is different from common retrovirus vectors, has the infection capacity on both split cells and non-split cells, and can efficiently transfer target genes (or RNAi) into primary cells or cell lines of animals and human. The lentivirus genome is two identical positive strand RNA, and after infecting cells, the lentivirus genome is reversely transcribed into DNA by reverse transcriptase carried by the lentivirus genome in cytoplasm to form a DNA pre-integration complex, and the DNA is integrated into the cell genome after entering a cell nucleus. The integrated DNA transcribes the mRNA, returns to the cytoplasm, expresses the protein of interest, or produces RNAi interference.
The expression vector and the helper packaging plasmid transfect the cell together, and the packaging of the virus is completed in the cell. The packaged pseudovirus particles are secreted into a culture medium outside cells, and after centrifugation to obtain a supernatant, the pseudovirus particles can be directly used for infection of host cells, and can also be applied to in-vivo experiments after concentration and purification. When the viral genome carrying the gene of interest enters the host cell, it is reverse transcribed and then integrated into the genome, thereby expressing the effector molecule at high levels.
At present, the titer detection of lentiviruses mainly adopts a fluorescence titer method, an Elisa method and an RT-qPCR method.
The fluorescence titer method is to use virus liquid to infect cells, and then detect the proportion of successfully infected cells in a sample by a flow cytometer, so as to accurately reflect the virus titer and the actual infection activity of the virus. However, the fluorescence titer method is only applicable to viruses containing fluorescent tags, and is not capable of determining viruses without fluorescent tags, thereby limiting the use of the method.
The Elisa method is to detect the virus titer by utilizing the immunoreaction of an antibody to P24 protein on a lentivirus capsid, and the principle is that the P24 protein on the lentivirus capsid is combined with a microporous plate coated by a P24 antibody, then an HRP-labeled P24 protein antibody is added to finally form an antibody-antigen-enzyme-labeled antibody compound, TMB is added for color development and is converted into final yellow under the action of acid, and the shade of the color is positively correlated with the P24 protein in a sample. Therefore, the titer of lentivirus was deduced by measuring absorbance (OD value) at a wavelength of 450nm using a microplate reader and calculating the concentration of P24 protein in the sample from the standard curve. However, both free P24 protein and P24 protein on inactivated virus particles react with antibodies to affect the results, and thus the titer of the virus cannot be accurately determined.
In the RT-qPCR method, the RNA efficiency influences the final result, and the RT-qPCR method can count the nucleic acid of virus particles containing the nucleic acid but losing the infection activity, so that the real infection activity of the virus cannot be reflected, and the titer detection result of the virus is inaccurate, thereby limiting the application of the method.
The titer of the virus product needs to be determined before use, so a set of specific, quick, sensitive and effective molecular detection method for the lentivirus is established, and technical support can be provided for application of the lentivirus.
Disclosure of Invention
The invention mainly aims to provide a pair of real-time fluorescent quantitative PCR primers for detecting the titer of the lentivirus;
another purpose of the invention is to provide a real-time fluorescent quantitative PCR kit for detecting the titer of the lentivirus
Still another objective of the present invention is to provide a real-time fluorescent quantitative PCR method for detecting the titer of lentivirus.
The technical scheme adopted by the invention is as follows:
a real-time fluorescent quantitative PCR primer for detecting the titer of a lentivirus has the following nucleotide sequence:
ENV-F:CGCAGTTAATCCTGGCCTGTTA；
ENV-R:ATCCTTTGATGCACACAATAGAGG。
a real-time fluorescent quantitative PCR kit for detecting the titer of lentivirus is characterized in that the kit contains the primer.
A real-time fluorescent quantitative PCR method for detecting the titer of lentivirus is characterized by comprising the following steps:
1) cell count was recorded as B, virus was diluted and virus was transduced into cells;
2) after the virus is transduced for 45-52 hours, collecting the genome DNA of the cell;
3) using the extracted genome DNA as a template, carrying out virus genome fluorescent quantitative PCR amplification reaction by using the primer ENV-F, ENV-R and carrying out reference gene fluorescent quantitative PCR amplification reaction in target cells by using the internal reference primer BMP2-F, BMP2-R to obtain an amplification product, and obtaining the virus genome copy number Y1 and the internal reference BMP2 copy number Y2 of the sample in a standard curve according to CT values;
4) calculating the titer of the sample according to a formula; titer TU/mL ═ B × 2000 × Y1/Y2, B is the number of cells before viral transduction, Y1 is the number of copies of the viral genome of the sample, and Y2 is the number of copies of the internal reference BMP2 of the sample.
Further, the virus dilution factor in the step 1) is 90-110 times.
Further, polybrene was used in step 2) to facilitate viral transduction.
Further, the nucleotide sequence of the reference primer BMP2-F, BMP2-R in the step 3) is as follows:
BMP2-F:TAGGGTAGACAGAGCCAAGG；
BMP2-R:AGCACAGGACAAGAAAGTCATTG。
further, the fluorescent quantitative PCR amplification reaction system in the step 3) is as follows:
the virus genome amplification reaction system is as follows:
the amplification reaction system of the reference gene in the target cell is as follows:
further, the fluorescent quantitative PCR amplification reaction program of the step 3) is as follows: pre-denaturing at 95-98 ℃ for 1-2 minutes; denaturation at 93-98 ℃ for 10-30 seconds, annealing at 55-65 ℃ for 1-3 minutes, and circulating for 30-40 times.
The invention has the beneficial effects that:
according to the real-time fluorescent quantitative PCR method, the primer is designed on the envelope of the lentivirus, and the presence or absence of the fluorescent label has no influence on the titer detection. In addition, the real-time fluorescent quantitative PCR method detects that the virus is infected with cells and successfully integrated, can embody the real infection activity of the virus, and is not influenced by the extraction efficiency of cell genome DNA.
Drawings
FIG. 1 is a standard curve of lentivirus ENV, in which the abscissa represents the number of copies of the viral segment ENV of interest and the ordinate represents the CT value, i.e.the number of cycles undergone by the fluorescence signal in each reaction tube when it reaches a set threshold;
FIG. 2 is a standard curve of internal reference BMP2, wherein the abscissa represents the copy number of the internal reference fragment and the ordinate represents the CT value, i.e., the number of cycles that the fluorescence signal in each reaction tube has undergone until it reaches a set threshold value.
FIG. 3 is a melting curve diagram of quantitative PCR amplification using a virus-infected cell genome and an ENV standard as templates, respectively.
Detailed Description
The present invention will be further described with reference to the following examples.
EXAMPLE 1 design of specific primers
According to the published virus sequence, the envelope region of the lentivirus is selected for designing a primer; the designed primers are preliminarily screened to obtain a group of primer pairs with high universality and good sensitivity and specificity, and the nucleotide sequences are as follows:
ENV-F:CGCAGTTAATCCTGGCCTGTTA(SEQ.ID:NO.1)；
ENV-R:ATCCTTTGATGCACACAATAGAGG(SEQ.ID:NO.2)。
the lentivirus shuttle plasmid is used as a template, and the amplification sequence is as follows:
cgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggat(SEQ.ID:NO.3)；
the length of the amplified fragment was 144 bp.
Internal reference BMP2(Homo sapiens bone morphogenetic protein 2) primer:
BMP2-F:TAGGGTAGACAGAGCCAAGG(SEQ.ID:NO.4)；
BMP2-R:AGCACAGGACAAGAAAGTCATTG(SEQ.ID:NO.5)。
taking genome DNA extracted from human-derived cells as a template, and the amplification sequence is as follows:
tagggtagacagagccaagggcagagttttcagagatagtattgaaaaatcaaagcccagggccccaaagtctttctaatttatagttgatctgggcctggtttggaagattttgaatcccaatctaatccccgtgggagatcaatactacaatcaatcttattgtttccacaatgactttcttgtcctgtgct(SEQ.ID:NO.6)；
the length of the amplified fragment is 194 bp.
Example 2 preparation of standards and real-time quantitative PCR (qPCR) assay
Preparation of standard substance
Using ENV-F, ENV-R of example 1,BMP2-F, BMP2-R primer, the target fragment is amplified, and the amplification product is connected to pMDTM18-T carrier. The constructed vector is subjected to double enzyme digestion by AhdI and NdeI, and the enzyme digestion product is recovered and the concentration and the purity of the enzyme digestion product are determined by using NanoDrop. And calculating the number of molecules of the sample with the purity according to the molecular weight of the fragment and the Avogastron constant, and taking the number of molecules as virus quantitative standard products, namely an ENV standard product and an internal reference BMP2 standard product.
The specific calculation formula is as follows: sample copy number per 1uL fragment ═ A × N × 10-9and/M. Wherein A is the concentration of the DNA to be detected in ng/uL; n is the Avogastron constant (6.02 × 10)23Mol); m is the molecular weight of the fragment.
Second, real-time quantitative PCR (qPCR) detection of standard substance
(1) And (3) diluting the standard:
diluting ENV standard and internal reference BMP2 standard to 10 respectively by using deionized water7、106、105、104、103copies/μL。
(2) Quantitative PCR analysis:
and (3) carrying out quantitative PCR analysis by using the diluted ENV standard substance and the internal reference BMP2 standard substance, wherein the quantitative PCR reaction systems of the virus genomes are respectively as follows:
quantitative PCR reaction system of reference gene in target cell:
to reduce errors, more than 2 duplicate wells per sample should be used.
qPCR employs a two-step process using an Applied Biosystems model 7500 real-time fluorescent quantitative PCR instrument. The specific reaction procedure is as follows: pre-denaturation at 95 ℃ for 1 min, entering the cycle: denaturation at 95 ℃ for 15 seconds, annealing at 60 ℃ for 1 minute, and 40 cycles, the standard curve of the standard was obtained and analyzed.
(3) And (4) analyzing results:
the primers of the present invention are within the range of the conventionally used virus titer in terms of sensitivity (10)6～1010TU/mL) with good sensitivity, R2> 0.99 (as shown in figures 1 and 2).
Example 3 real-time fluorescent quantitative PCR of genomic DNA of target cells
(1) Viral transduction of 293T cells:
at a rate of 3X 10 per hole5The individual cells were seeded 293T cells in 6-well plates, one well of the cells was trypsinized the next day before viral transduction and the cells were counted, and the count was stored as B. The virus product was diluted 100-fold using 293T complete medium, 50uL of the diluted virus solution was added to one well of a 6-well plate, 10uL of polybrene (polybrene) was added to promote transduction, and cells that did not transduce any virus in one well were kept as negative controls and placed in a 37 ℃ incubator for further culture.
(2) Extraction of cell genomic DNA:
after 48 hours of viral transduction, cells were harvested and genomic DNA of target cells was extracted using a blood tissue cell genome extraction kit (Tiangen, DP 304).
(3) Quantitative PCR analysis:
taking the extracted cell genome DNA infected by the virus as a template, and respectively carrying out quantitative PCR analysis aiming at the virus genome and a reference gene in a target cell, wherein the quantitative PCR reaction system of the virus genome is as follows:
a quantitative PCR reaction system of a reference gene in a target cell:
to reduce errors, more than 2 duplicate wells per sample should be used.
The qPCR adopts a two-step method, and the used instrument is an Applied Biosystems 7500 real-time fluorescent quantitative PCR instrument. The specific reaction procedure is as follows: pre-denaturation at 98 ℃ for 2 min; denaturation at 93 ℃ for 10 seconds; the samples were analyzed after obtaining CT values after annealing at 55 ℃ for 1 minute and 30 cycles.
(4) And (4) analyzing results:
the primers of the present invention, the genome of the cell infected with the virus, and 103～107Copy number ENV standard was used as template for amplification, and the dissolution curves were found to be consistent, indicating that the specificity of this primer is good (as shown in FIG. 3). After the detection is finished, Software (7500 Software v2.0.5) carried by the instrument is used for drawing a standard curve, the CT value of the sample is substituted into the standard curve of the figure 1 and the figure 2, the ENV genome copy number Y1 of the sample to be detected and the BMP2 copy number Y2 of the sample to be detected are respectively calculated, and Y1/Y2 is the relative content of the lentivirus genome to the cell genome. The virus dilution factor is 100, the volume of the added virus is 50 mu L, the virus titer is calculated according to the formula, and the titer of the sample to be detected is calculated according to the formula:
namely: the titer TU/mL (TU: Transduction Unit) is B.times.2000 XY 1/Y2.
Example 4 real-time fluorescent quantitative PCR of genomic DNA of target cells
(1) Viral transduction of 293T cells:
at a rate of 3X 10 per hole5The 293T cells were seeded into 6-well plates, and cells from one well were trypsinized and counted the next day before virus transduction, and the count was stored as B. The virus product was diluted 90-fold using 293T complete medium, 50uL of diluted virus solution was added to one well of a 6-well plate, 10uL of polybrene (polybrene) was added to promote transduction, and cells that did not transduce any virus were retained in one well as a negative control, and the cells were placed in a 37 ℃ incubator for further culture.
(2) Extraction of cell genomic DNA:
45 hours after viral transduction, cells were harvested and genomic DNA of target cells was extracted using a blood tissue cell genome extraction kit (Tiangen, DP 304).
(3) Quantitative PCR analysis:
and (3) taking the extracted cell genome DNA infected by the virus as a template, and respectively carrying out quantitative PCR analysis on the virus genome and the reference gene in the target cell. The quantitative PCR reaction system of the viral genome is as follows:
a quantitative PCR reaction system of a reference gene in a target cell:
to reduce errors, more than 2 duplicate wells per sample should be used.
The qPCR adopts a two-step method, and the used instrument is an Applied Biosystems 7500 real-time fluorescent quantitative PCR instrument. The specific reaction procedure is as follows: pre-denaturation at 95 ℃ for 1 min: denaturation at 93 ℃ for 10 sec; annealing at 65 ℃ is extended for 3 minutes, and the sample is analyzed after being subjected to 40 times of circulation and the CT value is obtained.
(4) And (4) analyzing results:
after the detection is finished, Software (7500 Software v2.0.5) carried by the apparatus is used for drawing a standard curve, the CT value of the sample is substituted into the standard curve shown in the figure 1 and the figure 2, the ENV genome copy number Y1 of the sample to be detected and the BMP2 copy number Y2 of the sample to be detected are respectively calculated, and Y1/Y2 is the relative content of the lentivirus genome to the cell genome. The virus dilution factor is 90, the volume of the added virus is 50 mu L, the virus titer is calculated according to the formula, and the titer of the sample to be detected is calculated according to the formula:
the titer TU/mL (TU: Transduction Unit) is B.times.1600 XY 1/Y2.
Example 5 real-time fluorescent quantitative PCR of genomic DNA of target cells
(1) Viral transduction of 293T cells:
at a rate of 3X 10 per hole5The individual cells were seeded 293T cells in 6-well plates, one well of the cells was trypsinized the next day before viral transduction and the cells were counted, and the count was stored as B. The virus product was diluted 110 times using 293T complete medium, 50uL of diluted virus solution was added to one well of a 6-well plate, 10uL of polybrene (polybrene) at 0.5mg/mL was added to promote transduction, and cells that did not transduce any virus were retained in one well as a negative control, and the culture was continued in a 37 ℃ incubator.
(2) Extraction of cell genomic DNA:
after 52 hours of viral transduction, cells were harvested and the genomic DNA of the target cells was extracted using a blood tissue cell genome extraction kit (Tiangen, DP 304).
(3) Quantitative PCR analysis:
and (3) taking the extracted cell genome DNA infected by the virus as a template, and respectively carrying out quantitative PCR analysis on the virus genome and the reference gene in the target cell. The quantitative PCR reaction system of the virus genome is as follows:
quantitative PCR reaction system of reference gene in target cell:
to reduce errors, more than 2 duplicate wells per sample should be used.
qPCR employs a two-step process using an Applied Biosystems model 7500 real-time fluorescent quantitative PCR instrument. The specific reaction procedure is as follows: pre-denaturation at 97 ℃ for 1 min; denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 3 minutes, and cycle 35 times, and CT value of the sample was obtained and then analyzed.
(4) And (4) analyzing results:
after the detection is finished, Software (7500 Software v2.0.5) carried by the instrument is used for drawing a standard curve, the CT value of the standard substance is substituted into the standard curve shown in the figure 1 and the figure 2, the ENV genome copy number Y1 of the sample to be detected and the BMP2 copy number Y2 of the sample to be detected are respectively calculated, and Y1/Y2 is the relative content of the lentivirus genome to the cell genome. The virus dilution factor is 110, the volume of the added virus is 50 mu L, the virus titer is calculated according to the formula, and the titer of the sample to be tested is calculated according to the formula:
titer TU/mL (TU: Transduction Unit) B.times.2200 XY 1/Y2.
The primers mentioned in the present invention, tested the genome of cells infected with virus, 103～107The standard substance with copy number is used as a template for amplification, and the dissolution curves are found to be consistent, which indicates that the specificity of the primer is good. In terms of sensitivity, in the range of commonly used virus titers (10)6～1010TU/mL) with good sensitivity, R2＞0.99。
The above description is a preferred embodiment of the present invention, but the present invention is not limited to the above embodiment, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and they are included in the scope of the present invention.
SEQUENCE LISTING
<110> cloud boat Biotechnology (Guangzhou) Inc
<120> real-time fluorescent quantitative PCR primer, kit and method for detecting titer of lentivirus
<130>
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213> Artificial primer
<400> 1
cgcagttaat cctggcctgt ta 22
<210> 2
<211> 24
<212> DNA
<213> Artificial primer
<400> 2
atcctttgat gcacacaata gagg 24
<210> 3
<211> 144
<212> DNA
<213> Artificial sequence
<400> 3
cgcagttaat cctggcctgt tagaaacatc agaaggctgt agacaaatac tgggacagct 60
acaaccatcc cttcagacag gatcagaaga acttagatca ttatataata cagtagcaac 120
cctctattgt gtgcatcaaa ggat 144
<210> 4
<211> 20
<212> DNA
<213> Artificial primer
<400> 4
<210> 5
<211> 23
<212> DNA
<213> Artificial primer
<400> 5
agcacaggac aagaaagtca ttg 23
<210> 6
<211> 194
<212> DNA
<213> Artificial sequence
<400> 6
tagggtagac agagccaagg gcagagtttt cagagatagt attgaaaaat caaagcccag 60
ggccccaaag tctttctaat ttatagttga tctgggcctg gtttggaaga ttttgaatcc 120
caatctaatc cccgtgggag atcaatacta caatcaatct tattgtttcc acaatgactt 180
tcttgtcctg tgct 194
Claims (5)
1. A real-time fluorescent quantitative PCR method for detecting the titer of lentivirus is characterized by comprising the following steps:
1) cell count was recorded as B, virus was diluted and virus was transduced into cells;
2) collecting genome DNA of cells after virus transduction for 45-52 hours;
3) using the extracted genome DNA as a template, carrying out virus genome fluorescent quantitative PCR amplification reaction by using a primer ENV-F, ENV-R and carrying out target cell reference gene fluorescent quantitative PCR amplification reaction by using an internal reference primer BMP2-F, BMP2-R to obtain an amplification product, and obtaining the virus genome copy number Y1 and the internal reference BMP2 copy number Y2 of the sample in a standard curve according to the CT value;
4) calculating the titer of the sample according to a formula; titer TU/mL = B × 2000 × Y1/Y2, B is the number of cells before viral transduction, Y1 is the viral genome copy number of the sample, Y2 is the internal reference BMP2 copy number of the sample;
the nucleotide sequence of the primer ENV-F, ENV-R is shown as follows:
ENV-F: CGCAGTTAATCCTGGCCTGTTA；
ENV-R: ATCCTTTGATGCACACAATAGAGG；
the nucleotide sequence of the internal reference primer BMP2-F, BMP2-R is as follows:
BMP2-F: TAGGGTAGACAGAGCCAAGG；
BMP2-R: AGCACAGGACAAGAAAGTCATTG。
2. the method of claim 1, wherein the virus dilution factor in step 1) is 90-110 fold.
3. The method of claim 1, wherein step 2) comprises using polybrene to facilitate viral transduction.
4. The method of claim 1, wherein the fluorescent quantitative PCR amplification reaction system in step 3) is:
the virus genome amplification reaction system is as follows:
SYBR Green Real-time PCR Master Mix 10μL
ENV-F 0.25μL
ENV-R 0.25μL
DNA 1μL
supplementing deionized water to 20 mu L;
the amplification reaction system of the reference gene of the target cell is as follows:
SYBR Green Real-time PCR Master Mix 10μL
BMP2-F 0.25μL
BMP2-R 0.25μL
DNA 1μL
make up to 20 μ L of deionized water.
5. The method according to claim 1, wherein the fluorescent quantitative PCR amplification reaction procedure of step 3) is as follows: pre-denaturation at 95-98 ℃ for 1-2 minutes; denaturation at 93-98 ℃ for 10-30 seconds, annealing at 55-65 ℃ for 1-3 minutes, and circulating for 30-40 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810564086.9A CN108559792B (en) | 2018-06-04 | 2018-06-04 | Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting titer of lentivirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810564086.9A CN108559792B (en) | 2018-06-04 | 2018-06-04 | Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting titer of lentivirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108559792A CN108559792A (en) | 2018-09-21 |
| CN108559792B true CN108559792B (en) | 2022-07-22 |
Family
ID=63552767
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810564086.9A Active CN108559792B (en) | 2018-06-04 | 2018-06-04 | Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting titer of lentivirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108559792B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486910A (en) * | 2018-11-21 | 2019-03-19 | 温州医科大学附属第医院 | A kind of remaining primer pair of detection 293T cytogene, kit and method |
| CN112176100A (en) * | 2019-07-01 | 2021-01-05 | 重庆精准生物技术有限公司 | General method for detecting copy number of target gene and virus titer and application |
| CN111235309B (en) * | 2020-01-20 | 2022-09-30 | 湖南农业大学 | Absolute quantitative PCR method for rapidly determining titer of vesicular virus |
| CN111850171A (en) * | 2020-08-03 | 2020-10-30 | 浙江大学 | Method for detecting lentivirus in deep sea sediment sample |
| CN112111606B (en) * | 2020-09-24 | 2023-10-03 | 深圳普瑞金生物药业有限公司 | Nucleic acid compositions, kits and methods for detecting recombinant lentivirus titers |
| CN113151587A (en) * | 2021-01-28 | 2021-07-23 | 云舟生物科技（广州）有限公司 | Primer, kit and detection method for detecting titer of lentivirus |
| CN113564277A (en) * | 2021-06-15 | 2021-10-29 | 中国计量科学研究院 | Evaluation method for nucleic acid extraction efficiency of new coronavirus (2019-nCoV) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134613A (en) * | 2010-12-31 | 2011-07-27 | 中国人民解放军第三军医大学 | Detection method of titer of recombinant lentivirus |
| CN107435082A (en) * | 2017-06-13 | 2017-12-05 | 安徽安龙基因医学检验所有限公司 | A kind of method based on gag genetic test recombinant slow virus titres |
-
2018
- 2018-06-04 CN CN201810564086.9A patent/CN108559792B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134613A (en) * | 2010-12-31 | 2011-07-27 | 中国人民解放军第三军医大学 | Detection method of titer of recombinant lentivirus |
| CN107435082A (en) * | 2017-06-13 | 2017-12-05 | 安徽安龙基因医学检验所有限公司 | A kind of method based on gag genetic test recombinant slow virus titres |
Non-Patent Citations (3)
| Title |
|---|
| Continuous high-titer HIV-1 vector production;Yasuhiro lkeda et al.;《Nature biotechnology》;20030407;全文 * |
| Human immunodeficiency virus 1 DNA for Gag, Pol,Vif,Vpr,Tat,Rev,Env,Vpu;GenBank:D86068.1;《GENBANK》;20160721;cds * |
| 应用荧光实时定量 PCR 方法检测重组慢病毒滴度及其感染效率;马海燕等;《生命科学研究》;20091031;第13卷(第5期);摘要、第1.3-1.8节、第398页左栏 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108559792A (en) | 2018-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108559792B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting titer of lentivirus | |
| Pizzato et al. | A one-step SYBR Green I-based product-enhanced reverse transcriptase assay for the quantitation of retroviruses in cell culture supernatants | |
| CN106435024B (en) | Fluorescent quantitative PCR primer, probe, kit and detection method for detecting avian influenza virus subtype | |
| US20210214789A1 (en) | Reagent and method for fluorescence quantitative real-time pcr detection of rcl | |
| CN104087686A (en) | GeXP quick detection kit and detection method for identifying 8 chicken immunosuppression disease pathogens | |
| CN110964857A (en) | Kit for detecting bovine sarcoidosis virus by excluding capripoxvirus, preparation method and application thereof | |
| Foord et al. | Real-time RT-PCR for detection of equine influenza and evaluation using samples from horses infected with A/equine/Sydney/2007 (H3N8) | |
| CN116676429B (en) | LAMP primer group for detecting pangolin respiratory syncytial virus type B and application thereof | |
| CN111154923A (en) | Primer for amplifying nucleotide fragment of novel coronavirus (SARS-CoV-2) gene and application thereof | |
| CN109402069A (en) | A kind of pseudovirion and its preparation method and application | |
| US9617606B2 (en) | Oligonucleotide for HIV detection, HIV detection kit, and HIV detection method | |
| CN110343784B (en) | Composition and kit for quadruple influenza virus nucleic acid detection based on melting curve | |
| CN110923361A (en) | Primer, probe and kit for blood source screening based on digital PCR | |
| CN113186226B (en) | RNA virus nucleic acid detection reference standard and application thereof | |
| CN100419089C (en) | Nucleotide sequence for fast inspecting HIV virus, its method and extra-diagnostic reagent kit | |
| CN102649985B (en) | Reverse transcription-loop-mediated isothermal amplification (RT-LAMP) visual detection kit for H1N2 avian influenza viruses | |
| CN108998575B (en) | Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus | |
| CN110607394A (en) | Moloney murine leukemia virus titer detection kit and titer detection method | |
| Kim et al. | Development of quantitative competitive—reverse transcriptase—polymerase chain reaction for detection and quantitation of avian leukosis virus subgroup J | |
| CN105349698B (en) | GeXP rapid detection primer group and kit for identifying main epidemic subtypes of avian influenza at the same time and application of primer group and kit | |
| CN115725788A (en) | Primer and TaqMan probe for detecting feline parvovirus and application thereof | |
| CN109722465B (en) | HIV drug resistance detection vector and construction method | |
| JP2014513921A (en) | Exogenous internal positive control | |
| CN102649983B (en) | Reverse transcription-loop-mediated isothermal amplification (RT-LAMP) visual detection kit for H1 avian influenza virus | |
| CN110777219A (en) | Triple PCR detection primer group, kit and method for chicken parvovirus and H9 subtype avian influenza virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: Room d301-d309, Guangzhou International Business Incubator (Zone D), No. 3, Juquan Road, Science City, high tech Industrial Development Zone, Guangzhou, Guangdong 510663 Applicant after: Yunzhou Biotechnology (Guangzhou) Co.,Ltd. Address before: Room d301-d309, Guangzhou International Business Incubator (Zone D), No. 3, Juquan Road, Science City, high tech Industrial Development Zone, Guangzhou, Guangdong 510663 Applicant before: YUNZHOU BIOSCIENCES (GUANGZHOU) Inc. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |