CN100419089C - Nucleotide sequence for fast inspecting HIV virus, its method and extra-diagnostic reagent kit - Google Patents
Nucleotide sequence for fast inspecting HIV virus, its method and extra-diagnostic reagent kit Download PDFInfo
- Publication number
- CN100419089C CN100419089C CNB2006101136131A CN200610113613A CN100419089C CN 100419089 C CN100419089 C CN 100419089C CN B2006101136131 A CNB2006101136131 A CN B2006101136131A CN 200610113613 A CN200610113613 A CN 200610113613A CN 100419089 C CN100419089 C CN 100419089C
- Authority
- CN
- China
- Prior art keywords
- seq
- virus
- mark
- particle
- preservations
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A nucleotide sequence for inspecting HIV virus rapidly, its method and in-vitro diagnostic reagent knit are disclosed. It's cheap, simple and accurate and has wide inspection range, and it can be used to inspect A-H sub-family and O-family of M family.
Description
Technical field
The present invention relates to a kind of nucleotide sequence, method and external diagnosis reagent case of rapid detection HIV virus, belong to viral molecular biology field and medical biotechnology field.
Background technology
Human immunodeficiency virus group in the HIV Tobamovirus Retroviridae lentivirus.Up to now, measure according to serological reaction and nucleic acid sequence, global popular HIV can be divided into 2 types: HIV-1 type and HIV-2 type.In the HIV-1 type, homology according to the gag gene order of the env gene of encoded packets membranin and coding glutelin is further divided into three group: M groups (main group), O group (peripheral group) and N group (the non-O group of group or non-M newly) again, and M can be divided into A-J10 hypotype again in organizing.Between HIV-1 type and HIV-2 type, its nucleotides sequence is shown 45% homology, and has immunological cross-reaction.Diagnosis to HIV mainly is the antibody that detects anti-HIV by serological test in early days, diagnoses HIV to infect indirectly.In recent years, molecular biology method constantly was applied in the detection of HIV, and the laboratory diagnostic method of HIV has been obtained very big progress, and detection of nucleic acids has become the developing direction of HIV laboratory diagnosis.
At present, internationally recognized detection reagent has the Amplicor HIV-1Monitor Test that Roche Holding Ag produces.This reagent adopts the RT-PCR-ELISA principle to detect, only use a pair of primer and the probe of corresponding HIV gag gene, can not guarantee that the bonded that causes with the possible sudden change of the specific combination of each hypotype and primer or probe calmodulin binding domain CaM changes, there is bibliographical information to prove, the phenomenon that there is omission in this test kit or quantitatively underestimates.In addition, this test kit costs an arm and a leg, detect the about 50-80 dollar/person-portion of cost, has limited its at home universal.
Summary of the invention
The main technical problem to be solved in the present invention provides one group of nucleotide sequence that can be used for detecting HIV virus.
Another technical problem that the present invention will solve provides the method for a kind of highly sensitive, high specificity, detection HIV virus that the detection cost is low.
Another technical problem that the present invention will solve provides the external diagnosis reagent case of the low detection HIV virus that contains two primers, two probes of a kind of high specificity, cost.
For achieving the above object, the present invention is by the following technical solutions:
One group of nucleotide sequence that can be used for detecting HIV virus has the sequence shown in sequence table SEQ ID No.1 to the SEQ ID No.7.
Probe 15 '-ACCATCAATGAGGAAGCTGCAGAATGGG-3 ' SEQ ID No.3
The reverse 5 '-ATTTGCATAGCTGCTTGATGTCC-3 ' SEQ of primer 2 ID No.5
Probe 25 '-TCAGCATTATCAGAAGGAGCCACCCCACA-3 ' SEQ ID No.6
Probe 35 '-TCAGGCCCCCTCAAAGCCGAC-3 ' SEQ ID No.7
Wherein, 5 ' end of probe 1 and probe 2 sequences is mark fluorescent reporter group FAM respectively, and 3 ' end is mark fluorescent quenching group TAMRA respectively; 5 ' end mark fluorescent reporter group VIC of probe 3,3 ' end fluorescent quenching group TAMRA.
By all known HIV-1 sequences are carried out the comparison of bioinformatics method, obtain nucleotide sequence zone conservative in the HIV-1 sequence, adopt the biological software design many primer probe according to the rule of design of primers (as length, melting temp, the GC content of considering the primer probe, repeat base number, terminal bases etc.).Each is compared to primer probe and HIV-1 sequence, finally adopt the good primer probe of matching degree.We finally use two primers and the two probe of the base sequence shown in SEQ IDNo.1 to the SEQ ID No.6 as the real-time fluorescence quantitative PCR reaction through experiment screening.
A kind of method of detection HIV virus of highly sensitive, high specificity uses the sequence shown in SEQ ID No.1 to the SEQ ID No.6 to carry out fluorescence real-time quantitative PCR as two primers and two probes.This method also comprises uses the detection probes of the nucleotide sequence shown in virus-like particle and the SEQ ID No.7 as interior mark Quality Control thing, virus-like particle is joined participate in the quality control that sample extraction, reverse transcription, pcr amplification and product detect whole process in the sample.
We adopt the TaqMan method, after two ends divide the oligonucleotide probe of mark fluorescence and quenching group to be attached on the PCR product, the Taq archaeal dna polymerase that its labelling groups is had 5 '-3 ' 5 prime excision enzyme activity cuts away, thereby separate generation fluorescence with quenching group, can carry out qualitative and quantitative to the PCR product by Real-time and Dynamic Detection to fluorescence.This method has improved the sensitivity and the specificity of detection reaction, and easy handling.
A kind of external diagnosis reagent case that contains the detection HIV virus of two primers, two probes, form by following reagent:
1.RNA extraction reagent: be selected from Trizol or paramagnetic particle method and extract a kind of in the reagent, all contain and mark virus-like particle in the 1000 copy/ml:
(1) Trizol: contain mark virus-like particle in the 1000 copy/ml, by this prepared in laboratory, method cf. publication, 4 ℃ of preservations.
(2) paramagnetic particle method extracts reagent: comprise plurality of reagents such as lysate, in its lysate, contain mark virus-like particle in the 1000 copy/ml, and by this prepared in laboratory, method cf. publication, 4 ℃ of preservations.
2. reaction solution: by 50mM Tris (working concentration 20mM), 125mM KCl (working concentration 50mM), 10mMMgCl
2(working concentration 4mM), 500ug/ml BSA (working concentration 200ug/ml), 0.375mM Sorbitol (sorbyl alcohol, working concentration 0.15mM), 0.025mM Triton (working concentration 0.01mM), RNase inhibitor Rnasin2.5-5U/ul (usage quantity is the 5-10U/ person-portion), form-20 ℃ of preservations with 750 μ M dNTP (working concentration 300 μ M).
3. enzyme mixture: 200U/ul MMLV reversed transcriptive enzyme (usage quantity is the 100-200U/ person-portion) and 2.5-5U/ulHotstartTaq archaeal dna polymerase (usage quantity is the 2-5U/ person-portion) ,-20 ℃ of preservations.
Enzyme mixture can also be 200U/ul Superscript III reversed transcriptive enzyme (usage quantity is the 50-100U/ person-portion) and 2.5-5U/ul Taq Plantium archaeal dna polymerase (usage quantity is the 2-5U/ person-portion) ,-20 ℃ of preservations.
4. primer and probe mixture: comprise primer sequence (SEQ ID No.1, SEQ ID No.2, SEQ ID No.4 and SEQ ID No.5) 6 μ M (working concentration is 200nM), primer probe (SEQ ID No.3 and SEQ ID No.6,5 ' end mark fluorescent reporter group FAM, 3 ' end fluorescent quenching group TAMRA) 6 μ M (working concentration is 200nM) and interior mark probe (SEQ ID No.7,5 ' end mark fluorescent reporter group VIC, 3 ' end fluorescent quenching group TAMRA) 3 μ M (working concentration is 100nM) ,-20 ℃ of preservations.
Of particular note, the nucleus of this test kit is primer, probe and interior mark Quality Control virus-like particle, all the other reagent can be selected to use according to the experiment custom, for example as the reagent that extracts RNA, can select " Trizol " or " paramagnetic particle method extraction reagent "; As the reversed transcriptive enzyme that amplified reaction is used, can select " MMLV reversed transcriptive enzyme " or " Superscript III reversed transcriptive enzyme "; Archaeal dna polymerase also can be selected " Hotstart Taq archaeal dna polymerase " or " Taq Plantium archaeal dna polymerase ".But, when selecting " MMLV reversed transcriptive enzyme " for use, should be used " HotstartTaq archaeal dna polymerase ", and when selecting " Superscript III reversed transcriptive enzyme ", should be used " Taq PlantiumDNA polysaccharase ".
In the present invention, in order to reach more excellent detection effect, when using the Taqman method to make quantitative PCR, we also use, and innovative internal reference system--virus-like particle internal reference system carries out false negative control, obtains quantitative result accurately to proofread and correct PCR efficient.Find that in the research of MS2 phage envelope protein the loop-stem structure RNA sequence that envelope protein and phage replication enzyme 5 ' end are made up of 19 bases (19mer) has specificity to interact, this effect can cause the assembling of phage ghost, simultaneously, phage genome RNA is packaged in the coating.The foreign study personnel find to introduce non-phage gene sequence behind packaging site also can cause packing.Around this principle, make up the recombinant plasmid (just having replaced the detection probes sequence in the original series in the recombinant plasmid) of interior mark virus-like particle with interior mark probe sequence by the method for overlapping PCR.Basic plasmid is pET28b (a Novagen company), insert the nucleotide sequence (SEQID No.8) of 81-1769 of MS2 phage genome in multiple clone site NcoI and BamHI site, insert the 335bp fragment SEQ ID No.9 of HIV-1 virus GAG gene then in multiple clone site BamHI site and HindIII site).
The nucleotide sequence that the MS2 phage genome is 81-1769 (SEQ ID No.8):
ATGGCTATCGCTGTAGGTAGCCGGAATTCCATTCCTAGGAGGTTTGACCTGTGCGAGCTTTTAGTACCCTTGAT
AGGGAGAACGAGACCTTCGTCCCCTCCGTTCGCGTTTACGCGGACGGTGAGACTGAAGATAACTCATTCTCTTT
AAAATATCGTTCGAACTGGACTCCCGGTCGTTTTAACTCGACTGGGGCCAAAACGAAACAGTGGCACTACCCCT
CTCCGTATTCACGGGGGGCGTTAAGTGTCACATCGATAGATCAAGGTGCCTACAAGCGAAGTGGGTCATCGTGG
GGTCGCCCGTACGAGGAGAAAGCCGGTTTCGGCTTCTCCCTCGACGCACGCTCCTGCTACAGCCTCTTCCCTGT
AAGCCAAAACTTGACTTACATCGAAGTGCCGCAGAACGTTGCGAACCGGGCGTCGACCGAAGTCCTGCAAAAGG
TCACCCAGGGTAATTTTAACCTTGGTGTTGCTTTAGCAGAGGCCAGGTCGACAGCCTCACAACTCGCGACGCAA
ACCATTGCGCTCGTGAAGGCGTACACTGCCGCTCGTCGCGGTAATTGGCGCCAGGCGCTCCGCTACCTTGCCCT
AAACGAAGATCGAAAGTTTCGATCAAAACACGTGGCCGGCAGGTGGTTGGAGTTGCAGTTCGGTTGGTTACCAC
TAATGAGTGATATCCAGGGTGCATATGAGATGCTTACGAAGGTTCACCTTCAAGAGTTTCTTCCTATGAGAGCC
GTACGTCAGGTCGGTACTAACATCAAGTTAGATGGCCGTCTGTCGTATCCAGCTGCAAACTTCCAGACAACGTG
CAACATATCGCGACGTATCGTGATATGGTTTTACATAAACGATGCACGTTTGGCATGGTTGTCGTCTCTAGGTA
TCTTGAACCCACTAGGTATAGTGTGGGAAAAGGTGCCTTTCTCATTCGTTGTCGACTGGCTCCTACCTGTAGGT
AACATGCTCGAGGGCCTTACGGCCCCCGTGGGATGCTCCTACATGTCAGGAACAGTTACTGACGTAATAACGGG
TGAGTCCATCATAAGCGTTGACGCTCCCTACGGGTGGACTGTGGAGAGACAGGGCACTGCTAAGGCCCAAATCT
CAGCCATGCATCGAGGGGTACAATCCGTATGGCCAACAACTGGCGCGTACGTAAAGTCTCCTTTCTCGATGGTC
CATACCTTAGATGCGTTAGCATTAATCAGGCAACGGCTCTCTAGATAGAGCCCTCAACCGGAGTTTGAAGCATG
GCTTCTAACTTTACTCAGTTCGTTCTCGTCGACAATGGCGGAACTGGCGACGTGACTGTCGCCCCAAGCAACTT
CGCTAACGGGGTCGCTGAATGGATCAGCTCTAACTCGCGTTCACAGGCTTACAAAGTAACCTGTAGCGTTCGTC
AGAGCTCTGCGCAGAATCGCAAATACACCATCAAAGTCGAGGTGCCTAAAGTGGCAACCCAGACTGTTGGTGGT
GTAGAGCTTCCTGTAGCCGCATGGCGTTCGTACTTAAATATGGAACTAACCATTCCAATTTTCGCTACGAATTC
CGACTGCGAGCTTATTGTTAAGGCAATGCAAGGTCTCCTAAAAGATGGAAACCCGATTCCCTCAGCAATCGCAG
CAAACTCCGGCATCTACTAATAGACGCCGGCCATTCAAACATGAGGATTACCCATGTCGAA
The 335bp fragment (SEQ ID No.9) of HIV-1 virus GAG gene:
TCTCCAAGGGCAAATGGTACATCAGCCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTGGTAGAAGAGA
AGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGGCCCCCTCAAAGCCGACAGATTTAAACACCATGCTAAA
CACAGTGGGGGGACATCAAGCAGCCATGCAAATGCTAAAAGATTCAGGCCCCCTCAAAGCCGACATAGGCTACA
TCCAGTGCATGCAGGGCCTATTGCACCAGGCCAAATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTA
GTAACCTGCAGGAACAAATAGCATGGATGACGGGTAACC
The escherichia coli cloning of sequencing result being justified with this area ordinary method carries out great expression.Reference is seen: contain the structure and the expression of the virus-like particle of anti-rnase of human a-fetoprotein mRNA partial sequence, Chinese hepatopathy magazine, 2005 04 phases.Inoculate interior mark plasmid clone overnight incubation, switching back continuation cultivation in 1: 100 is carried out IPTG after 2 hours and is induced.Cultivate centrifugal thalline after 20 hours, carrying out ultrasonic bacteria breaking, centrifugal collection supernatant, 37 ℃ of digestion of DNASE/RNASE 2 hours, electrophoresis.The supernatant of collecting is added the 0.6G/ML cesium chloride, carry out ultracentrifugation purified virus sample particle, 45000RPM * 20 hour.According to every pipe 400UL separation of taking a sample, get the sample electrophoresis, the pipe that is associated with virus-like particle carries out supersound process liquid and dialyses.Carry out once super again from purifying.Will be in the dialyzate add the 0.6G/ML cesium chloride, 56300RPM * 20 hour.According to every pipe 400UL separation of taking a sample, get the sample electrophoresis again, the pipe that is associated with virus-like particle carries out supersound process, and treatment solution is dialysed and promptly obtained the virus-like particle of purifying.Virus-like particle behind the purifying is carried out quantitatively, be kept at 20mM Tris (U.S. Sigma company) pH8.8; 50mM KCl (U.S. Sigma company); 4mM MgCl
2In (U.S. Sigma company) solution, concentration is 5*10
12Copy/ml), working concentration is 1000 copy/ml.
We modify the nucleotide sequence in the virus-like particle according to the experimental design purpose, change the sequence that HIV-1 detects sequence middle probe binding site, thereby the sequence and the purpose fragment of interior mark Quality Control made a distinction, thereby make up corresponding interior mark Quality Control thing.Virus-like particle has following characteristics: (1) in normal people's negative serum 45 ℃, and place and can both keep stable in 3 days, meet the stability criterion that biomaterial transports; (2) virus-like particle can have good tolerance to RNASEA and DNASEI; (3) no infectivity.
Be to determine best in the mark incorporation, we do behind 10 times of serial dilutions (10 with the virus-like particle of unknown concentration
6-13Dilution) adopt the probe (SEQ ID No.7) of VIC mark to detect, standard substance are done PCR in real time for adopting the RNA of the quantitative interior indicated weight group plasmid in-vitro transcription of spectrophotometer.Increase reaction conditions with 7500Real Time PCR System (u.s.a. applied biosystem company): 50 ℃ 30 minutes 94 ℃, 3 minutes; 95 ℃, 10 seconds 60 ℃, 45 seconds (50cycles), recording virus-like particle concentration is 5*10
12Copy/ml.Again with the sample (HIV 4000IU/ml, HIV 40000IU/ml and HIV 2000000IU/ml) of three parts of different concns and different dilution in mark virus-like particles (10
3, 10
4, 10
5, 10
6With 10
7) carry out chessboard method PCR, paramagnetic particle method with Xiamen Kehua extracts reagent (paramagnetic particle method in HBV-HCV-HIV nucleic acid amplification (PCR) the fluorescence combined detection kit of Shanghai Kehua Bio-engineering Co., Ltd (KHB PCR HBV-HCV-HIV-02 (scientific research is used)) extracts reagent) extraction nucleic acid then, carries out augmentation detection.The result shows that it is best that the virus-like particle of 1000 copy/ml joins in the sample as interior mark Quality Control thing.
The basis of detection of nucleic acids is the coupling of primer probe and target sequence.Because the variant nucleic acid sequence degree of HIV-1 is bigger, adopts a pair of primer probe can not cover all hypotypes, will inevitably cause omission.Thereby two specific probe detection kit that we invent have adopted the omission of having avoided of two pairs of primer probe maximum possible.Compare with single probe in detecting test kit, we have the detection sensitivity height by two probe in detecting test kits of invention, and false negative rate is low, the characteristics that detection specificity is good.The detection lower limit of two probe in detecting test kits is greatly about 125IU/ml, the A-H hypotype and the O family of M family be can detect, the domestic epidemic strain A that Nat'l Pharmaceutical ﹠ Biological Products Control Institute provides, B detected, C, D, F, G, CRF01-AE, when CRF07-BC, the blood grouping serum of CRF08-BC, epidemic strain all can detect in the host country.When detecting HIV-1 negative sample and other Virus Samples, have 100% specificity, do not have non-specific amplification.Carrying out 60 parts of clinical samples when detecting, compare with single probe in detecting test kit, two probe in detecting test kits of our invention have better verification and measurement ratio (detect 50 parts of positives in 60 parts, remaining 10 parts of negative findingses adopt the AmplicorHIV-1 Monitor vl.5test that generally acknowledges to detect and prove feminine gender).
The invention has the beneficial effects as follows: one group of new HIV of our invention detects A-H hypotype and the O family that sequence and test kit can detect M family, and is wider than present commercial goods test kit sensing range; Method is simple to operate, is easy to grasp, and is less demanding to operator; Detect lower limit and be low to moderate 125IU/ml; Adopt the two primer systems of two probes can both be well quantitative accurately, guaranteed that hypotype to various types can both be attached to and can adapt to the possible sudden change of combining site to change various HIV-1 hypotypes, thereby accurately quantitatively; With low cost, with respect to the cost of import reagent box 50-80 dollar/person-portion, our the test kit cost of invention only is a 10-20 yuan/person-portion.
The invention will be further described below in conjunction with the drawings and specific embodiments; it is not limitation of the invention; according to prior art well known in the art; embodiments of the present invention are not limited to this; therefore all this areas of having done according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.
Description of drawings
Fig. 1 detects the detection lower limit result of lower limit figure as a result: A when adopting probe 1 and primer to 1 system for the present invention, the detection lower limit result of B when adopting probe 2 and primer to 2 systems.
Fig. 2 is specificity test-results figure.
Embodiment
Entrust Jikang Biotechnology Co Ltd, Shanghai synthetic
Probe 15 '-ACCATCAATGAGGAAGCTGCAGAATGGG-3 ' SEQ ID No.3
The reverse 5 '-ATTTGCATAGCTGCTTGATGTCC-3 ' SEQ of primer 2 ID No.5
Probe 25 '-TCAGCATTATCAGAAGGAGCCACCCCACA-3 ' SEQ ID No.6
Probe 35 '-TCAGGCCCCCTCAAAGCCGAC-3 ' SEQ ID No.7
Wherein, 5 ' end of probe 1 and probe 2 sequences is mark fluorescent reporter group FAM respectively, and 3 ' end is mark fluorescent quenching group TAMRA respectively; 5 ' end mark fluorescent reporter group VIC of probe 3,3 ' end fluorescent quenching group TAMRA.
One. form
1.RNA extraction reagent: be selected from Trizol or paramagnetic particle method and extract a kind of in the reagent, all contain and mark virus-like particle in the 1000 copy/ml:
(1) Trizol: purchase company, contain mark virus-like particle in the 1000 copy/ml in Invitrogen, by this prepared in laboratory, method cf. publication, 4 ℃ of preservations.
(2) paramagnetic particle method extracts reagent: comprise plurality of reagents such as lysate, purchase in Shanghai Kehua Bio-engineering Co., Ltd; In its lysate, contain mark virus-like particle in the 1000 copy/ml, by this prepared in laboratory, method cf. publication, 4 ℃ of preservations.
2. reaction solution: by 50mM Tris (working concentration 20mM), 125mM KCl (working concentration 50mM), 10mMMgCl
2(working concentration 4mM), 500ug/ml BSA (working concentration 200ug/ml), 0.375mM Sorbitol (working concentration 0.15mM), 0.025mM Triton (working concentration 0.01mM), RNase inhibitor Rnasin 2.5-5U/ul (purchase the Promega company in the U.S., usage quantity is the 5-10U/ person-portion), form-20 ℃ of preservations with 750 μ M dNTP (working concentration 300 μ M).
3. enzyme mixture: 200U/ul MMLV reversed transcriptive enzyme (is purchased the Promega company in the U.S., usage quantity is the 100-200U/ person-portion) and 2.5-5U/ul HotstartTaq archaeal dna polymerase (purchase in TIANGEN Biotech (Beijing) Co., Ltd., usage quantity is the 2-5U/ person-portion) ,-20 ℃ of preservations.
4. primer and probe mixture: comprise primer sequence (SEQ ID No.1; SEQ ID No.2; SEQ ID No.4 and SEQ ID No.5) 6 μ M (working concentration is 200nM); primer probe (SEQ ID No.3 and SEQ ID No.6; 5 ' end mark fluorescent reporter group FAM; 3 ' end fluorescent quenching group TAMRA) 6 μ M (working concentration is 200nM) and interior mark probe (SEQ ID No.7; 5 ' end mark fluorescent reporter group VIC; 3 ' end fluorescent quenching group TAMRA) 3 μ M (working concentration is 100nM); all entrust Jikang Biotechnology Co Ltd, Shanghai synthetic ,-20 ℃ of preservations.
The preparation method of virus-like particle RNA is summarized as follows: basic plasmid is pET28b (a Novagen company), insert the nucleotide sequence (SEQ IDNo.8) of 81-1769 of MS2 phage genome in multiple clone site NcoI and BamHI site, insert the 335bp fragment (SEQ ID No.9) of HIV-1 virus GAG gene then in multiple clone site BamHI site and HindIII site.The escherichia coli cloning of sequencing result being justified with this area ordinary method carries out great expression.Inoculate interior mark plasmid clone overnight incubation, switching back continuation cultivation in 1: 100 is carried out IPTG after 2 hours and is induced.Cultivate centrifugal thalline after 20 hours, carrying out ultrasonic bacteria breaking, centrifugal collection supernatant, 37 ℃ of digestion of DNase/RNase 2 hours, electrophoresis.The supernatant of collecting is added the 0.6g/ml cesium chloride, carry out ultracentrifugation purified virus sample particle, 45000rpm * 20 hour.According to every pipe 400ul separation of taking a sample, get the sample electrophoresis, the pipe that is associated with virus-like particle carries out supersound process liquid and dialyses.Carry out once super again from purifying.Will be in the dialyzate add the 0.6g/ml cesium chloride, 56300rpm * 20 hour.According to every pipe 400ul separation of taking a sample, get the sample electrophoresis again, the pipe that is associated with virus-like particle carries out supersound process, and treatment solution is dialysed and promptly obtained the virus-like particle of purifying.Virus-like particle behind the purifying is carried out quantitatively.
Two. using method
In the 30ul reaction system, add reaction solution 12ul, enzyme mixture 2ul, primer probe mixture 1ul, the RNA sample 15ul of extraction (adopt Trizol method or paramagnetic particle method to extract and obtain, see embodiment 4).
The reaction conditions of test kit 1 is: increase reaction conditions with 7500Real Time PCR System (u.s.a. applied biosystem company): 42 ℃ 30 minutes 95 ℃, 3 minutes; 95 ℃, 10 seconds, 55 ℃, 20 seconds, 72 ℃, 30 seconds (5cycles); 95 ℃, 15 seconds 60 ℃, 45 seconds (50cycles).
One. form
1.RNA extraction reagent: be selected from Trizol or paramagnetic particle method and extract a kind of in the reagent, all contain and mark virus-like particle in the 1000 copy/ml:
(1) Trizol: purchase company, contain mark virus-like particle in the 1000 copy/ml in Invitrogen, by this prepared in laboratory, method cf. publication, 4 ℃ of preservations.
(2) paramagnetic particle method extracts reagent: comprise plurality of reagents such as lysate, purchase in Shanghai Kehua Bio-engineering Co., Ltd; In its lysate, contain mark virus-like particle in the 1000 copy/ml, by this prepared in laboratory, method cf. publication, 4 ℃ of preservations.
2. reaction solution: by 50mM Tris (purchasing Sigma company, working concentration 20mM), 125mM KCl (purchasing Sigma company, working concentration 50mM), 10mM MgCl in the U.S. in the U.S.
2(purchase Sigma company in the U.S., working concentration 4mM), 500ug/ml BSA (purchases the Sigma company in the U.S., working concentration 200ug/ml), 0.375mMSorbitol (purchases the Sigma company in the U.S., working concentration 0.15mM), 0.025mM Triton (purchases the Sigma company in the U.S., working concentration 0.01mM), RNase inhibitor Rnasin 2.5-5U/ul (purchases the Promega company in the U.S., usage quantity is the 5-10U/ person-portion) and 750 μ M dNTP (purchase Promega company in the U.S., working concentration 300 μ M) form-20 ℃ of preservations.
3. enzyme mixture: 200U/ul Superscript III reversed transcriptive enzyme (is purchased the company in Invitrogen, usage quantity is the 50-100U/ person-portion) and 2.5-5U/ul Taq Plantium archaeal dna polymerase (purchase in TIANGEN Biotech (Beijing) Co., Ltd., usage quantity is the 2-5U/ person-portion) ,-20 ℃ of preservations.
4. primer and probe mixture: comprise primer sequence (SEQ ID No.1; SEQ ID No.2; SEQ ID No.4 and SEQ ID No.5) 6 μ M (working concentration is 200nM); primer probe (SEQ ID No.3 and SEQ ID No.6; 5 ' end mark fluorescent reporter group FAM; 3 ' end fluorescent quenching group TAMRA) 6 μ M (working concentration is 200nM) and interior mark probe (SEQ ID No.7; 5 ' end mark fluorescent reporter group VIC; 3 ' end fluorescent quenching group TAMRA) 3 μ M (working concentration is 100nM); all entrust Jikang Biotechnology Co Ltd, Shanghai synthetic ,-20 ℃ of preservations.
Two. using method
In the 30ul reaction system, add reaction solution 12ul, enzyme mixture 2ul, primer probe mixture 1ul, the RNA sample 15ul of extraction (adopt Trizol method or paramagnetic particle method to extract and obtain, see embodiment 4).
Increase reaction conditions with 7500Real Time PCR System (u.s.a. applied biosystem company): 50 ℃ 25 minutes 95 ℃, 3 minutes; 95 ℃, 10 seconds, 55 ℃, 20 seconds, 72 ℃, 30 seconds (5cycles); 95 ℃, 15 seconds 60 ℃, 45 seconds (50cycles).
Embodiment 4. test experience
One. material
The accepted standard product are for coming from the HIV-1 international standard substance (1*10 of NIBSC (Britain's country's biological standardization and Control Study institute)
3IU/ml) and international standard serum dish (containing the A-H of M family hypotype, N family, O family and negative serum), 60 parts of patients serums come from ditan hospital and You An hospital.
Two. method
1. extract RNA: can adopt any in embodiment 2 and 3 two kinds of test kits of embodiment according to operating habit:
(1) the Trizol method is extracted RNA:
Get autoclaved 1.5ml centrifuge tube, every pipe adds 300ul Trizol (purchasing the company in Invitrogen), adds the 100ul sample then respectively, and 100ul water is as negative control, and suction nozzle is blown and beaten mixing repeatedly, adds precooling 100ul chloroform then, puts upside down mixing; 13,000rpm, centrifugal 15 minutes; Get the sterilization centrifuge tube, every pipe adds the pre-cold isopropanol of 200ul, gets above-mentioned upper phase and adds in the Virahol pipe, puts upside down mixing; 13,000rpm, centrifugal 15 minutes, suction nozzle was inhaled and is removed supernatant, adds 75% ethanol of 300ul precooling, puts upside down washing, and 13,000rpm, centrifugal 10 minutes, remove supernatant with the suction nozzle suction, 50 ℃, dry 5 minutes, add DEPC water 30ul dissolving RNA.
(2) adopt the paramagnetic particle method of Shanghai Kehua Bio-engineering Co., Ltd to extract reagent extraction nucleic acid:
A every hole in 96 orifice plates adds the 20ul agent of disinthibiting, and adds sample 100ul, adds lysate 100ul;
B carries out the first step reaction heating pyrolyze on the nucleic acid extraction instrument of Xiamen Kehua;
C adds magnetic bead solution 100ul, washings A 200ul, B 200ul, C 200ul and elutriant 60ul respectively in other 5 allegros;
D waits for and puts into second block of plate (having added magnetic bead solution) absorption magnetic bead after the first step finishes;
E is reentered into first block of plate again with magnetic bead and the hybridization of cracked sample;
F washs magnetic bead, and washings A 200ul, B 200ul, C 200ul are respectively once;
G wash-out nucleic acid is in elutriant 60ul.
2. detect: can adopt any in embodiment 2 and 3 two kinds of test kits of embodiment according to operating habit, detection method is seen embodiment 2 and embodiment 3.
Three. the result
After carrying out nucleic acid extraction behind 60 parts of clinical samples adding virus-like particles, detect, the result shows that the two probe in detecting systems of employing have better recall rate.
The detection clinical detection result of 60 parts of clinical samples of table 1
Embodiment 4. sensitivity tests
One. method
Standard substance are carried out gradient dilution and international standard serum dish to be adopted the paramagnetic particle method of Xiamen Kehua to extract reagent to extract nucleic acid (extracting method is with embodiment 3), carry out augmentation detection then together.The sample that extracts sees Table 2:
Table 2 extracts sample list
| 100000 | 250 | 250 | 125 | 62.5 | A | N | |
| 100000 | 250 | 250 | 125 | 62.5 | | O | |
| 10000 | 250 | 125 | 125 | 62.5 | | Negative | |
| 10000 | 250 | 125 | 125 | 62.5 | |
||
| 1000 | 250 | 125 | 62.5 | 62.5 | |
||
| 1000 | 250 | 125 | 62.5 | 62.5 | |
||
| 500 | 250 | 125 | 62.5 | | G | ||
| 500 | 250 | 125 | 62.5 | Negative | H |
Two. the result
The result shows that the detection sensitivity of two probe in detecting test kits is about 125IU/ml, sees shown in Fig. 1 and the table 3.
Detection lower limit result when table 3 adopts two probe system
The test of embodiment 5. specificitys
One. method
International serotype dish progressive type specific detection.Extract amplification method with embodiment 4.
Two. the result
As shown in Figure 2, the result shows when adopting two probe in detecting system can detect the A-H hypotype and the O family of M family, but there is the hypotype omission in M family when adopting single probe system, and N family and O family can not detect.
In sum, one group of new HIV of our invention detects sequence and test kit has obvious superiority than domestic and international HIV-1 kit for detecting nucleic acid, is fit to domestic production and uses.
Sequence table
＜110〉Beijing Hospital
＜120〉nucleotide sequence of rapid detection HIV virus, method and external diagnosis reagent case
<130>
<160>9
<170>PatentIn version 3.3
<210>1
<211>21
<212>DNA
＜213〉synthetic
<400>1
acatcaagca gccatgcaaa t 21
<210>2
<211>25
<212>DNA
＜213〉synthetic
<400>2
ctatgtcact tccccttggt tctct 25
<210>3
<211>28
<212>DNA
＜213〉synthetic
<400>3
accatcaatg aggaagctgc agaatggg 28
<210>4
<211>23
<212>DNA
＜213〉synthetic
<400>4
gctttcagcc cagaagtaat acc 23
<210>5
<211>23
<212>DNA
＜213〉synthetic
<400>5
atttgcatag ctgcttgatg tcc 23
<210>6
<211>29
<212>DNA
＜213〉synthetic
<400>6
tcagcattat cagaaggagc caccccaca 29
<210>7
<211>21
<212>DNA
＜213〉synthetic
<400>7
tcaggccccc tcaaagccga c 21
<210>8
<211>1689
<212>DNA
＜213〉nucleotide sequence of 81-1769 of MS2 phage genome
<400>8
atggctatcg ctgtaggtag ccggaattcc attcctagga ggtttgacct gtgcgagctt 60
ttagtaccct tgatagggag aacgagacct tcgtcccctc cgttcgcgtt tacgcggacg 120
gtgagactga agataactca ttctctttaa aatatcgttc gaactggact cccggtcgtt 180
ttaactcgac tggggccaaa acgaaacagt ggcactaccc ctctccgtat tcacgggggg 240
cgttaagtgt cacatcgata gatcaaggtg cctacaagcg aagtgggtca tcgtggggtc 300
gcccgtacga ggagaaagcc ggtttcggct tctccctcga cgcacgctcc tgctacagcc 360
tcttccctgt aagccaaaac ttgacttaca tcgaagtgcc gcagaacgtt gcgaaccggg 420
cgtcgaccga agtcctgcaa aaggtcaccc agggtaattt taaccttggt gttgctttag 480
cagaggccag gtcgacagcc tcacaactcg cgacgcaaac cattgcgctc gtgaaggcgt 540
acactgccgc tcgtcgcggt aattggcgcc aggcgctccg ctaccttgcc ctaaacgaag 600
atcgaaagtt tcgatcaaaa cacgtggccg gcaggtggtt ggagttgcag ttcggttggt 660
taccactaat gagtgatatc cagggtgcat atgagatgct tacgaaggtt caccttcaag 720
agtttcttcc tatgagagcc gtacgtcagg tcggtactaa catcaagtta gatggccgtc 780
tgtcgtatcc agctgcaaac ttccagacaa cgtgcaacat atcgcgacgt atcgtgatat 840
ggttttacat aaacgatgca cgtttggcat ggttgtcgtc tctaggtatc ttgaacccac 900
taggtatagt gtgggaaaag gtgcctttct cattcgttgt cgactggctc ctacctgtag 960
gtaacatgct cgagggcctt acggcccccg tgggatgctc ctacatgtca ggaacagtta 1020
ctgacgtaat aacgggtgag tccatcataa gcgttgacgc tccctacggg tggactgtgg 1080
agagacaggg cactgctaag gcccaaatct cagccatgca tcgaggggta caatccgtat 1140
ggccaacaac tggcgcgtac gtaaagtctc ctttctcgat ggtccatacc ttagatgcgt 1200
tagcattaat caggcaacgg ctctctagat agagccctca accggagttt gaagcatggc 1260
ttctaacttt actcagttcg ttctcgtcga caatggcgga actggcgacg tgactgtcgc 1320
cccaagcaac ttcgctaacg gggtcgctga atggatcagc tctaactcgc gttcacaggc 1380
ttacaaagta acctgtagcg ttcgtcagag ctctgcgcag aatcgcaaat acaccatcaa 1440
agtcgaggtg cctaaagtgg caacccagac tgttggtggt gtagagcttc ctgtagccgc 1500
atggcgttcg tacttaaata tggaactaac cattccaatt ttcgctacga attccgactg 1560
cgagcttatt gttaaggcaa tgcaaggtct cctaaaagat ggaaacccga ttccctcagc 1620
aatcgcagca aactccggca tctactaata gacgccggcc attcaaacat gaggattacc 1680
catgtcgaa 1689
<210>9
<211>335
<212>DNA
＜213〉the 335bp fragment of HIV-1 virus GAG gene
<400>9
tctccaaggg caaatggtac atcagcccat atcacctaga actttaaatg catgggtaaa 60
agtggtagaa gagaaggctt ttagcccaga agtaataccc atgttttcag gccccctcaa 120
agccgacaga tttaaacacc atgctaaaca cagtgggggg acatcaagca gccatgcaaa 180
tgctaaaaga ttcaggcccc ctcaaagccg acataggcta catccagtgc atgcagggcc 240
tattgcacca ggccaaatga gagaaccaag gggaagtgac atagcaggaa ctactagtaa 300
cctgcaggaa caaatagcat ggatgacggg taacc 335
Claims (4)
1. one group of nucleotide sequence that detects HIV virus is characterized in that: have base sequence shown in sequence table SEQ ID No.1 to the SEQ IDNo.7; Wherein sequence SEQ ID No.1 and SEQ ID No.2 are that primer is right, and SEQ ID No.4 and SEQ ID No.5 are that primer is right, and SEQ ID No.3, SEQ ID No.6 and SEQ ID No.7 are respectively probe sequence; In one-time detection, use jointly.
2. external diagnosis reagent case that contains the detection HIV virus of two primers, two probes, form by following reagent:
(1) RNA extracts reagent: be selected from Trizol or paramagnetic particle method and extract a kind of in the reagent, all contain and mark virus-like particle in the 1000 copy/ml;
(1) Trizol: contain mark virus-like particle in the 1000 copy/ml, 4 ℃ of preservations;
(2) paramagnetic particle method extracts reagent: contain mark virus-like particle in the 1000 copy/ml in its lysate, 4 ℃ of preservations;
(2) reaction solution: by 50mM Tris, 125mM KCl, 10mM MgCl
2, 500ug/ml BSA, 0.375mMSorbitol, 0.025mM Triton, RNase inhibitor Rnasin 2.5-5U/ul and 750 μ M dNTP form-20 ℃ of preservations;
(3) enzyme mixture: 200U/ul MMLV reversed transcriptive enzyme and 2.5-5U/ul HotstartTaq archaeal dna polymerase ,-20 ℃ of preservations;
(4) primer and probe mixture: comprise primer sequence SEQ ID No.1, SEQ ID No.2, SEQ ID No.4 and SEQ ID No.5,6 μ M, primer probe SEQ ID No.3 and SEQ ID No.6,5 ' end mark fluorescent reporter group FAM, 3 ' end fluorescent quenching group TAMRA, 6 μ M and interior mark probe SEQ ID No.7,5 ' end mark fluorescent reporter group VIC, 3 ' end fluorescent quenching group TAMRA, 3 μ M ,-20 ℃ of preservations.
3. external diagnosis reagent case that contains the detection HIV virus of two primers, two probes, form by following reagent:
(1) RNA extracts reagent: be selected from Trizol or paramagnetic particle method and extract a kind of in the reagent, all contain and mark virus-like particle in the 1000 copy/ml:
(1) Trizol: contain mark virus-like particle in the 1000 copy/ml, 4 ℃ of preservations;
(2) paramagnetic particle method extracts reagent: contain mark virus-like particle in the 1000 copy/ml in its lysate, 4 ℃ of preservations;
(2) reaction solution: by 50mM Tris, 125mM KCl, 10mM MgCl
2, 500ug/ml BSA, 0.375mMSorbitol, 0.025mM Triton, RNase inhibitor Rnasin 2.5-5U/ul and 750 μ M dNTP form-20 ℃ of preservations;
(3) enzyme mixture: 200U/ul Superscript III reversed transcriptive enzyme and 2.5-5U/ul Taq PlantiumDNA polysaccharase ,-20 ℃ of preservations;
(4) primer and probe mixture: comprise primer sequence SEQ ID No.1, SEQ ID No.2, SEQ ID No.4 and SEQ ID No.5,6 μ M, primer probe SEQ ID No.3 and SEQ ID No.6,5 ' end mark fluorescent reporter group FAM, 3 ' end fluorescent quenching group TAMRA, 6 μ M and interior mark probe SEQ ID No.7,5 ' end mark fluorescent reporter group VIC, 3 ' end fluorescent quenching group TAMRA, 3 μ M ,-20 ℃ of preservations.
4. according to claim 2 or 3 described a kind of external diagnosis reagent cases that contain the detection HIV virus of two primers, two probes, it is characterized in that:
The mark virus-like particle makes by the following method in described: basic plasmid is pET28b, insert the nucleic acid sequence SEQ ID No.8 of 81-1769 of MS2 phage genome in multiple clone site NcoI and BamHI site, insert the 335bp fragment SEQ IDNo.9 of HIV-1 virus GAG gene then in multiple clone site BamHI site and HindIII site, with escherichia coli expression and purifying.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006101136131A CN100419089C (en) | 2006-10-09 | 2006-10-09 | Nucleotide sequence for fast inspecting HIV virus, its method and extra-diagnostic reagent kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006101136131A CN100419089C (en) | 2006-10-09 | 2006-10-09 | Nucleotide sequence for fast inspecting HIV virus, its method and extra-diagnostic reagent kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1940090A CN1940090A (en) | 2007-04-04 |
| CN100419089C true CN100419089C (en) | 2008-09-17 |
Family
ID=37958612
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006101136131A Expired - Fee Related CN100419089C (en) | 2006-10-09 | 2006-10-09 | Nucleotide sequence for fast inspecting HIV virus, its method and extra-diagnostic reagent kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100419089C (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074446B (en) * | 2013-01-10 | 2014-04-09 | 湖南圣湘生物科技有限公司 | Human immunodeficiency virus (HIV) nucleic acid detection kit |
| CN103789277A (en) * | 2014-01-16 | 2014-05-14 | 东北制药集团辽宁生物医药有限公司 | Preparation method of artificial dual false virus particle comprising HCV (hepatitis C virus) and HIV (human immunodeficiency virus) nucleic acid fragments |
| CN106119413B (en) * | 2016-07-01 | 2020-03-20 | 浙江省疾病预防控制中心 | AIDS virus multiple fluorescence PCR detection kit and detection method |
| CN107385116B (en) * | 2017-09-13 | 2021-02-19 | 北京旌准医疗科技有限公司 | Method for detecting type 1 human immunodeficiency virus and special reagent set thereof |
| CN108998570B (en) * | 2018-08-14 | 2021-11-02 | 首都医科大学附属北京佑安医院 | HIV-1 total DNA quantitative detection primer pair, probe and detection kit capable of covering multiple subtypes |
| CN117912558A (en) * | 2024-03-19 | 2024-04-19 | 北京医院 | Method for producing nucleic acid sequence which does not exist in nature and nucleic acid sequence produced thereby |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1680598A (en) * | 2005-02-03 | 2005-10-12 | 上海科华生物工程股份有限公司 | Fluorescent quantitative detecting kit of human immune deficiency virus HIV-1 nucleic acid amplification |
-
2006
- 2006-10-09 CN CNB2006101136131A patent/CN100419089C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1680598A (en) * | 2005-02-03 | 2005-10-12 | 上海科华生物工程股份有限公司 | Fluorescent quantitative detecting kit of human immune deficiency virus HIV-1 nucleic acid amplification |
Non-Patent Citations (4)
| Title |
|---|
| Amplification and detection of a single molecule of humanimmunodeficiency virus RNA.. S Nakamura, et al.Virus Genes,Vol.7 No.4. 1993 |
| Amplification and detection of a single molecule of humanimmunodeficiency virus RNA.. S Nakamura, et al.Virus Genes,Vol.7 No.4. 1993 * |
| 实时荧光RT-PCR在HIV母婴传播病例诊断中的应用. 颜苹苹等.海峡预防医学杂志，第10卷第4期. 2004 |
| 实时荧光RT-PCR在HIV母婴传播病例诊断中的应用. 颜苹苹等.海峡预防医学杂志，第10卷第4期. 2004 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1940090A (en) | 2007-04-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021196498A1 (en) | Primer, probe and kit for detecting novel coronavirus | |
| CN111534643B (en) | Kit for detecting nucleic acid of respiratory tract pathogen, detection method and application | |
| WO2021174674A1 (en) | Composition, kit and method for detecting and typing coronaviruses | |
| Sarantis et al. | Comprehensive detection and serotyping of human adenoviruses by PCR and sequencing | |
| Han et al. | Simultaneous amplification and identification of 25 human papillomavirus types with Templex technology | |
| Xu et al. | Species-specific identification of human adenoviruses by a multiplex PCR assay | |
| Green et al. | A nested reverse transcriptase PCR assay for detection of small round-structured viruses in environmentally contaminated molluscan shellfish | |
| CN100419089C (en) | Nucleotide sequence for fast inspecting HIV virus, its method and extra-diagnostic reagent kit | |
| JP2014061007A (en) | Diagnostic assays for parvovirus b19 | |
| O'Carroll et al. | Functional redundancy in HIV-1 viral particle assembly | |
| CN109402239B (en) | Hands-free direct amplification reagent for real-time fluorescent quantitative PCR and application thereof | |
| JP7064473B2 (en) | How to detect influenza A virus and influenza B virus | |
| CN103789277A (en) | Preparation method of artificial dual false virus particle comprising HCV (hepatitis C virus) and HIV (human immunodeficiency virus) nucleic acid fragments | |
| CN111748651B (en) | Kit for detecting nucleic acid of respiratory tract pathogen, detection method and application | |
| WO2023109031A1 (en) | Respiratory pathogen detection kit, and preparation method therefor and use thereof | |
| Kim et al. | Isolation and identification of monkeypox virus MPXV-ROK-P1-2022 from the first case in the Republic of Korea | |
| TWI362419B (en) | Nucleic acid detection | |
| Oshima et al. | Effects of blocking individual maturation cleavages in murine leukemia virus gag | |
| CN108588276A (en) | D type influenza virus fluorescence quantification PCR primers pair and kit | |
| Phong et al. | Sequence analysis of Malaysian infectious bursal disease virus isolate and the use of reverse transcriptase nested polymerase chain reaction enzyme-linked immunosorbent assay for the detection of VP2 hypervariable region | |
| CN113234866B (en) | Detection kit for synchronously detecting pathogens of multiple blood circulation systems and detection method thereof | |
| Moret et al. | New commercially available PCR and microplate hybridization assay for detection and differentiation of human polyomaviruses JC and BK in cerebrospinal fluid, serum, and urine samples | |
| Lee et al. | M‐specific reverse transcription loop‐mediated isothermal amplification for detection of pandemic (H1N1) 2009 virus | |
| JP2014513921A (en) | Exogenous internal positive control | |
| CN101886136B (en) | Kit for detecting H1N1 influenza A virus by real-time fluorescence RT-PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080917 Termination date: 20161009 |