CN109971888A - A kind of detection method replicating controllable type influenza virus - Google Patents
A kind of detection method replicating controllable type influenza virus Download PDFInfo
- Publication number
- CN109971888A CN109971888A CN201910290093.9A CN201910290093A CN109971888A CN 109971888 A CN109971888 A CN 109971888A CN 201910290093 A CN201910290093 A CN 201910290093A CN 109971888 A CN109971888 A CN 109971888A
- Authority
- CN
- China
- Prior art keywords
- virus
- gene
- influenza virus
- wsn
- ppoli
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Abstract
The present invention relates to a kind of detection methods for replicating controllable type influenza virus.Virus to be detected is obtained by way of virus rescue, it is introduced in the cell strain of stable integration and expression of influenza virus PA, PB1, PB2 and NP gene and replicates controllable influenza virus rescue system, which includes the plasmid for introducing terminator codon in PA, PB1, PB2 and NP gene respectively.The characteristics of detection method, is to realize virus replication proliferation by Cells for production, then is measured and substituted by qPCR method and obtain virus quantity according to the Ct value curve that wild-type virus measurement obtains.The detection method has stronger specific, preferable repeatability and higher precision.
Description
Technical field
The present invention relates to influenza virus technical fields, and in particular to a kind of detection method for replicating controllable type influenza virus.
Background technique
Influenza (influenza) is respiratory tract and other organs as caused by influenza virus (Influenza virus)
Disease, in healthy children and adult, per that can have different degrees of prevalence in winter in spring or even other seasons every year, usually
A kind of acute, communicable disease.
Influenza virus is the pathogen for leading to influenza, belongs to minus strand single-stranded RNA virus, genome share 8 it is independent
RNA segment (respectively with segment 1-8 name) forms, and nucleic acid total length is about 13.6kb.This 8 segments encode 10 kinds of albumen altogether
Matter, wherein 8 kinds are structural proteins, including PB1, PB2, PA, HA, NA, NP, M1, M2, and NS1, NS2 are non-structural protein.Influenza
Virus is divided into human influenza virus and animal influenza virus, and human influenza virus is divided into first (A), second (B), the third (C) three type.
Virus replication relies primarily on viral ribonucleoprotein (vRNPs).The ribonucleoprotein of influenza A virus is by virus
RNA, RNA polymerase (RdRp) complex and nucleoprotein (NP) composition, are the minimum replicators of virus, virus protein is at this
It could be expressed in structure basis.RdRp in vRNPs structure is made of 3 subunits (PA, PB2, PB1), and PB1 is located at tripolymer
Core, N-terminal and C-terminal pass through non-covalent bond (such as hydrophobic work with the N-terminal of the C-terminal of PA subunit and PB2 subunit respectively
With, hydrogen bond, Van der Waals force etc.) form stable protein complex.
Although all kinds of antiviral drugs can be used in treatment influenza virus, since influenza virus quickly makes a variation, the world is each
There is distributing prevalence and breaking out for influenza on ground every year, and correct inoculation influenza vaccines can effectively reduce flu episode rate.
Currently, influenza vaccines can be divided into according to its type: inactivated virus vaccine, split vaccine and subunit vaccine.Entirely
Viral inactivation vaccine, split vaccine need every year before breaking out season because influenza quickly makes a variation, the poison that may break out to current year
Strain is predicted that Accurate Prediction acquires a certain degree of difficulty, prediction error, will lead to vaccine protective rate sharp fall, even if moreover, quasi-
Really prediction, also because the chicken embryo production technology mainly used at present, the chicken embryo adaptive variation that virus generates, cause vaccine to be protected
It is inefficient；For subunit vaccine, it can be used for the conserved sequence of vaccine due to not being found influenza virus at present, cause
It makes slow progress.
Therefore, there is an urgent need to have more safety and the preferably immunocompetent influenza vaccines of reservation totivirus and its production
The appearance of method.On this basis, it is also desirable to which a kind of detection method specifically for duplication controllable type influenza virus is realized in epidemic disease
The control of influenza virus validity and safety in seedling production and vaccine use process.
Summary of the invention
It is an object of the invention to produce influenza virus by specific mammalian cell, to be used for vaccine preparation, and lead to
Cross detection of the particular detection method realization to the influenza virus.The influenza virus cannot normally feed due to introducing mutation
It is proliferated, can only be proliferated in the host cell for incorporating exogeneous viral protein gene in newborn zooblast.
In order to achieve the above objectives, the present invention is transferred to specific gene into mammalian cell, obtains and stablizes expression accordingly
Influenza virus protein host cell, then transfect the influenza virus after associated gene mutation rescue system, rescue replicated
Controllable new type influenza live virus.For the detection for realizing such special virus, the present invention is directed to the virus using qPCR method
The characteristics of genome, designs corresponding primer, is fast and accurately detected with realizing.
Specifically, the invention provides the following technical scheme:
Firstly, the present invention provides a kind of quantitative detecting method for replicating controllable type influenza virus, by virus liquid to be measured and life
Production is co-cultured with cell, and then extracting total serum IgE and reverse transcription is cDNA, finally according to the wild-type virus qPCR of known copy number
Ct value result draw standard curve, substitute into duplication controllable type influenza virus Ct value, calculate obtain influenza virus copy number it is excellent
Choosing, wild-type virus is the A/WSN/1933 strain of influenza virus H1N1, and detects wild-type virus and duplication controllable type influenza
The qPCR primer of virus is following primer:
Ben3-FP:5 '-CAAATGTCCAAAGAAGTAAATGCTAGA-3 ' (SEQ ID NO:23)
Ben3-RP:5 '-GGCATCCATCAGCAGGAATT-3 ' (SEQ ID NO:24).
In a preferred embodiment, the detection method includes the following steps:
(1) 37 DEG C are based on DMEM+10%FBS culture, 5%CO2 stationary culture 293T cell or Vero cell 24 hours；
(2) virus liquid to be measured is added and in 37 DEG C, 5%CO2 stationary incubation 2 hours；
(3) TRNzol method extracts RNA；
It (4) is cDNA by RNA reverse transcription
(5) the Ct value that sample to be tested is measured by qPCR reaction system, according to the wild-type virus conduct of known copy number
Standard items carry out qPCR and draw standard curve, bring the Ct value of sample to be tested into regression curve and obtain respective copies number；
The Ct value is that the fluorescence signal in each reaction tube reaches recurring number experienced when setting value.
Preferably, step (4) is carried out by following scheme:
(i) reaction system 1 containing random primer and Oligonucleolide primers and RNA to be measured is prepared, and is contained
The reaction system 2 of MgCl2, buffer, dNTP, recombinant RNA enzyme inhibitor and AMV reverse transcriptase；
(ii) reaction system 1 is centrifuged in tube bottom, 70 DEG C of incubation 5min, are immediately placed on ice after the completion on Standard PCR instrument
Upper 3min；
(iii) reaction system 2 is added in reaction system 1,25 DEG C of incubation 5min, 42 DEG C of incubation 50min, 70 DEG C are incubated for
15min, 4 DEG C spare.
Method for detecting virus of the invention is preferably applied to the duplication controllable type stream that ad hoc approach according to the invention obtains
Influenza Virus.Specifically, the virus has a characteristic that by the way that virus rescue system is imported mammalian host cell
Mode obtains, mammalian host cell stable integration influenza virus PA, PB1, PB2 and NP gene, influenza virus rescue
Saltant type PA, PB1, PB2 and NP gene are carried in system, the mutation is prevent influenza virus saves system from natural lactation
Rescue obtains intact virus in zooblast.
Preferably, the influenza virus rescue system includes the recombinant plasmid of encoding mutant type PA, PB1, PB2 and NP gene
And the recombinant plasmid of coding tetra- kinds of genes of HA, NA, M, NS, the mutation is by introducing TAG in four gene orders respectively
Codon is realized.
It is furthermore preferred that the stable integration is saved to PA, PB1, PB2 and NP gene of host cell and influenza virus
Rescue the A/WSN/1933 strain that encoding viral gene HA, NA, M, NS in system are all from influenza virus H1N1.
It is especially preferred, the nucleotide sequence of PA, PB1, PB2 and NP gene of the stable integration to host cell
Respectively as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4.
Highly preferred, the influenza virus rescue system includes following eight plasmids: pPolI-WSN-PB, pPolI-
WSN-PB1,pPolI-WSN-PA,pPolI-WSN-NP,pPolI-WSN-HA；pPolI-WSN-NA；pPolI-WSN-M；
PPolI-WSN-NS, wherein contained PA gene is that there are R52 codons for TAG, PB1 gene there are R266 codon mutation
Sport TAG), PB2 gene be TAG and NP gene there are K33 codon mutation there are D101 codon mutation be TAG.
Relational language is further expalined below.
Virus rescue
Virus rescue or the infective molecule cloning of virus belong to reverse genetics manipulation technology, that is, pass through manual operation base
Cause transfects cell with the appropriate form of viral nucleic acid under certain condition, generates the virion of infectious.The present invention is optional
8 plasmid Rescue Systems using foundation such as Hoffmann, the system completely based on plasmid is not its advantage is that need to assist
Virus avoids a large amount of screening operation.8 pUC pUCs are realized based on the plasmid of minimum number using identical carrier
Intracellular viral RNA and albumen synthesis, and then it is packaged into virus.
In the present invention, virus rescue obtains virion and can carry out as follows:
(1) the simple substance grain or multi plasmid system of building coding PA, PB1, PB2 and NP gene；
(2) the simple substance grain of step (1) or multi plasmid system are imported into mammalian cell, screens and stablizes four kinds of genes of expression
Host cell, it is preferable that imported by electrotransformation；
(3) recombinant plasmid comprising saltant type PA, PB1, PB2 and NP gene and coding HA, NA, M, NS tetra- are constructed respectively
The recombinant plasmid of kind gene forms influenza virus and saves system, and the mutation is by introducing TAG in four gene orders respectively
Codon is realized；
(4) by the host cell of the virus rescue system cotransfection steps for importing (2) of step (3) building；
(5) incubation step (4) obtains cell simultaneously harvests the particle of influenza virus.
Preferably, the nucleotide sequence of PA, PB1, PB2 and NP gene described in step (1) respectively as SEQ ID NO:1,
Shown in SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4.
Preferably, the influenza virus rescue system includes following eight plasmids: pPolI-M-PB2, pPolI-M-PB1,
pPolI-M-PA,pPolI-M-NP,pPolI-WSN-HA；pPolI-WSN-NA；pPolI-WSN-M；PPolI-WSN-NS,
In, it there are R52 codon mutation is TAG, PB2 base that contained PA gene, which is TAG, PB1 gene there are R266 codon mutation,
It there are D101 codon mutation is TAG because being TAG and NP gene there are K33 codon mutation.
Strains of influenza viruses
In the present invention, the genetic fragment being related to derives from influenza A or Type B influenza virus, is preferably derived from A type
H1N1 (such as A/WSN/1933, A/PR/8), H3N2 (such as A/Aichi/2/68) strain.
As a preferred embodiment, the present invention uses the strains of influenza viruses of the A/WSN/1933 from H1N1
Clone Origin as all genetic fragments.
Many organisms show preference to the use of specific codon, therefore can just give biology based on codon optimization
Optimal gene expression adjusts gene in body.Present invention discover that there are different hosts cells for the gene order of coding virus protein
Between codon preference, and the Preference directly affects expressing quantity, and determines the efficiency of virus rescue.
In a preferred embodiment, inventor is obtained by repetition test has higher exogenous protein expression amount, and virus rescue is imitated
The higher optimization codon of rate, be based on codon optimization result: the PA gene order is as shown in SEQ ID NO:1；The PB1
Gene order is as shown in SEQ ID NO:2；The PB2 gene order is as shown in SEQ ID NO:3；The NP gene order is such as
Shown in SEQ ID NO:4.
SEQ ID NO:1 is as follows:
atggaggacttcgtgaggcagtgcttcaaccccatgatcgtggagctggccgagaaggccatgaagga
gtacggcgaggacctgaagatcgagaccaacaagttcgccgccatctgcacacacctggaggtgtgcttcatgtac
tctgacttccacttcatcgacgagcagggcgagtccatcgtggtggagctgggggaccccaacgctctgctgaagc
accggttcgagatcatcgagggacgggacaggaccatcgcctggacagtgatcaacagcatctgcaacaccacagg
ggccgagaagcccaagttcctgcccgacctgtacgactacaagaagaacaggttcatcgagatcggcgtgaccagg
agagaggtgcacatctactacctggagaaggccaacaagatcaagtccgagaagacccacatccacatcttcagct
tcacaggggaggagatggccaccaaggccgactacacactggacgaggagagcagggcccggatcaagaccaggct
gttcacaatcagacaggagatggcctccaggggcctgtgggactccttccggcagagcgagaggggagaggagaca
atcgaggagagattcgagatcaccggcacaatgagaaagctggccgaccagtccctgccacccaacttcagctctc
tggagaagttcagagcctacgtggacgggttcgagcccaacggctacatcgaggggaagctgagccagatgtctaa
ggaggtgaacgccagaatcgagcccttcctgaagagcacccccaggcccctgagactgccagacggaccaccatgc
tcccagcggagcaagttcctgctgatggacgccctgaagctgtccatcgaggaccccagccacgagggagagggca
tccccctgtacgacgccatcaagtgcatgagaacattcttcggctggaaggagcccaacgtggtgaagccccacga
gaaggggatcaaccccaactacctgctgagctggaagcaggtgctggccgagctgcaggacatcgagaacgaggag
aagatcccccggaccaagaacatgaagaagacatctcagctgaagtgggctctgggagagaacatggctccagaga
aggtggacttcgacgactgcaaggacgtgggggacctgaagcagtacgacagcgacgagcccgagctgaggtctct
ggcctcctggattcagaacgagttcaacaaggcctgcgagctgaccgactccagctggatcgagctggacgagatc
ggagaggacgctgctcccatcgagcacatcgccagcatgcggaggaactacttcaccgccgaggtgtctcactgca
gggccacagagtacatcatgaagggcgtgtacatcaacacagccctgctgaacgcctcctgcgctgctatggacga
cttccagctgatccccatgatcagcaagtgcagaaccaaggaggggagacggaagacaaacctgtacggcttcatc
atcaagggcaggagccacctgcggaacgacaccgacgtggtgaacttcgtgtctatggagttctccctgacagacc
cccggctggagccacacaagtgggagaagtactgcgtgctggaggtcggcgacatgctgctgaggtctgccatcgg
gcacgtgtcccggcccatgttcctgtacgtgaggaccaacggcacaagcaagatcaagatgaagtgggggatggag
atgaggagatgcctgctgcagagcctgcagcagatcgagtctatgatcgaggccgagtcttccgtgaaggagaagg
acatgaccaaggagttcttcgagaacaagtccgagacatggccagtgggagagagcccaaagggagtggaggaggg
ctctatcgggaaggtgtgccggaccctgctggccaagagcgtgttcaactctctgtacgcctccccacagctggag
ggcttcagcgccgagtctaggaagctgctgctgatcgtgcaggccctgagagacaacctggagccagggaccttcg
acctgggagggctgtacgaggccatcgaggagtgcctgatcaacgacccctgggtgctgctgaacgccagctggtt
caactctttcctgacacacgccctgagatga
SEQ ID NO:2 is as follows:
atggacgtgaaccccacactgctgttcctgaaggtgcccgcccagaacgccatctccaccacattccc
ctacaccggcgaccccccatacagccacggaaccgggacaggctacaccatggacacagtgaacaggacacaccag
tactctgagagagggcggtggaccacaaacaccgagacaggagctccacagctgaaccccatcgacggaccactgc
cagaggacaacgagccatccggatacgctcagaccgactgcgtgctggaggccatggccttcctggaggagagcca
ccccgggatcttcgagacctcttgcctggagacaatggaggtggtgcagcagacccgggtggacaagctgacacag
ggcaggcagacctacgactggacactgaacagaaaccagccagctgctaccgccctggccaacacaatcgaggtgt
tcagatccaacggactgaccgctaacgagagcggccggctgatcgacttcctgaaggacgtgatggagtctatgaa
caaggaggagatggagatcaccacacacttccagagaaagaggagagtgcgggacaacatgacaaagaagatggtg
acccagagaacaatcggcaagagaaagcagcggctgaacaagaggagctacctgatcagagccctgaccctgaaca
ccatgacaaaggacgctgagagagggaagctgaagagaagggccatcgccaccccagggatgcagatcaggggctt
cgtgtacttcgtggagacactggccaggagcatctgcgagaagctggagcagtccggactgccagtgggagggaac
gagaagaaggccaagctggccaacgtggtgcggaagatgatgaccaactctcaggacacagagatcagcttcacca
tcacaggggacaacacaaagtggaacgagaaccagaaccccaggatgttcctggccatgatcacctacatcacacg
gaaccagcccgagtggttcaggaacgtgctgtccatcgcccccatcatgttcagcaacaagatggccagactgggg
aagggctacatgttcgagtctaagtccatgaagatcagaacccagatcccagctgagatgctggccagcatcgacc
tgaagtacttcaacgactctaccagaaagaagatcgagaagatcagaccactgctgatcgacggaacagccagcct
gtctcccgggatgatgatgggcatgttcaacatgctgagcaccgtgctgggggtgtctatcctgaacctgggccag
aagaggcacacaaagaccacatactggtgggacggcctgcagagctctgacgacttcgccctgatcgtgaacgctc
caaaccacgagggcatccaggctggcgtgaacaggttctacagaacatgcaagctgctggggatcaacatgagcaa
gaagaagagctacatcaaccggaccggcacattcgagttcacctctttcttctaccgatacgggttcgtggccaac
ttctccatggagctgccctctttcggggtgtccggcatcaacgagagcgccgacatgtctatcggcgtgaccgtga
tcaagaacaacatgatcaacaacgacctgggaccagctacagctcagatggccctgcagctgttcatcaaggacta
caggtacacctaccggtgccacaggggcgacacccagatccagacaagacggagcttcgagatcaagaagctgtgg
gagcagacccactctaaggctggactgctggtgtccgacggaggacccaacctgtacaacatcaggaacctgcaca
tccccgaggtgtgcctgaagtgggagctgatggacgaggactaccagggcagactgtgcaaccccctgaacccctt
cgtgaaccacaaggacatcgagtccgtgaacaacgccgtgatcatgccagctcacggaccagctaagaacatggag
tacgacgccgtggccaccacacacagctggattcccaagaggaacagatccatcctgaacaccagccagaggggca
tcctggaggacgagcagatgtaccagaagtgctgcaacctgttcgagaagttcttcccctccagctcttacaggag
acccgtgggcatctccagcatggtggaggctatggtgagccgggccaggatcgacgccaggatcgacttcgagtct
gggagaatcaagaaggaggagttcaccgagatcatgaaaatctgcagcacaatcgaggagctgcggaggcagaagt
ga
SEQ ID NO:3 is as follows:
atggagaggatcaaggagctgagaaacctgatgtctcagtcccggacaagggagatcctgaccaagac
cacagtggaccacatggccatcatcaagaagtacaccagcggcaggcaggagaagaaccccgccctgagaatgaag
tggatgatggccatgaagtaccccatcacagccgacaagcggatcaccgagatgatccccgagaggaatgagcagg
gccagaccctgtggagcaagatgaacgacgccggcagcgacagagtgatggtgagccccctggccgtgacatggtg
gaacagaaacggccccgtgacatctaccgtgcactaccccaaaatctacaagacatacttcgagaaggtggagaga
ctgaagcacggcaccttcgggccagtgcacttccggaaccaggtgaagatcaggagacgggtggacatcaacccag
gacacgccgacctgtctgccaaggaggcccaggacgtgatcatggaggtggtgttccccaacgaagtgggcgccag
aatcctgaccagcgagtctcagctgaccacaaccaaggagaagaaggaggagctgcaggggtgcaagatcagcccc
ctgatggtggcctacatgctggagcgggagctggtgagaaagacccggttcctgccagtggctggaggcaccagca
gcgtgtacatcgaggtgctgcacctgacacagggcacctgctgggagcagatgtacacaccaggaggagaggctag
aaacgacgacgtggaccagtccctgatcatcgccgccaggaacatcgtgaggagagctacagtgtctgccgacccc
ctggcctccctgctggagatgtgccacagcacccagatcggcggcatcaggatggtgaacatcctgaggcagaacc
ccacagaggagcaggccgtggacatctgcaaggccgccatgggcctgaggatctccagctctttctccttcggcgg
gttcacattcaagagaaccagcggctccagcgtgaagagagaggaggaggtgctgacagggaacctgcagaccctg
aagatcagggtgcacgagggctacgaggagttcacaatggtggggcggagggctaccgctatcctgagaaaggcca
caagacggctgatccagctgatcgtgagcggccgggacgagcagtctatcgccgaggccatcatcgtggccatggt
gttcagccaggaggactgcatgatcaaggccgtgaggggggacctgaacttcgtgaaccgggccaaccagaggctg
aaccccatgcaccagctgctgagacacttccagaaggacgccaaggtgctgttccagaactggggcatcgagtcta
tcgacaacgtgatgggcatgatcggcatcctgcccgacatgacaccctccaccgagatgagcatgaggggcgtgag
aatctccaagatgggggtggacgagtactcttccgccgagaagatcgtggtgagcatcgacaggttcctgagagtg
cgggaccagagaggcaacgtgctgctgtctcccgaggagatcagcgagacacaggggaccgagaagctgacaatca
cctacagctcttccatgatgtgggagatcaacggccccgagtctgtgctggtgaacacctaccagtggatcatcag
aaactgggagacagtgaagatccagtggtcccagaaccccaccatgctgtacaacaagatggagttcgagcccttc
cagagcctggtgccaaaggccgtgaggggccagtactctgggttcgtgagaaccctgttccagcagatgcgggacg
tgctgggcacattcgacaccgcccagatcatcaagctgctgcccttcgccgccgccccaccaaagcagagccggac
acagttcagctctctgaccatcaacgtgaggggctctgggatgagaatcctggtgcgggggaactcccccgtgttc
aactacaacaagacaaccaagcggctgaccgtgctgggcaaggacgctggaccactgaccgaggaccccgacgagg
gcacagccggggtggagagcgccgtgctgaggggcttcctgatcctggggaaggaggacaggagatacggccccgc
cctgagcatcaacgagctgtctaacctggccaagggggagaaggccaacgtgctgatcggccagggcgacgtggtg
ctcgtgatgaagaggaagagaaactccagcatcctgaccgacagccagacagccaccaagcggatcaggatggcca
tcaactga
SEQ ID NO:4 is as follows:
atggccaccaagggcacaaagaggagctacgagcagatggagaccgacggggagaggcagaacgccac
agagatcagagcctctgtgggcaagatgatcgacggcatcgggagattctacatccagatgtgcaccgagctgaag
ctgtccgactacgaggggagactgatccagaactctctgacaatcgagcggatggtgctgtccgccttcgacgaga
ggagaaacaagtacctggaggagcacccaagcgccggcaaggaccccaagaagaccggaggaccaatctacagaag
ggtggacgggaagtggagacgggagctgatcctgtacgacaaggaggagatcaggagaatctggaggcaggctaac
aacggcgacgacgctaccgctgggctgacacacatgatgatctggcactctaacctgaacgacgccacctaccaga
ggacaagagccctggtgcggaccggaatggaccccaggatgtgctctctgatgcaggggtccacactgccacggag
gagcggagctgctggagctgccgtgaagggcgtggggaccatggtcatggagctgatccggatgatcaagaggggc
atcaacgacagaaacttctggcggggcgagaacgggagacggacaaggatcgcctacgagagaatgtgcaacatcc
tgaagggcaagttccagaccgccgcccagaggacaatggtggaccaggtgagggagagcaggaaccccggcaacgc
cgagttcgaggacctgatcttcctggctagatccgccctgatcctgagagggagcgtggctcacaagtcttgcctg
ccagcttgcgtgtacggcagcgccgtggcctctgggtacgacttcgagagggagggctacagcctggtggggatcg
accccttcagactgctgcagaactcccaggtgtacagcctgatcagaccaaacgagaacccagctcacaagagcca
gctggtgtggatggcctgccactctgccgccttcgaggacctgagggtgagctctttcatcagaggaaccaaggtg
gtgccccggggcaagctgtccacaaggggggtgcagatcgccagcaacgagaacatggagaccatggagtccagca
cactggagctgcggtccaggtactgggccatcagaacccggagcggcgggaacacaaaccagcagagggcctcttc
cggccagatcagcatccagcccaccttcagcgtgcagagaaacctgcccttcgaccggcccacaatcatggctgcc
ttcaccggaaacacagagggacggaccagcgacatgaggacagagatcatcagactgatggagagcgccagaccag
aggacgtgtctttccagggcaggggggtgttcgagctgtctgacgagaaggccacctcccccatcgtgccctcttt
cgacatgtccaacgagggcagctacttcttcggggacaacgccgaggagtacgacaactga
It is emphasized that the present invention is such as not particularly limited when mentioning PA, PB1, PB2 and NP gene, referring to can be with
Any nucleotide sequence for encoding PA, PB1, PB2 and NP albumen, including having carried out the artificial reconstructed nucleotides sequence of codon preference
Column.Q_PA, Q_PB1, Q_PB2, Q_NP gene refer in particular to the nucleotide sequence after being transformed according to Vero cell preference.Saltant type
PA, PB1, PB2 and NP gene refer to that the fixed point for introduce terminator codon to four genes in virus rescue system is prominent
Become nucleotide sequence obtained.
Host cell
The original host cell that the present invention is used to express virus protein can be thin selected from Vero cell, mdck cell, 293
Born of the same parents, the cells such as MRC5.Different hosts cell in terms of the effect of rescue influenza virus there are difference, preferably Vero cell,
Mdck cell, because being higher than remaining cell 2 times or more (in terms of the virus titer after saving using the rescue efficiency of both cells
It calculates).
Carrier
The carrier that the present invention is used to import PA, PB1, PB2 and NP gene to mammalian cell can be selected from various routines
Protein expressing plasmid, preferably pBudCE4.1.To express said gene, the present invention constructs while expressing aforementioned four gene
A recombinant plasmid.Technical solution alternately, the present invention construct the double-mass model system for expressing aforementioned four gene, three
PUC pUC and four pUC pUCs, wherein each plasmid can express one or more of aforementioned four gene.According to experiment
Verifying, above-mentioned four kinds of systems are able to achieve stablizing for target protein and express.As a preferred option, the present invention uses
PBudCE4.1 is imitated because four kinds of foreign genes are realized while expressed on the plasmid with relatively high transfection
Rate, and obtain the opposite higher stable integration efficiency of other carriers.Higher transfection and integration efficiency are realized as another
Optional scheme, the present invention also use double-mass model system.So-called double-mass model system is preferably with pcDNA3.1/Hygro (+) for bone
Frame, building while the pcDNA3.1_PA_PB1 carrier for expressing PA and PB1 albumen；Using pBudCE4.1 as skeleton, building while table
Up to the pBudCE4.1_Puro_NP_PB2 carrier of NP and PB2 albumen.Turn when constructing stable cell line, while by the double-mass model
Enter in host cell.
The nucleotide sequence (SEQ ID NO:5) of pBudCE4.1 is as follows:
gcgcgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagc
ccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccat
tgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactattt
acggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggt
aaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattag
tcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatt
tccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgt
aacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggc
taactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagcttgcattcc
tgcaggtcgacatcgatcttaagcagtacttctagaggatccgaacaaaaactcatctcagaagaggatctgaata
tgcataccggtcatcatcaccatcaccattgagtttgatccccgggaattcagacatgataagatacattgatgag
tttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttg
taaccattataagctgcaataaacaagttggggtgggcgaagaactccagcatgagatccccgcgctggaggatca
tccagccggcgtcccggaaaacgattccgaagcccaacctttcatagaaggcggcggtggaatcgaaatctcgtag
cacgtgtcagtcctgctcctcggccacgaagtgcacgcagttgccggccgggtcgcgcagggcgaactcccgcccc
cacggctgctcgccgatctcggtcatggccggcccggaggcgtcccggaagttcgtggacacgacctccgaccact
cggcgtacagctcgtccaggccgcgcacccacacccaggccagggtgttgtccggcaccacctggtcctggaccgc
gctgatgaacagggtcacgtcgtcccggaccacaccggcgaagtcgtcctccacgaagtcccgggagaacccgagc
cggtcggtccagaactcgaccgctccggcgacgtcgcgcgcggtgagcaccggaacggcactggtcaacttggcca
tggtttagttcctcaccttgtcgtattatactatgccgatatactatgccgatgattaattgtcaacacgtgctga
tcagatccgaaaatggatatacaagctcccgggagctttttgcaaaagcctaggcctccaaaaaagcctcctcact
acttctggaatagctcagaggcagaggcggcctcggcctctgcataaataaaaaaaattagtcagccatggggcgg
agaatgggcggaactgggcggagttaggggcgggatgggcggagttaggggcgggactatggttgctgactaattg
agatgcatgctttgcatacttctgcctgctggggagcctggggactttccacacctggttgctgactaattgagat
gcatgctttgcatacttctgcctgctggggagcctggggactttccacaccctcgtcgagctagcttcgtgaggct
ccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaac
cggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggt
gggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagg
taagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccac
ctggctccagtacgtgattcttgatcccgagctggagccaggggcgggccttgcgctttaggagccccttcgcctc
gtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgc
tgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtctt
gtaaatgcgggccaggatctgcacactggtatttcggtttttgggcccgcggccggcgacggggcccgtgcgtccc
agcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccg
gcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcacca
gttgcgtgagcggaaagatggccgcttcccggccctgctccagggggctcaaaatggaggacgcggcgctcgggag
agcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacgga
gtaccgggcgccgtccaggcacctcgattagttctggagcttttggagtacgtcgtctttaggttggggggagggg
ttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattct
cgttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttct
tccatttcaggtgtcgtgaacacgtggtcgcggccgcttcgaaggtaccagcacagtggactcgagagatctggcc
ggctgggcccgtttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatc
accatcaccattgagtttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgccc
ctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcg
cattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagaca
atagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagtggcggtaatacggttat
ccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggc
cgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtgg
cgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccc
tgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggta
tctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgcc
ttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaaca
ggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaag
gacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaa
caaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaag
atcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgacatt
aacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacac
atgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcag
cgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatatg
cggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaact
gttgggaagggcgatcggtgcgggcctcttcgctattacgcca
Rite-directed mutagenesis
The present invention has carried out introducing terminator codon to four genes (PA, PB1, PB2 and NP) in virus rescue system
Rite-directed mutagenesis, the purpose is to make rescue system in the host cell of above-mentioned building, can be realized virus rescue and infection increase
Grow, and in normal zooblast, because the introducing of terminator codon cause PA, PB1, PB2 and NP can not normal expression, thus
It can not virus rescue and can not infection development.In four genes, PA, PB1, PB2 are separately encoded RNA polymerase complex
3 subunits, NP encoding nuclear proteins, four genes inactivate jointly ensures that virus cannot carry out duplication proliferation in normal cell,
Generate duplication controllable type character.The mode of rite-directed mutagenesis includes but is not limited to that introducing TAG is close in four gene orders respectively
Numeral terminates so as to cause expression.The mutated site can pass through the amino acid sequence and crystal structure to the albumen
It is analyzed, screens a series of most effective mutational sites.Effective mutation can be, such as: PA (R266 sports TAG),
PB1 (R52 sports TAG), PB2 (K33 sports TAG) and NP (D101 sports TAG), in addition it is also possible to additionally include HA,
Mutation on NA, M, NS gene.
Electrotransformation cell
PA, PB1, PB2 and NP gene are transfected Vero, MDCK or other cells, experiment using the method that electricity turns by the present invention
Show that the method that electricity turns is substantially better than other methods, and Vero cell, mdck cell are most suitable for.
Safety and efficacy
Identify that safety-replication defective method is cytopathy test experience.Through inside and outside it is demonstrated experimentally that duplication can
Control type influenza virus not can be carried out duplication in wild-type animal cell, but can express PA, PB1, PB2 and NP albumen
Host cell in rescue form complete live virus, cause cytopathy, cracking.By cytopathy, influenza disease can be known
Whether poison has replication capacity in different cells.Virus immunity validity can be tested by conventional animal immune and be carried out
Evaluation.Experiment shows that live virus of the invention has very high safety and genetic stability, has compared with inactivation of viruses
Better immune effect.
Innovation of the invention is: detection method of the invention especially suitable for specific saltant type influenza virus,
The virus can only save in specific cell line and infection development, but will not answer in normal animal and human body cell
System proliferation.The present invention provides particular for viral design qPCR primer same as wild-type virus, and with wild
Data source of the qPCR measurement result of type virus as standard curve returns the qPCR measurement result of mutant virus to be measured
It is calculated in curve and obtains virion number, to realize the indirect quantification detection of virus.Experimental verification shows described draw
The building of object, host cell condition of culture and qPCR reaction system is so that the detection of wild type and mutant virus has relatively by force
Specific, preferable repeatability and higher precision, ensure that the accuracy of mutant virus quantitative detection, for viral epidemic disease
Seedling preparation provides reliable quality control standard.
Detailed description of the invention
Fig. 1 is that plasmid pBudCE4.1_NP_IRES_PA_PB2_IRES_PB1 constructs map；
Fig. 2 is the electromicroscopic photograph for the virus that rescue is formed, transmission electron microscope (Spirit 120KV), 100kv, amplification 150,000
Times；
Fig. 3 be rescue generate virus catastrophe point verifying sequencing result, wherein gene loci 1-4 correspond respectively to NP,
The corresponding site of PA, PB1 and PB2, wherein sequence above is the sequence of measurement in the comparison diagram in same gene site, under
The sequence in face is reference sequences.
Fig. 4 Revive virus transfects the experiment of cell safety control, and after wherein A1 is transfection of normal cells plate overnight, A2 is
Electron microscope after transfection of normal cells culture 3 days；B1 is cell and plate overnight of the transfection according to the single plasmid construction of embodiment 1
Afterwards, B2 is its cell electron microscope after cultivating 3 days.Virus liquid used participates in rescue using the cell of embodiment 3-1 and obtains.
Fig. 5: Ct value standard curve is formed according to the Ct value measurement of eight standard items.
Fig. 6: the qPCR reaction result of different genes group DNA, wherein A curve represents duplication controllable type influenza virus cDNA；B
Curve represents Escherichia coli BL genomic DNA；C curve represents bacillus coli DH 5 alpha genomic DNA；D curve represents carrier
PBudCE4.1 genomic DNA.
Specific embodiment
The technical scheme in the embodiments of the invention will be clearly and completely described below, it is clear that described implementation
Example is only a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, the common skill in this field
Art personnel every other embodiment obtained without making creative work belongs to the model that the present invention protects
It encloses.
It should be noted that the term " includes " of the embodiment of the present invention and " having " and their any deformation, it is intended that
Be to cover it is non-exclusive include, for example, containing the process, method, system, product or equipment of a series of steps or units not
Those of be necessarily limited to be clearly listed step or unit, but may include be not clearly listed or for these processes, side
The intrinsic other step or units of method, product or equipment.
Experimental material
The present invention NP through codon optimization, PA, PB1, PB2 gene order are all from artificial synthesized, all sequences clone
Primer, selection markers are also according to sequence disclosed in this invention by artificial synthesized.Carrier pBudCE4.1 (SEQ ID NO:5) by
It is artificial synthesized.
The host cell of the present embodiment part uses Vero cell, comes fromCCL-81TM, belong to commercially available
Vero cell line.
The building of 1 plasmid pBudCE4.1_NP_IRES_PA_PB2_IRES_PB1 of embodiment
According to the gene order of the Pubmed influenza virus A/WSN/1933 (Taxonomy ID:382835) announced, pass through
Codon optimization obtains PA, PB1, PB2 and NP the expressing gene sequence for having Preference to Vero cell, through full genome respectively
Synthesis, is respectively designated as Q_PA (SEQ ID NO:1), Q_PB1 (SEQ ID NO:2), Q_PB2 (SEQ for the genetic fragment of acquisition
ID NO:3), Q_NP (SEQ ID NO:4) gene.
To pBudCE4.1 and Q PURO (puromycin resistance gene, SEQ ID NO:6) carry out double digestion (EcoRI,
AvrII), T4DNA ligase connects, and heat shock method is converted into bacillus coli DH 5 alpha, screens, and culture amplification, purifying obtains
pBudCE4.1+puro。
Double digestion (HindIII, SalI) is carried out to pBudCE4.1+puro and Q_NP, the connection of T4DNA ligase, heat shock method
Conversion is into bacillus coli DH 5 alpha, screening, and culture amplification, purifying obtains pBudCE4.1+puro_NP.
PBudCE4.1+puro_NP and Q_PA carries out double digestion (SalI, BamHI), the connection of T4DNA ligase, building
PBudCE4.1+puro_NP, heat shock method are converted into bacillus coli DH 5 alpha, screening, and culture amplification, purifying obtains pBudCE4.1+
puro_NP_PA。
PBudCE4.1+puro_NP_PA and Q_PB2 carries out double digestion (NotI, XhoI), the connection of T4DNA ligase, heat shock
Method is converted into bacillus coli DH 5 alpha, screening, and culture amplification, purifying obtains pBudCE4.1+puro_NP_PA_PB2.
PBudCE4.1+puro_NP_PA_PB2 and Q_PB1 carries out double digestion (XhoI, BglII), and T4DNA ligase connects
It connects, heat shock method is converted into bacillus coli DH 5 alpha, screening, and culture amplification, purifying obtains pBudCE4.1+puro_NP_PA_PB2_
PB1。
In above-mentioned building process, solid medium that screening step uses are as follows: low sodium LB solid medium (1% peptone,
0.5% sodium chloride, 0.5% yeast extract, 1.8% agarose), the bleomycin of 25 μ g/ml；The liquid that amplification step uses
Culture medium are as follows: low sodium LB liquid medium (1% peptone, 0.5% sodium chloride, 0.5% yeast extract), 25 μ g/ml's is rich
Lay mycin.
The building map of the plasmid is as shown in Figure 1.The nucleotide sequence of Q PURO gene is following (SEQ ID NO:6):
atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtcccccgggccgtacgcaccct
cgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgacccggaccgccacatcgagcgggtcaccgag
ctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtgg
cggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgag
cggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttc
ctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggagg
cggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcgg
cttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctag
Embodiment 2Vero cell culture and electrotransformation
Embodiment 2-1 simple substance grain Vero cell electrotransformation:
Vero cell after recovery, goes to T25 Tissue Culture Flask, and cell concentration is 9 × 106A/bottle, cell training used
Support base be containing L-Glutamine, nonessential amino acid, 10%FBS MEM.Second day of culture after pancreatin digestion, is collected thin
Born of the same parents are resuspended in 50ml PBS, and supernatant is removed in 4000rpm, 10min centrifugation, then are resuspended in 0.5mLoptiMEM and (are purchased from U.S. Sigma public affairs
Department).The counting cell of FCM 1: 40, every 5 × 1060.4cm electroporation cup is added in a cell
(electroporationcuvette) and 400 μ L optiMEMI (being purchased from Sigma Co., USA).
1 μ g plasmid pBudCE4.1+puro_NP_PA_PB2_PB1 is transferred to Vero cell by way of electrotransformation
In (1.67E+04 cell/μ g plasmid), electricity turns condition are as follows: voltage 120V, pulse 500 μ s, number of shocks 6 times, and time interval
100ms。
Culture after embodiment 2-2 conversion
Cell after electricity turn takes the preferable cell pool of 3-5 growing state, expands culture.
Vero cell culture condition: 250 μ g/ml hygromycin, 2 μ g/ml puromycins, cell culture medium are to contain 4mmol/
L L-Glutamine, nonessential amino acid, 20%FBS DMEM in.37 DEG C, 5% carbon dioxide constant temperature stationary culture；Every 2 days
It carries out changing liquid.
Embodiment 2-3RT-PCR
TRIzol extracts the total serum IgE in above-mentioned culture cell, is by M-MLV reverse transcriptase reverse transcription using random primer
CDNA detects the expression of target gene using the cDNA of reverse transcription as template PCR amplifications.RT-PCR result is demonstrated in simple substance
In the Vero cell of grain conversion, have PA, PB2, PB1 and NP gene mRNA levels stablizes expression.
The building of 3 mutated viruses RNA of embodiment rescue system
According to the gene order of the Pubmed influenza virus A/WSN/1933 (Taxonomy ID:382835) announced, through complete
Gene chemical synthesis obtains the gene of eight genetic fragments of influenza virus.The GeneBank accession number of each gene order of influenza virus
Respectively, PB2:LC333182.1, PB1:LC333183.1, PA:LC333184.1, NP:LC333186.1, HA:
LC333185.1, NA:LC333187.1, M:LC333188.1, NS:LC333189.1.Then it is connected to PHH21
On (purchased from Chinese plasmid vector bacterium cell gene collection) carrier, the plasmid of rescue wild type influenza virus WSN is obtained.
The name of the plasmid of acquisition be respectively as follows: pPolI-WSN-PB2, pPolI-WSN-PB1, pPolI-WSN-PA, pPolI-WSN-NP,
pPolI-WSN-HA；pPolI-WSN-NA；pPolI-WSN-M；pPolI-WSN-NS.The method for constructing 8 pUC pUCs is existing
Technology is constructed and is used see also Patents documents, such as can join the structure in Chinese patent application 201511029463.1
Construction method.
By the conservative of the amino acid of each albumen of bioinformatics tools Consurf infected by influenza A/WSN/1933 into
Row analysis, and according to the crystal structure for the influenza virus protein being resolved, selection is conservative, guards relatively, is relatively not conservative, no
Conservative amino acid sites are mutated, and are finally screened and are obtained the optional mutation for being directed to PA, PB1, PB2, NP respectively, PA
(R266 codon mutation is TAG), PB1 (R52 codon mutation is TAG), PB2 (K33 codon mutation is TAG) and NP
(D101 codon mutation is TAG) mutation.
For above-mentioned selected mutational site, the codon mutation TAG that can make to encode the amino acid is separately designed
Primer, specific primer is as follows:
By the point mutation primer in selection site on 1 four kinds of albumen of table
Using pPolI-WSN-PB2, pPolI-WSN-PB1, pPolI-WSN-PA, pPolI-WSN-NP as template plasmid,
Using site-directed mutagenesis kit (Lightning Site-DirectedMutagenesis Kits, Catalog#210518), press
The amino acid codes in the site selected on each albumen are sported amber end by above-mentioned primer sites by specification operation
Only codon TAG is mutated successfully through sequence verification.Gained include mutated genes carrier be respectively designated as pPolI-M-PB,
pPolI-M-PB1、pPolI-M-PA、pPolI-M-NP。
The rescue of the duplication controllable type virus of embodiment 4
Stabilization expression cell bed board prepared by embodiment 2-1: by taking 10cm ware as an example, by stability series according to every ware 1 × 106
A/ml is plated in 10cm ware plate, after mixing, is placed in 37 DEG C, 5%CO2, culture 20-24hrs to cell confluency degree
20%-40%.
Transfection and the virus rescue for conventionally carrying out virus particle, by 8 matter used in rescue influenza virus
The Vero stable cell lines for the conversion simple substance grain that grain cotransfection embodiment 2 obtains.Wherein: carrying NP, PA, PB2, PB1 gene
Four rite-directed mutagenesis plasmids that plasmid uses embodiment 4 to obtain, carry HA, NA, M, and the plasmid of NS gene uses pPolI-WSN-
HA；pPolI-WSN-NA；pPolI-WSN-M；Tetra- plasmids of pPolI-WSN-NS.
1ml Opti-MEM is added 8 kinds of plasmids (every kind of 1 μ g of plasmid) in EP pipe, and transfection reagent is added, and mixes, 37 DEG C,
5%CO2Lower incubation changes liquid in 5.5 hours, carries out half amount within the 4th day after transfection and changes liquid, after transfection from the 6th day, every fluid infusion in two days is initial
The 10% of volume, the case where observing and recording the growing state and cytopathy of cell daily, convert in simple substance grain and generate stabilization
In the virus rescue that cell line participates in, there is 70% or more lesion, harvests virus liquid.
Using phosphotungstic acid negative staining, 5min, transmission electron microscope (Spirit 120KV), 100kv, 150,000 times of amplification, observation, bat
It obtains simple substance grain conversion Vero cell and participates in the complete virus image that rescue obtains, as shown in Figure 2.
Embodiment 5 replicates the catastrophe point confirmation of controllable type virus
Extracting the virus obtained of embodiment 4 using RNAiso plus (TaKaRa Code No.:9108), (simple substance grain is whole
The Vero cell line of conjunction participates in rescue) whole RNA, 13 μ l are dissolved in after extraction without RNA enzyme dH2In O, warp
TaKaRaPrimeScript One Step RT-PCR Kit Ver.2 (Code No.:RR055A) carries out RT-PCR,
The above-mentioned PCR product of TSINGKE DNA gel QIAquick Gel Extraction Kit (Code No.:GE0101-200) gel extraction, is dissolved in 25 μ l
Eluent Buffer,Terminator v3.1 sequencing reaction and purifying, 3730 sequencers, 3730xl logarithm
It is analyzed according to being collected.As a result referring to Fig. 3.Four catastrophe point primers are as follows:
Table 2
Experimental result: as shown in figure 3, four catastrophe point sequencing results and reference sequences are completely the same, there is no replying
Mutation.For the virus rescue that the host cell of double-mass model system building is participated in, the abrupt climatic change is equally carried out, as a result phase
Together.
6 viral cytopathic of embodiment, which is tested, determines safety
The cell for taking normal Vero cell and embodiment 2-1 to construct, according to 4*105Every hole spreads 6 orifice plates, every hole 2mL culture
Base is separately added into different holes, and 37 DEG C, 5%CO2It is incubated overnight, adds 0.5mL virus liquid (preparation of embodiment 5), mix, 37
DEG C, 5%CO2, cultivate 3 days, microscopically observation, the cell of building is because of virus replication cracking, and normal Vero cell is not split
Solution.Referring to fig. 4.
7 viral hemoagglutination test experience of embodiment measures HA
The duplication controllable type virus liquid that Example 4 obtains, the i.e. cell of embodiment 2-1 participate in the virus liquid that rescue is formed
(cultivating 6 days and 7 days respectively).Red cell suspension is prepared according to " preparation of 1% chicken erythrocyte suspension " SOP.Add PBS, takes 8 sample-addings
Device installs 200 μ L band filter core water droppers, 50 μ L PBS is drawn in loading slot, micro plate is added.Viral 100 μ L to be checked is added.Successively
Two times are done to be serially diluted.It is sufficiently mixed red blood cell with virus, temperature is incubated for 60min, observes hemagglutination and records knot
Fruit.The result shows that the virus liquid of culture 6 days and 7 days has erythrocyte agglutination under conditions of extension rate is 1:8 and 1:4 respectively
Phenomenon shows virus rescue success.
The qPCR measuring method of the duplication controllable type virus of embodiment 8
With 293T (being purchased from Shanghai Ji Ning Industrial Co., Ltd.) plating cells, bed board culture medium is DMEM+10%FBS (purchase
From Shanghai Yan Sheng Industrial Co., Ltd.), the every hole 1 × 10 of bed board amount62mL culture medium is added in a 293T cell, every hole, and 6 orifice plates are put
Enter in carbon dioxide incubator, 37 DEG C, 5%CO2Stationary culture rs for 24 hours.
The virus liquid that embodiment 5 obtains is configured to solution to be measured, for preparing 2mL, is shown in Table 3.
Table 3
In Biohazard Safety Equipment, the former culture medium of culture 18hrs is drawn, configured 2mL virus liquid is added, and carry out phase
It should mark.37 DEG C, 5%CO2Stationary incubation 2hrs.
TRNzol method extracts RNA:
1) after the completion of being incubated for, former culture medium is discarded, is added the PBS of preheating, board-washing 3 times.Then it is added into 6 orifice plates
TRNzol reagent, every hole 0.2mL.Pressure-vaccum is allowed to become to be homogenized.It transfers them in centrifuge tube, marks.
2) it is placed at room temperature for 5min, is kept completely separate nucleic acid-protein compound.
3) 0.04mL chloroform is added in every hole, acutely shakes 15s, is placed at room temperature for 3min.
4) 4 DEG C, 12000g, be centrifuged 15min, upper strata aqueous phase is transferred in new pipe, (not be drawn onto middle layer and under
Layer), about 100 μ L.
5) isopropanol of -80 DEG C of isometric pre-coolings is added, overturns 3 times, is placed at room temperature for 10min.
6) 4 DEG C, 12000g is centrifuged 10min, and careful inhale abandons supernatant, it is seen that milky white precipitate.
7) 75% ethyl alcohol of 0.19mL is added, is vortexed and mixes.
8) 4 DEG C, 10000g is centrifuged 8min, and careful inhale abandons supernatant.
9) it uncaps in superclean bench and places 10min, residual alcohol is made to volatilize.(the Shanghai RNase-free ddH2O is added
Suo Bao Biotechnology Co., Ltd) 20 μ L, blow and beat 20 mixings, sufficiently dissolution RNA repeatedly.
10) concentration of micro-spectrophotometer measurement RNA, it is spare.
Reverse transcription cDNA:
1) melt kit each component on ice
2) configure reaction system (following dosage is a sample, and multiple samples voluntarily convert)
4 reaction system 1 of table
* random primer is 5 '-NNNNNN-3 ', and N is randomized bases, 5 '-TTTTTTTTTTTTTTT- of Oligonucleolide primers
3 ', it is that kit is included.
5 reaction system 2 of table
3) it is centrifuged, configured reaction system 1 is centrifuged in tube bottom, 70 DEG C of incubation 5min on Standard PCR instrument, after the completion
It is immediately placed on 3min on ice.
4) configured reaction system 2 is added in reaction system 1,25 DEG C of incubation 5min, 42 DEG C of incubation 50min, 70
DEG C be incubated for 15min, 4 DEG C are spare.
qPCR
1) melt each component on ice
2) configure reaction system (following dosage is a sample, and multiple samples voluntarily convert)
6 reaction system 3 of table
* PCR mixture of ribonucleotides (PCR Nucleotide Mix) is dATP, dCTP, dGTP and the dTTP being pre-mixed
Sodium salt, respective concentration be 10mM, total concentration be 40mM (pH7.5).The pre- blend of kit.
Ben3-FP:5 '-CAAATGTCCAAAGAAGTAAATGCTAGA-3 ' (SEQ ID NO:23)
Ben3-RP:5 '-GGCATCCATCAGCAGGAATT-3 ' (SEQ ID NO:24)
3) program is as follows
Table 7
* Ct value is meant that: (such as in the present embodiment, the fluorescence signal in each reaction tube reaches the thresholding of setting
The 1/10 of maximum fluorescence intensity) when recurring number experienced.
The qPCR measurement result of the duplication controllable type virus of embodiment 9
Wild type influenza virus A/WSN/1933 is subjected to gradient dilution with PBS buffer solution, prepares different number grade copy
Several standard items 1-8.Blank control uses PBS buffer solution.Ct value is meant that: the fluorescence signal arrival in each reaction tube is set
Recurring number experienced, 3 parts of parallel samples are averaged when fixed thresholding.SD value represents standard deviation.
The drawing data of 8 qPCR standard curve of table
Regression curve is drawn according to measurement result, referring to Fig. 5.
The regression equation measured according to standard items is as follows:
Y=-3.1656x+39.415
R2=0.9965；Slope=-3.1656
Amplification efficiency E=10-1/Slope=2.07
The experiment of embodiment 10qPCR validation verification
With reference to " Chinese Pharmacopoeia " 2015 editions biological sample quantitative analysis method verification guide principles and medicine quality standard point
Method validation guideline is analysed, methodology validation is carried out for the qPCR method of duplication controllable type influenza virus exploitation, confirms parameter
It include: specificity, repeatability and precision.
Specificity:
Using different genera cell genomic dna as template, tested according to this detection method.Laboratory sample is voluntarily
It extracts.Experimental result is shown, in addition to replication defect type influenza virus gene group cDNA has amplification curve, reference group Escherichia coli BL
Genomic DNA, bacillus coli DH 5 alpha genomic DNA, carrier pBudCE4.1 genomic DNA are without amplified reaction (referring to Fig. 6).
Repeatability:
8 parts of duplication controllable type influenza virus samples are averaged by measurement three times respectively, and calculate standard deviation and variation
Coefficient.
Acceptable standard: the coefficient of variation≤15%.
Table 9
Average value Avg=28.144；
Standard deviation SD=1.940；
Coefficient of variation CV=SD/Avg*100%=6.892%
Precision:
Three batches of samples are taken, being diluted to copy number is about 1 × 104, while copy number is 2.4 × 10 in Example 98Standard
Product 2, according to the form below mix and detect actual copy number:
Table 10
The rate of recovery of virus is calculated according to following formula:
The rate of recovery=examination criteria additional amount/theoretical addition amount × 100%
Acceptable standard: the rate of recovery=80~120%.
Table 11
Rate of recovery section: 98.68%~107.84%, meet acceptable standard.The rate of recovery index represents qPCR mistake
The damaed cordition of cDNA in journey, the higher loss for representing cDNA of the rate of recovery is smaller, so that precision is higher.
The specificity of result presentation method, the indexs such as repeatability and precision can reach the basic demand of method validation,
It can be used for replicating the quantitative determination of controllable type influenza virus.
Claims (9)
1. a kind of quantitative detecting method for replicating controllable type influenza virus, it is characterised in that: by virus liquid to be measured and production with carefully
Born of the same parents co-culture, and then extracting total serum IgE and reverse transcription is cDNA, finally according to the Ct value of the wild-type virus qPCR of known copy number
As a result standard curve is drawn, the Ct value of duplication controllable type influenza virus is substituted into, calculates and obtains influenza virus copy number.
2. detection method as described in claim 1, it is characterised in that wild-type virus is the A/WSN/ of influenza virus H1N1
1933 plants, and detecting wild-type virus and replicating the qPCR primer of controllable type influenza virus is following primer:
Ben3-FP:5 '-CAAATGTCCAAAGAAGTAAATGCTAGA-3 ' (SEQ ID NO:23)；
Ben3-RP:5 '-GGCATCCATCAGCAGGAATT-3 ' (SEQ ID NO:24).
3. detection method as claimed in claim 2, which comprises the steps of:
(1) it is based on 33-38 DEG C with DMEM+10%FBS culture, 5%CO2Stationary culture 293T cell or Vero cell 24 hours；
(2) virus liquid to be measured is added and in 33-38 DEG C, 5%CO2Stationary incubation 2 hours；
(3) TRNzol method extracts RNA；
It (4) is cDNA by RNA reverse transcription；
(5) the Ct value that sample to be tested is measured by qPCR reaction system, according to the wild-type virus of known copy number as standard
Product carry out qPCR and draw standard curve, bring the Ct value of sample to be tested into regression curve and obtain respective copies number；
The Ct value is that the fluorescence signal in each reaction tube reaches recurring number experienced when setting value.
4. detection method as claimed in claim 3, which is characterized in that step (4) is carried out by following scheme:
(i) reaction system 1 containing random primer and Oligonucleolide primers and RNA to be measured is prepared, and contains MgCl2, buffering
The reaction system 2 of liquid, dNTP, recombinant RNA enzyme inhibitor and AMV reverse transcriptase；
(ii) reaction system 1 is centrifuged in tube bottom, 70 DEG C of incubation 5min, are immediately placed on ice after the completion on Standard PCR instrument
3min；
(iii) reaction system 2 is added in reaction system 1,25 DEG C of incubation 5min, 42 DEG C of incubation 50min, 70 DEG C are incubated for
15min, 4 DEG C spare.
5. detection method according to any one of claims 1-4, it is characterised in that:
The duplication controllable type influenza virus is obtained in such a way that virus rescue system is imported mammalian host cell,
Mammalian host cell stable integration influenza virus PA, PB1, PB2 and NP gene carries in influenza virus rescue system
Saltant type PA, PB1, PB2 and NP gene, the mutation is prevent influenza virus saves system from natural mammalian cellular
Rescue obtains intact virus.
6. detection method as claimed in claim 5, which is characterized in that the influenza virus rescue system includes encoding mutant type
The recombinant plasmid of PA, PB1, PB2 and NP gene and the recombinant plasmid for encoding tetra- kinds of genes of HA, NA, M, NS, the mutation pass through
TAG codon is introduced in four gene orders respectively to realize.
7. detection method as claimed in claim 6, which is characterized in that PA, PB1, PB2 of the stable integration to host cell
The A/WSN/1933 strain of influenza virus H1N1 is all from the encoding viral gene in NP gene and influenza virus rescue system.
8. detection method as claimed in claim 7, which is characterized in that PA, PB1, PB2 of the stable integration to host cell
Nucleotide sequence with NP gene is respectively such as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4
It is shown.
9. detection method as claimed in claim 8, which is characterized in that the influenza virus rescue system includes following eight matter
Grain: pPolI-WSN-PB, pPolI-WSN-PB1, pPolI-WSN-PA, pPolI-WSN-NP, pPolI-WSN-HA；pPolI-
WSN-NA；pPolI-WSN-M；PPolI-WSN-NS, wherein contained PA gene there are R266 codon mutation be TAG,
PB1 gene is TAG there are R52 codon mutation), PB2 gene there are K33 codon mutation be that there are D101 for TAG and NP gene
Codon mutation is TAG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910290093.9A CN109971888A (en) | 2019-04-11 | 2019-04-11 | A kind of detection method replicating controllable type influenza virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910290093.9A CN109971888A (en) | 2019-04-11 | 2019-04-11 | A kind of detection method replicating controllable type influenza virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109971888A true CN109971888A (en) | 2019-07-05 |
Family
ID=67084215
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910290093.9A Pending CN109971888A (en) | 2019-04-11 | 2019-04-11 | A kind of detection method replicating controllable type influenza virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109971888A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020181837A1 (en) * | 2019-03-13 | 2020-09-17 | Zhejiang Senwei Biopharmaceutical Development Co., Ltd. | Method for rescuing influenza virus and composition therefor |
| CN115896172A (en) * | 2022-09-29 | 2023-04-04 | 深圳盛源生物技术有限公司 | Cotransfection vector for quickly establishing drosophila cell stable expression strain and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929482A (en) * | 2015-12-31 | 2017-07-07 | 北京大学 | Influenza virus, its live vaccine of rite-directed mutagenesis and its preparation method and application |
| CN108064315A (en) * | 2014-08-22 | 2018-05-22 | 西菲伊德公司 | The method for detecting influenza |
-
2019
- 2019-04-11 CN CN201910290093.9A patent/CN109971888A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108064315A (en) * | 2014-08-22 | 2018-05-22 | 西菲伊德公司 | The method for detecting influenza |
| CN106929482A (en) * | 2015-12-31 | 2017-07-07 | 北京大学 | Influenza virus, its live vaccine of rite-directed mutagenesis and its preparation method and application |
Non-Patent Citations (3)
| Title |
|---|
| 刘志军: "应用12质粒转染系统构建A/HNP/03（H9N2）重组禽流感病毒", 《中国优秀硕士学位论文全文数据库》 * |
| 王敏主编: "《医学免疫学实验指导》", 30 March 2016, 北京邮电大学出版社 * |
| 臧阳: "嵌合诺如病毒P粒子疫苗诱导HIV-1广泛中和抗体的研究及qPCR技术检测三价流感减毒活疫苗病毒滴度方法的建立", 《中国优秀博硕士学位论文全文数据库(博士)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020181837A1 (en) * | 2019-03-13 | 2020-09-17 | Zhejiang Senwei Biopharmaceutical Development Co., Ltd. | Method for rescuing influenza virus and composition therefor |
| CN115896172A (en) * | 2022-09-29 | 2023-04-04 | 深圳盛源生物技术有限公司 | Cotransfection vector for quickly establishing drosophila cell stable expression strain and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111560354B (en) | Recombinant novel coronavirus, preparation method and application thereof | |
| Xie et al. | An infectious cDNA clone of SARS-CoV-2 | |
| CN103540614B (en) | The signal of packaging of influenza virus vectors | |
| Marsh et al. | Highly conserved regions of influenza a virus polymerase gene segments are critical for efficient viral RNA packaging | |
| Stucker et al. | The role of evolutionary intermediates in the host adaptation of canine parvovirus | |
| Shang et al. | A naturally occurring recombinant enterovirus expresses a torovirus deubiquitinase | |
| CN107805628A (en) | A kind of stable expression PPR virus acceptor Nectin 4 cell line and its construction method | |
| Sauder et al. | Gene-specific contributions to mumps virus neurovirulence and neuroattenuation | |
| CN106755089B (en) | Cell line for expressing goat lymphocyte activating molecules and construction method and application thereof | |
| Scott et al. | The use of equine influenza pseudotypes for serological screening | |
| CN110205321B (en) | DNA fragment and application thereof in construction of recombinant influenza virus expressing red fluorescent protein gene | |
| CN109971888A (en) | A kind of detection method replicating controllable type influenza virus | |
| US11512117B1 (en) | Whole avian-origin reverse genetic system and recombinant H5N2 subtype avian influenza virus, vaccine and uses thereof | |
| CN113186226B (en) | RNA virus nucleic acid detection reference standard and application thereof | |
| CN112501138A (en) | Method for rapid preparation of infectious RNA viruses | |
| CN104592367B (en) | Influenza NP protein mutant and its encoding gene and application | |
| US20190314482A1 (en) | Vaccines against infectious diseases caused by positive stranded rna viruses | |
| CN105132583B (en) | It is a kind of using influenza virus as HCV detection of nucleic acids quality-control product of carrier and preparation method thereof | |
| CN104711240B (en) | The application of Avianreovirus σ A albumen and its relevant biological material | |
| Wobus et al. | Murine norovirus: additional protocols for basic and antiviral studies | |
| CN103215267B (en) | Suppress siRNA and its application of influenza virus related gene | |
| US20220041997A1 (en) | Method for rescuing influenza virus and composition therefor | |
| CN109943576A (en) | A kind of recombinant rabies virus of chimeric canine distemper virus principal immune gene and its application | |
| CN106754982B (en) | Limited replication West Nile virus system for expressing green fluorescent protein and application thereof | |
| CN104762274B (en) | The application of Avianreovirus σ NS albumen and its relevant biological material |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |