CN115725633A - Cytochrome P450 function research and application in ganoderma triterpene synthesis - Google Patents
Cytochrome P450 function research and application in ganoderma triterpene synthesis Download PDFInfo
- Publication number
- CN115725633A CN115725633A CN202111000127.XA CN202111000127A CN115725633A CN 115725633 A CN115725633 A CN 115725633A CN 202111000127 A CN202111000127 A CN 202111000127A CN 115725633 A CN115725633 A CN 115725633A
- Authority
- CN
- China
- Prior art keywords
- cyp5150l8
- saccharomyces cerevisiae
- iglcpr
- expression
- prs425
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
A cytochrome P450 function research and application in ganoderma triterpene synthesis are disclosed, wherein a two-plasmid antibiotic regulation and control expression system is adopted in a saccharomyces cerevisiae cell, and expression regulation and control are carried out on GL21117 in one plasmid and expression regulation and control are carried out on two genes GL20421 and GL21117 in two plasmids simultaneously, so that the yield of a GA-HLDOA precursor is ensured, and a type of ganoderma triterpene is obtained at the same time, and the method comprises the following steps: 3, 15-dihydroxy-lanosta-8, 24-diene-26-oic acid, ganoderic acid Y, 3,15, 30-trihydroxy-lanosta-8, 24-diene-26-oic acid, 7-oxo-3, 15-dihydroxy-lanosta-8, 24-diene-26-oic acid and 24,25-dialkyl-3, 30-dihydroxy-lanosta-8-enyl-26-oic acid.
Description
Technical Field
The invention relates to a technology in the field of bioengineering, in particular to a cytochrome P450 function research and an application in ganoderma triterpene synthesis.
Background
Because the growth cycle of the ganoderma lucidum is long and not easy to culture, the metabolite in the ganoderma lucidum is rich and the content is relatively low, and the factors such as mature and comprehensive gene manipulation means of ganoderma lucidum fungal cells are lacked, researchers have poor cognition and slow progress on the biosynthesis pathway of ganoderma lucidum triterpenoids.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides a cytochrome P450 function research and application thereof in ganoderma triterpene synthesis, wherein a two-plasmid antibiotic regulation and expression system is adopted in saccharomyces cerevisiae cells, and by carrying out expression regulation and control on GL21117 in one plasmid and carrying out expression regulation and control on GL20421 and GL21117 in two plasmids simultaneously, the yield of a GA-HLDOA precursor is ensured, and meanwhile, a plurality of functions of two enzymes are researched, so that a series of new unreported ganoderma triterpene compounds are obtained, and the heterologous biosynthesis of the compounds in the saccharomyces cerevisiae cells is realized while disclosing the biosynthesis pathway of the ganoderma triterpene in ganoderma.
The invention is realized by the following technical scheme:
the invention relates to ganoderma triterpene, which comprises the following components: 3, 15-dihydroxy-lanosta-8, 24-dien-26-oic acid (15-hydroxy-gaderic acid HLDOA), ganoderic acid Y (gaderic acid Y), 3,15, 30-trihydroxy-lanosta-8, 24-dien-26-oic acid (15, 30-dihydroxy-gaderic acid HLDOA), 7-oxo-3, 15-dihydroxy-lanosta-8, 24-dien-26-oic acid (7-oxo-15-hydroxy-gaderic acid HLDOA) and 24,25-dialkyl-3, 30-dihydroxy-lanosta-8-enyl-26-oic acid (24, 25-dihydroxy-30-hydroxy-gaderic acid HLDOA) having the following structural formulae:
and
the invention relates to a preparation method of ganoderma triterpene, which comprises the following steps: a novel ganoderma triterpene formed by catalyzing Ganoderic acid HLDOA by P450 gene GL21117 or by catalyzing Ganoderic acid HLDOA by the P450 gene GL21117 and the P450 gene GL21117 together is cloned into saccharomyces cerevisiae overexpression plasmids respectively or together, the saccharomyces cerevisiae overexpression plasmids are respectively transformed into recombinant transformed microorganism saccharomyces cerevisiae for heterologous expression, and the fermentation of the transformed strains is realized.
The nucleotide sequence of the P450 gene GL20421 is shown as Seq ID No.1, and the amino acid sequence thereof is shown as Seq ID No. 2; the nucleotide sequence of the P450 gene GL21117 is shown as Seq ID No.3, and the amino acid sequence thereof is shown as Seq ID No. 4.
The method specifically comprises any one of the following steps:
a) Transferring a saccharomyces cerevisiae expression plasmid pRS426HF-GL21117-G418r into saccharomyces cerevisiae YL-T3 to form a recombined and transformed saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117, and transferring yeast expression plasmids pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr into saccharomyces cerevisiae YL-T3 to form a corresponding saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 excessively expressing the GL21117; fermenting the constructed saccharomyces cerevisiae overexpression strain YL-T3-CYP5150L8-iGLCPR-GL21117, and obtaining the ganoderma triterpenoids from fermentation products.
B) Transferring the Saccharomyces cerevisiae expression plasmids pRS426HF-GL21117-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr into Saccharomyces cerevisiae YL-T3 to form a recombined and transformed Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117; transferring yeast expression plasmids pRS426HF-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr into Saccharomyces cerevisiae YL-T3 to form corresponding Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 for over-expressing GL21117 and GL 20421; fermenting constructed saccharomyces cerevisiae overexpression strains YL-T3-CYP5150L8-iGLCPR-GL21117 and YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117, and obtaining the ganoderma triterpenes from fermentation products.
Drawings
FIG. 1 is a schematic representation of expression plasmid pRS426HF-G418r of the present invention;
FIG. 2 is a schematic diagram of expression plasmid pRS426HF-GL21117-G418r of the present invention;
FIG. 3 is a schematic diagram of expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr according to the present invention;
FIG. 4 is a schematic diagram of expression plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr according to the present invention;
FIG. 5 is HPLC chromatogram and MS analysis of Saccharomyces cerevisiae YL-T3-CYP5150L8-iGLCPR-GL21117 strain and control strain YL-T3-CYP5150L8-iGLCPR-control fermentation product;
FIG. 6 shows HPLC chromatogram and MS analysis of fermentation products of Saccharomyces cerevisiae YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 strain and control strain YL-T3-GL20421-CYP5150L 8-iGLCPR-control;
FIG. 7-FIG. 10 are the GL21117 catalytic product 15-hydroxy-gaderic acid HLDOA in sequence 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;
FIGS. 11 to 14 show the GL21117 catalytic product Ganoderic acid Y in sequence 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;
FIGS. 15-18 are the sequences of GL21117 catalytic product 15, 30-dihydroxy-organic acid HLDOA 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;
FIG. 19 to FIG. 22 show the GL21117 catalytic product 7-oxo-15-hyd in sequenceof oxy-gaderic acid HLDOA 1 H-NMR spectrum, 13 C-NMR spectrogram, HSQC spectrogram and HMBC spectrogram;
FIGS. 23 to 26 are sequentially GL21117 and GL20421 co-catalytic products 24, 25-dialkyl-30-hydroxy-herbicidal acid HLDOA 1 H-NMR spectrum, 13 C-NMR spectrum, HSQC spectrum, HMBC spectrum;
FIG. 27 is a schematic of the catalytic formation of different products by GL21117 and GL 20421.
Detailed Description
Example 1
Construction of Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 and control strain YL-T3-CYP5150L8-iGLCPR-control for overexpressing GL21117, namely transferring Saccharomyces cerevisiae overexpression plasmids pRS426HF-GL21117-G418r and pRS425-CYP5150L8-iGLCPR-Hygr into Saccharomyces cerevisiae YL-T3 to form recombinant transformed Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117, and transferring yeast expression plasmids pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr into Saccharomyces cerevisiae YL-T3 to form the corresponding control strain.
The saccharomyces cerevisiae overexpression plasmid comprises: pRS426HF-GL21117-G418r, pRS425-CYP5150L8-iGLCPR-Hygr and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr.
The saccharomyces cerevisiae overexpression plasmid is amplified by PCR to obtain the sequence segments of the coding regions of the P450 genes GL20421, GL21117 and CYP5150L 8. Then, by means of homologous recombination and other methods, the expression vector pRS426 and GL21117 coding region sequence fragment, yeast HXT7p promoter, yeast FBA1t terminator and KanMX gene expression frame containing truncated promoter Ura3 (tP-Ura 3) are recombined and connected to obtain the corresponding recombined overexpression plasmid pRS426HF-GL21117-G418r. The coding region sequence fragments of the expression vector pRS425 and CYP5150L8, yeast HXT7p promoter, yeast FBA1t terminator, iGLCPR expression cassette and HygromycinB gene expression cassette containing truncated promoter Ura3 (tP-Ura 3) are recombined and connected to obtain the corresponding recombined overexpression plasmid pRS425-CYP5150L8-iGLCPR-Hygr. The expression vector pRS425-CYP5150L8-iGLCPR-Hygr, tdh3p promoter, GL20421 coding region sequence fragment and Tef1t terminator are connected through homologous recombination, so as to obtain the overexpression plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr. Wherein the expression product of the GL19526 gene is a Cytochrome P450 Reductase (CPR) iGLCPR.
The recombinant saccharomyces cerevisiae cell YL-T3 refers to: the genetically engineered BY4742 strain YL-T3 is available in the literature (Dai, z., et al, producing aglycons of ginsenosides in bakers' yeast. Sci Rep,2014.4: the BY4742 strain is a commercial yeast host commonly used BY those skilled in the art. On the basis, a plurality of genes at the upstream of the biosynthesis pathway of the Lanosterol are over-expressed, so that the synthesis amount of the Lanosterol is increased.
The embodiment specifically includes:
1.1 ) construction of yeast expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr.
1.1.1 Based on pRS425-iGLCPR-Hygr, wherein the pRS425-iGLCPR-Hygr plasmid can be constructed by the reference (Lan, X., et al., effective biosynthesis of inorganic organic acid HLDOA using a dual tunable system for optimizing the expression of CYP5150L8 and a Garoderma P450 product, biotechnol Bioeng,2019.116 (12): p.3301-3311). The plasmid pRS425-iGLCPR-Hygr was first digested with Pmel enzyme to obtain linearized plasmid vector fragments.
1.1.2 Then using primer pair HF-CYP5150L8-F and HF-CYP5150L8-R, using pRS426-HXT7p-CYP5150L8-FBA1t [11] as template to amplify CYP5150L8 expression frame containing homologous arm. The specific sequences of the primers are shown in Table 1:
table 1: primer sequence table for amplifying expression cassette of CYP5150L8 containing homologous arm
| Primer name | Serial number | Sequence(5′to 3′) |
| HF-CYP5150L8-F | Seq ID No.5 | ggcaaaggaataatctcgagtcatgtaattagttatgtca |
| HF-CYP5150L8-R | Seq ID No.6 | cgagcggtctaaggcggtttacttctcgtaggaacaattt |
F and R represent forward and reverse primers, respectively.
1.1.3 The linearized pRS425-iGLCPR-Hygr vector fragment and the CYP5150L8 expression cassette fragment containing the homology arm were then ligated by homologous recombination. The method comprises the following specific steps:
1.1.3.1 Connection system: 0.03pmol of linearized pRS425-iGLCPR-Hygr plasmid, 0.06pmol of amplified CYP5150L8 expression cassette fragment containing the homology arm, 4. Mu.L of CE II Buffer, 2. Mu.L of Exnase II, and 20. Mu.L of sterile water. Mixing, reacting at 37 deg.C for 30min, and ice-cooling for 5min.
1.1.3.2 50 μ L of DH 5. Alpha. Competent cells frozen at-80 ℃ were removed and left on ice until completely thawed. It takes about 5min.
1.1.3.3 The ligation product was transferred to 50. Mu.L of DH 5. Alpha. Competent cells, mixed well to avoid air bubbles, incubated on ice for 20min, heat-shocked at 42 ℃ for 60S, then on ice for 2min, added to 900. Mu.L of LB medium, and incubated at 37 ℃ for 60min. Subsequently, 100ug/mL of Amp resistant LB plate was applied and the culture was carried out overnight at 37 ℃ with the incubator inverted.
1.1.3.4 ) after single colonies had grown on the plates, single colonies were selected and transferred to 3mL of liquid LB medium containing 100ug/mL Amp resistance and cultured overnight at 37 ℃ and 220 rpm.
1.1.3.5 Etc., extracting plasmids, performing PCR verification by using a sequencing primer, then selecting possible plasmids for sequencing, and comparing sequencing results, thereby obtaining correct recombinant plasmid pRS425-CYP5150L8-iGLCPR-Hygr.
The sequencing primers used are shown in table 2:
table 2: sequencing primer sequence table for verifying correctness of recombinant plasmid pRS425-CYP5150L8-iGLCPR-Hygr
| Name of primer | Serial number | Sequence(5′to 3′) |
| HF-CYP5150L8-CX-F | Seq ID No.7 | atttcgatgatgcagcttgg |
| HF-CYP5150L8-CX-R | Seq ID No.8 | acatcaaaatccacattctc |
1.2 ) construction of yeast expression plasmid pRS426HF-GL21117-G418r.
1.2.1 Based on pRS426HF-G418r, wherein the pRS426HF-G418r plasmid can be constructed by reference (Lan, X., et al, effective biosynthesis of inorganic organic acid HLDOA using a dual tunable system for optimizing the expression CYP of 5150L8 and a gastroenterma P450 reduction. Biotechnol Bioeng,2019.116 (12): p.3301-3311). Plasmid pRS426HF-G418r was first digested with Pmel enzyme to obtain a linearized plasmid vector fragment.
1.2.2 Then, using the Ganoderma lucidum cDNA as a template, and using a primer pair GL21117-F and GL21117-R, obtaining a GL21117 coding region gene fragment containing a homology arm by PCR amplification.
The primer pair GL21117-F and GL21117-R are shown in Table 3:
table 3: primer sequence table for amplifying GL21117 coding region gene fragment
| Name of primer | Serial number | Sequence(5′to 3′) |
| GL21117-F | Seq ID No.9 | TAATTTTAATCAAAAAGTTTATGGCGACGTTGGAGGACCC |
| GL21117-R | Seq ID No.10 | ATTAATTTGAATTAACGTTTTCAAGAAGCCTGCGCATGCC |
F and R represent forward and reverse primers, respectively.
1.2.3 The linearized vector fragment is connected with a gene fragment of the GL21117 coding region containing a homology arm by a homologous recombination method, and the specific operation steps are as follows:
1.2.3.1 Connection system): 0.03pmol of linearized pRS426HF-G418r plasmid fragment, 0.06pmol of amplified GL21117 gene coding region sequence fragment, 4. Mu.L of CE II Buffer, 2. Mu.L of Exnase II, and 20. Mu.L of sterile water. Mixing, reacting at 37 deg.C for 30min, and ice-cooling for 5min.
1.2.3.2 1.1.3.2 as in example 1;
1.2.3.3 1.1.3.3 as in example 1;
1.2.3.4 Same as 1.1.3.4 in example 1;
1.2.3.5 Etc. after the bacterial liquid is grown to a stable period, extracting plasmids, carrying out PCR verification by using sequencing primers, then selecting possible plasmids for sequencing, and comparing sequencing results, thereby obtaining correct recombinant plasmid pRS426HF-GL21117-G418r.
The sequencing primers used are shown in table 4:
table 4: sequencing primer sequence table for verifying correctness of recombinant plasmid pRS426HF-GL21117-G418r
| Primer name | Serial number | Sequence(5′to 3′) |
| P450-CX-F | Seq ID No.11 | gccaatacttcacaatgttc |
| P450-CX-R | Seq ID No.12 | tcattttgtcattgaccttc |
1.3 Expression plasmids pRS426HF-GL21117-G418r and pRS425-CYP5150L8-iGLCPR-Hygr were transformed into recombinantly engineered Saccharomyces cerevisiae cell YL-T3 by the lithium acetate method [21], and the transformed yeast was spread on SC-His-Leu-Ura (SC-HLU) solid medium (yeast nitro gene base with amino acids (YNB), 6.7G/L; glucose, 20g/L; "yeast synthetic drop-out media (SD) Y2001,1.39g/L; trptophan, 76mg/L; agar powder, 2%) were cultured. The temperature of the incubator is 30 ℃ for 1.5 to 3 days. Until the transformants appeared, single clones were selected, thus obtaining a Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 strain overexpressing GL21117.
1.4 Expression plasmids pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr are transformed into a recombinant saccharomyces cerevisiae cell YL-T3 by a lithium acetate method [21] (Gietz et al, 2007), and the specific operation steps are the same as 1.3 in example 1. Finally, a control strain YL-T3-CYP5150L8-iGLCPR-control of the Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 strain over-expressing GL21117 is obtained.
The control strains refer to: for Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 overexpressing GL21117, the control strain is a strain containing pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr two plasmids, namely YL-T3-CYP5150L8-iGLCPR-control; for the Saccharomyces cerevisiae strain YL-T3-GL 20421-GL 5150L8-iGLCPR-GL21117 overexpressing GL21117 and GL20421 simultaneously, the control strain is the Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-control containing pRS426HF-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr two plasmids.
Example 2
And simultaneously, constructing a saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 and a reference strain YL-T3-GL20421-CYP5150L8-iGLCPR-control for over-expressing GL21117 and GL20421, namely transferring the saccharomyces cerevisiae expression plasmid pRS426HF-GL21117-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr into saccharomyces cerevisiae YL-T3 to form a recombined and transformed saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117. Yeast expression plasmids pRS426HF-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr are transferred into Saccharomyces cerevisiae YL-T3 to form a corresponding control strain YL-T3-GL20421-CYP5150L8-iGLCPR-control, which specifically comprises:
2.1 Construction of yeast expression plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr.
2.1.1 Construction was carried out on the basis of pRS425-ERG1-CYP5150L8-iGLCPR-HygB, where pRS425-ERG1-CYP5150L8-iGLCPR-HygB plasmids can be constructed from the literature references (Lan, X., et al, effective biosyntheses of inorganic organic acid HLDOA using a dual construction system for optimizing the expression of CYP5150L8 and a gastroentera P450 production. Biotechnol Bioeng,2019.116 (12): p.3301-3311.).
2.1.2 pRS425-ERG1-CYP5150L8-iGLCPR-HygB plasmid is taken as a template, and primer pairs P1-F and P1-R, P2-F and P2-R, and P3-F and P3-R are taken as primers for PCR amplification respectively. Thus dividing the vector into 3 segments and amplifying.
2.1.3 Then using Ganoderma cDNA as a template, and using a primer pair A9-GL20421-F and A9-GL20421-R, obtaining a GL20421 coding region gene segment containing a homology arm by PCR amplification.
The primer pairs for the construction plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr are shown in Table 5:
table 5: primer sequence table for constructing plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr
| Primer name | Serial number | Sequence(5′to 3′) |
| P1-F | Seq ID No.13 | tttgtttgtttatgtgtgtttattcg |
| P1-R | Seq ID No.14 | cttgaccgcagttaactgtg |
| P2-F | Seq ID No.15 | cacagttaactgcggtcaag |
| P2-R | Seq ID No.16 | gttgcgcagcctgaatggcg |
| P3-F | Seq ID No.17 | cgccattcaggctgcgcaac |
| P3-R | Seq ID No.18 | ggagattgataagacttttctag |
| A9-GL20421-F | Seq ID No.19 | gaaaagtcttatcaatctccTCAGTCTGCACGACGCAC |
| A9-GL20421-R | Seq ID No.20 | aacacacataaacaaacaaaATGATCATCCCAGTAGACAT |
F and R represent forward and reverse primers, respectively.
2.1.4 Then three vector fragments amplified by using pRS425-ERG1-CYP5150L8-iGLCPR-HygB plasmid as a template and a GL20421 coding region gene fragment containing a homology arm are subjected to homologous recombination and connection. The method comprises the following specific steps:
2.1.4.1 Connection system): 0.03pmol, 4. Mu.L of CE II Buffer, 2. Mu.L of Exnase II and sterile water were added to each of the three vector fragments and the GL20421 coding region gene fragment containing the homology arm to make up 20. Mu.L. Mixing, reacting at 37 deg.C for 30min, and ice-cooling for 5min.
2.1.4.2 1.1.3.2 as in example 1;
2.1.4.3 1.1.3.3 as in example 1;
2.1.4.4 1.1.3.4 as in example 1;
2.1.4.5 ) after the bacterium liquid grows to a stable period, extracting plasmids, carrying out PCR verification by using a sequencing primer, then selecting possibly-paired plasmids for sequencing, and comparing sequencing results, thereby obtaining correct recombinant plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr
The sequencing primers used are shown in table 6:
table 6: sequencing primer sequence table for verifying correctness of recombinant plasmid pRS425-GL20421-CYP5150L8-iGLCPR-Hygr
| Name of primer | Serial number | Sequence(5′to 3′) |
| P1-P2-FP | Seq ID No.21 | gtaagacgattgctaaccac |
| P2-P3-FP | Seq ID No.22 | gttgagtgttgttccagtttg |
| P3-P4-FP | Seq ID No.23 | atgtgatttcgaccattgac |
| P1-P4-RP | Seq ID No.24 | aagacggtaggtattgattg |
F and R represent forward and reverse primers, respectively.
2.2 The constructed pRS425-GL20421-CYP5150L8-iGLCPR-Hygr plasmid and pRS426HF-GL21117-G418r are transformed into a recombined saccharomyces cerevisiae cell YL-T3 by a lithium acetate method, and the transformed yeast is coated on an SC-His-Leu-Ura (SC-HLU) solid medium (yeast nitro base with amino acids (YNB), 6.7G/L; glucose, 20g/L; "yeast synthetic drop-out media (SD) Y2001,1.39g/L; trptophan, 76mg/L; agar powder, 2%) were cultured. The temperature of the incubator is 1.5 to 3 days at 30 ℃. Until transformants appeared, single clones were selected to obtain Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 which overexpresses both GL21117 and GL 20421.
2.3 Constructed pRS425-GL20421-CYP5150L8-iGLCPR-Hygr plasmid and pRS426HF-G418r are transformed into a recombined and transformed saccharomyces cerevisiae cell YL-T3 by a lithium acetate method, and the transformed yeast is coated on an SC-His-Leu-Ura (SC-HLU) solid medium (yeast nitro gene base with amino acids (YNB), 6.7G/L; glucose, 20g/L; yeast synthetic drop-out media (SD) Y2001,1.39g/L; tryptophan,76mg/L; agar powder, 2%) were cultured. The temperature of the incubator is 1.5 to 3 days at 30 ℃. Until transformants appeared, single clones were selected to obtain a control strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 of Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 overexpressing both GL21117 and GL 20421.
Example 3
Fermentation and product extraction of over-expressed saccharomyces cerevisiae strains and control strains, namely fermenting constructed saccharomyces cerevisiae over-expressed strains YL-T3-CYP5150L8-iGLCPR-GL21117, YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 and corresponding control strains YL-T3-CYP5150L8-iGLCPR-control and YL-T3-GL20421-CYP5150L8-iGLCPR-control which do not contain GL21117 genes, and comparing the difference of metabolites in the fermented thalli to preliminarily determine the catalytic activity of GL21117 and GL 20421.
The overexpression plasmid is used for transforming the saccharomyces cerevisiae cell, and the comparison with a control strain after fermentation is that: the overexpression plasmids were transformed into recombinant engineered s.cerevisiae cell YL-T3 by standard lithium acetate transformation methods (Gietz, R.D. and R.H. Schiestl, high-efficiency year transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc,2007.2 (1): p.31-4.) to construct the corresponding experimental strains. One overexpression strain is a Saccharomyces cerevisiae strain overexpressing GL21117, YL-T3-CYP5150L8-iGLCPR-GL21117, namely YL-T3 strain transformed with two plasmids of pRS426HF-GL21117-G418r and pRS425-CYP5150L8-iGLCPR-Hygr. The second overexpression strain is a Saccharomyces cerevisiae strain overexpressing GL21117 and GL20421 simultaneously, YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117, namely Saccharomyces cerevisiae YL-T3 strain transformed with two plasmids of pRS426HF-GL21117-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr. Fermenting the two strains and a control strain by YPD24 culture medium, extracting thallus precipitate of fermentation product by methanol, analyzing and observing whether new peak is generated compared with the control strain by HPLC (high performance liquid chromatography) method, thereby primarily judging whether new product is generated.
The specific steps of the embodiment include:
3.1 The constructed transformants of the saccharomyces cerevisiae strain are respectively liquid-transferred to SC-His-Leu-Ura (SC-HLU) liquid culture medium (yeast nitro gene base without amino acids (YNB), 6.7g/L; glucose, 20g/L; "yeast synthetic drop-out media (SD) Y2001,1.39g/L; tryptophan,76 mg/L) at 30 ℃ and 220rpm until the bacteria grow to a stable state.
3.2 Then liquid transferring the cultured bacterial liquid to an SC-HLU liquid culture medium again according to the proportion of 3 percent, culturing the bacterial liquid at the temperature of 30 ℃ and the rpm of 220 until the bacterial body reaches the logarithmic phase, and completing the preparation of seed bacterial liquid.
3.3 Then inoculating the seed liquid into YPD24 medium (yeast powder 10g/L, beef peptone 20g/L, glucose 20g/L, glycerol 40 g/L) at a ratio of 3%, and fermenting and culturing at 30 deg.C and 220rpm for 5 days.
The YPD24 medium comprises 10g/L of yeast powder, 20g/L of beef peptone, 20g/L of glucose and 40g/L of glycerol.
3.4 After the fermentation is finished, taking out the fermented bacterial liquid, centrifuging to remove supernatant, extracting cell sediment by using methanol, centrifuging, filtering the supernatant by using a 0.22 mu m needle filter to obtain a crude extract after the fermentation of the recombinant modified strain, and then loading the crude extract for HPLC detection and analysis of a fermentation product.
3.5 By observing and comparing the difference between HPLC spectrograms of the strains to be detected and the reference strains, mainly whether new peaks appear or not, and preliminarily judging whether new ganoderma triterpene substances are generated or not.
Example 4
HPLC detection is carried out on fermentation products of the saccharomyces cerevisiae transformed strains, and the HPLC detection specifically comprises the following steps:
4.1 HPLC analytical method for fermentation products:
the instrument comprises the following steps: agilent 1260Infinity II HPLC analytical System, DAD (Diode array detector) detector.
And (3) chromatographic column: kinetex Biphenyl analytical column (2.6 μm,150 mm. Times.4.6 mm, phenomenex, torrance, calif.).
Column temperature: 30 ℃; flow rate: 0.5mL/min; sample introduction amount: 20 μ L, detection wavelength 214nm.
Phase A: ultrapure water, phase B: methanol (containing 0.1% acetic acid).
Gradient elution was used for YL-T3-CYP5150L 8-iglcr-GL 21117 and its control strain YL-T3-CYP5150L 8-iglcr-control, with the procedure: 0-30min,80% -100% of phase B; 30-35min,100% of phase B; 35-36min,100% -80% of phase B; 36-45min,80% of phase B.
For YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 and its control strain YL-T3-GL20421-CYP5150L8-iGLCPR-control, the gradient elution program used was: 0-30min,73% -100% of phase B; 30-35min,100% of phase B; 35-36min,100% -73% of phase B; 36-45min,73% of phase B.
4.2 By comparison with the HPLC peak patterns of the fermentation products of the control strains (FIGS. 5 and 6), some new peaks were found, presumably novel ganoderma triterpene products produced by catalysis. And subsequently, further mass spectrum identification is required to determine whether the compound corresponding to the new peak is a ganoderma lucidum triterpene product.
Example 5
Detecting a fermentation product by LC-MS, which specifically comprises the following steps:
the instrument comprises the following steps: ultra-high performance liquid chromatograph-ultra-high resolution mass spectrum combined system
A chromatographic column: kinetex Biphenyl analytical column (2.6 μm,150 mm. Times.4.6 mm, phenomenex, torrance, calif.).
Column temperature: 30 ℃; flow rate: 0.5mL/min; sample introduction amount: 20 μ L, detection wavelength 214nm.
Phase A: ultrapure water, phase B: methanol (containing 0.1% acetic acid).
The gradient elution procedure was: 0-30min,80% -100% of phase B; 30-35min,100% of phase B; 35-36min,100% -80% of phase B; 36-45min,80% of phase B.
Scanning molecular weight: 100-1000.
The comparison of HPLC, MS spectrum and peak corresponding ion with the control bacteria fermentation product (figure 5 and figure 6) is used to basically determine whether new ganoderma triterpene product is produced. Then further carrying out separation and purification and structure identification.
Example 6
The separation, purification and identification of the fermentation product specifically comprise:
6.1 ) separation and purification of fermentation products
6.1.1 Taking a yeast strain YL-T3-CYP5150L8-iGLCPR-GL21117 or YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 frozen at-80 ℃, streaking on an SC-HLU solid plate, and then culturing at 30 ℃ until bacterial colonies grow to activate thalli.
6.1.2 Single clone was picked and transferred to SC-HLU liquid medium and cultured at 30 ℃ and 220rpm until the strain grown to logarithmic phase.
6.1.3 After growth of the strain, the strain was transferred to SC-HLU liquid medium at a ratio of 3%, and then cultured at 30 ℃ and 220rpm until logarithmic phase. At this point the fermentation seed preparation is complete.
6.1.4 ) inoculating and fermenting. The cultured seed solution was inoculated into YPD24 medium at a ratio of 3%. By using 2 L big shake flasks with the filling amount of 400mL per flask for a total 2 And 5, bottles. Place all flasks in 3 0℃ 22 Fermentation was carried out at 0rpm for 5 days.
6.1.5 At the end of fermentation, the ratio of 1Adding ethyl acetate into the solution, adding the mixture into the solution, 3 shaking and extracting on a shaking table at the temperature of 0 ℃ and the speed of 250 rpm. The supernatant ethyl acetate layer was collected. The lower layer was extracted again with ethyl acetate. The ethyl acetate after the two extractions was then combined and rotary evaporated using a rotary evaporator to essentially dry to dryness. Then, the reaction mixture was aspirated, and the residue was dissolved out with methanol, and the dissolved products were combined and subjected to further purification.
6.1.6 Purified over normal phase silica gel column. The method comprises the following steps:
chromatography columns of 34mm (inner diameter of column) by 500mm (effective length of column) were used;
the elution procedure was: 200mL of petroleum ether; petroleum ether: ethyl acetate =8, 1, 200mL; petroleum ether: ethyl acetate =2, 1, 200mL; petroleum ether: ethyl acetate =1, 600mL; petroleum ether: ethyl acetate =1, 600mL; petroleum ether: ethyl acetate =1, 400mL; methanol, 600mL.
During the elution, the fractions were collected, filtered through a 0.22 μm organic syringe filter, and analyzed by HPLC. HPLC detection method is the same as 4.1 in example 4.
After detection, the collected liquid containing the new product is completely combined, then is subjected to rotary evaporation by using a rotary evaporator until the collected liquid is evaporated to dryness, then is dissolved out by using a small amount of methanol, is centrifuged at 12000rpm for 10min, and is taken out for subsequent treatment.
6.1.7 Preparative purification using a preparative liquid phase.
The concentrated crude product is further purified by a preparative liquid phase, which comprises the following steps:
the instrument comprises the following steps: an Agilent 1260 series liquid chromatograph. A DAD detector with a detection wavelength of 214nm;
and (3) chromatographic column: YMC-Pack ODS-A,20x250 mm,5um,12nm;
flow rate: 10mL/min; sample introduction amount: 800 mu L;
mobile phase: phase A: ultrapure water, phase B: methanol;
the gradient elution procedure was: 0-50min,80% -100% of phase B; 50-60min,100% of phase B; 60-60.5min,100% -80% phase B; 60.5-70min,80% of phase B.
During the peak time of the new product, fractions were collected using a 50ml glass tube for each time period and then subjected to HPLC. HPLC detection method is the same as 4.1 in example 4. And (3) estimating the purity of the new product according to the peak area in the HPLC spectrogram, combining the collected liquid in the collecting tube with higher purity, performing rotary evaporation to dryness, and dissolving the mixture into a centrifuge tube by using HPLC-grade methanol with the volume of less than 5ml (the weight of the centrifuge tube needs to be weighed before adding). Vacuum evaporating to obtain powder, weighing, and determining the weight of the pure product.
6.2 ) mass spectrometric identification. The pure substance was subjected to UPLC-APCI-MS analysis in the same manner as in example 5. Thereby determining whether the isolated and purified compound is the substance of interest and the purity.
6.3 Structure identification of new compounds.
If the compound obtained after separation and purification is determined to be the substance of interest. NMR (nuclear magnetic resonance spectroscopy) detection can be further performed to confirm the structure of the new product. By finely analyzing the spectrograms of the one-dimensional carbon spectrum, the one-dimensional hydrogen spectrum, the HSQC and the HMBC, the structure of the separated compound can be finally determined, so that whether the new compound is a new ganoderma triterpenoid is determined.
6.3.1 Identification of a novel product structure produced by Saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 overexpressing GL21117.
Four novel compounds were obtained from the fermentation product of YL-T3-CYP5150L8-iGLCPR-GL 21117.
6.3.1.1 Identified that the first novel compound was 15-hydroxy-organic acid HLDOA. Molecular formula C 30 H 48 O 4 The molecular weight is 472.354711, the MS ions are mainly 455.35272 and 437.34038. The one-dimensional carbon and hydrogen spectra data are shown in table 7. 1 H-NMR、 13 The C-NMR, HSQC and HMBC spectra are shown in FIGS. 7-10.
TABLE 7 preparation of hydroxy-gaderic acid HLDOA 1 H-NMR、 13 C-NMR data sheet
6.3.1.2 Identified as a second novel compound is Ganoderic acid Y. Molecular formula C 30 H 46 O 3 The molecular weight is 454.344147, and the MS ions are mainly 437.34570 and 455.35543. The one-dimensional carbon and hydrogen spectra data are shown in table 8.
1 H-NMR、 13 The C-NMR, HSQC and HMBC spectra are shown in FIGS. 11-14.
TABLE 8 of Ganoderic acid Y 1 H-NMR、 13 C-NMR data sheet
| C position | 13C NMR(ppm) | 1H NMR(δppm,J,N) |
| 1 | 27.92 | (1.32m,1.99m,2H) |
| 2 | 27.8 | (1.67m,1.72m,2H) |
| 3 | 78.98 | 3.25(dd,J＝11.6,4.3Hz,1H) |
| 4 | 38.71 | - |
| 5 | 49.11 | 1.09(dd,J＝11.4,4.3Hz,1H) |
| 6 | 23.01 | (2.07m,2.10m,2H) |
| 7 | 120.34 | 5.48(d,J＝5.1Hz,1H) |
| 8 | 142.57 | - |
| 9 | 145.95 | - |
| 10 | 37.38 | - |
| 11 | 116.2 | 5.32(d,J＝6.3Hz,1H) |
| 12 | 37.81 | (2.08m,2.21d,J＝18.0Hz,2H) |
| 13 | 43.81 | - |
| 14 | 50.32 | - |
| 15 | 31.49 | (1.39m,1.61m,2H) |
| 16 | 35.72 | (1.43m,1.99m,2H) |
| 17 | 50.86 | 1.58(m,1H) |
| 18 | 15.67 | 0.57(s,3H) |
| 19 | 22.76 | 0.98(s,3H) |
| 20 | 36.16 | 1.42(m,1H) |
| 21 | 18.31 | 0.93(d,J＝6.5Hz,3H) |
| 22 | 34.75 | (1.19m,1.56m,2H) |
| 23 | 25.92 | (2.13m,2.27m,2H) |
| 24 | 145.67 | 6.90(t,J＝7.5Hz,1H) |
| 25 | 126.48 | - |
| 26 | 172.01 | - |
| 27 | 12.04 | 1.84(s,3H) |
| 28 | 28.15 | 1.01(s,3H) |
| 29 | 15.8 | 0.88(s,3H) |
| 30 | 25.56 | 0.88(s,3H) |
6.3.1.3 A third novel compound identified as 15,30-dihydroxy-organodic acid HLDOA. Molecular formula C 30 H 48 O 5 Molecular weight 488.349626, ms ions are mainly 453.33671 and 435.32491. The one-dimensional carbon and hydrogen spectra data are shown in table 9. 1 H-NMR、 13 The C-NMR, HSQC and HMBC spectra are shown in FIGS. 15-18.
TABLE 9 preparation of 30-dihydroxy-ganoderic acid HLDOA 1 H-NMR、 13 C-NMR data sheet
| C position | 13C NMR(ppm) | 1H NMR(ppm,J,N) |
| 1 | 35.4 | (1.26m,1.75m,2H) |
| 2 | 27.71 | (1.60m,1.68m,2H) |
| 3 | 78.76 | 3.25(dd,J＝11.7,4.5Hz,1H) |
| 4 | 38.87 | - |
| 5 | 50.3 | 1.15(dd,J＝12.7,2.2Hz,1H) |
| 6 | 18.41 | (1.53m,1.75m,2H) |
| 7 | 29.58 | - |
| 8 | 130.58 | - |
| 9 | 137.98 | - |
| 10 | 37.57 | - |
| 11 | 20.97 | (2.08m,2.12m,2H) |
| 12 | 31.54 | (1.64m,1.81m,2H) |
| 13 | 46.33 | - |
| 14 | 56.02 | - |
| 15 | 74.91 | 4.50(dd,J＝9.7,5.8Hz,1H) |
| 16 | 40.16 | (1.98m,2.03m,2H) |
| 17 | 50.08 | 1.76(m,1H) |
| 18 | 17.55 | 0.71(s,3H) |
| 19 | 27.93 | 1.01(s,3H) |
| 20 | 36 | 1.39(m,1H) |
| 21 | 18.19 | 0.90(d,J＝6.4Hz,3H) |
| 22 | 34.62 | (1.20m,1.51m,2H) |
| 23 | 25.69 | (2.10m,2.24m,2H) |
| 24 | 145.16 | 6.85(td,J＝7.7,1.5Hz,1H) |
| 25 | 126.21 | - |
| 26 | 169.6 | - |
| 27 | 12.18 | 1.85(s,3H) |
| 28 | 18.82 | 1.01(s,3H) |
| 29 | 15.52 | 0.83(s,3H) |
| 30 | 66.63 | (3.66d,J＝11.0Hz,4.02d,J＝11.1Hz,2H) |
6.3.1.4 Identified as 7-oxo-15-hydroxy-boronic acid HLDOA. Molecular formula C 30 H 46 O 5 The molecular weight is 486.333976, and the MS ion is mainly 487.35245. The one-dimensional carbon and hydrogen spectra data are shown in table 10. 1 H-NMR、 13 The C-NMR, HSQC and HMBC spectra are shown in FIGS. 19 to 22.
TABLE 10 preparation of 7-oxo-15-hydroxy-boronic acid HLDOA 1 H-NMR、 13 C-NMR data sheet
6.3.2 Identification of a new product structure produced by Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 which simultaneously overexpresses GL21117 and GL 20421.
A new ganoderma lucidum triterpenoid 24, 25-dialkyl-30-hydroxy-triterpenoid HLDOA is obtained from a fermentation product of a saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 which simultaneously over-expresses GL21117 and GL 20421. The one-dimensional carbon spectrum and hydrogen spectrum data are shown in table 11. 1 H-NMR、 13 The C-NMR, HSQC and HMBC spectra are shown in FIGS. 23-26.
TABLE 11 preparation of 25-dialkyl-30-hydroxy-steroidal acid HLDOA 1 H-NMR、 13 C-NMR data sheet
Compared with the prior art, the invention further modifies the saccharomyces cerevisiae, thereby obtaining a new screened chassis cell for the excavation of the biosynthesis pathway of the ganoderic acid and the research of the enzyme function. Finally, a plurality of new ganoderma triterpene compounds are obtained, a partial biosynthesis route of ganoderic acid is further disclosed, and heterologous biosynthesis of the ganoderma triterpene compounds in saccharomyces cerevisiae is realized.
The foregoing embodiments may be modified in many different ways by those skilled in the art without departing from the spirit and scope of the invention, which is defined by the appended claims and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.
Sequence listing
<110> Shanghai university of traffic
Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences
<120> cytochrome P450 function research and application in ganoderma triterpene synthesis
<130> fnc590e
<141> 2021-08-25
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1626
<212> DNA
<213> P450 Gene GL20421 (Artificial Sequence)
<400> 1
atgatcatcc cagtagacat tgtatcgccc ctatctgtct ggcaggtcgc cgccgtcctc 60
accgcggtct acttcgccca cagcttcgtc cgcgcccgcc gcaaggccgc ccgcgagacg 120
cctcttgcgt gtcctccaag gcagagctgg ctcttcggca tccgcaacct tatcgcaggc 180
aaccccgagg ccggctccat ctacgaggcc tggatcgagg aatacgggtc cgtctaccgc 240
gtccccgcac cactggggtc cacccgggtc atcctcaccg atcccaaggc gatcgcgcac 300
ttctactcgg tcgagacgtg gacgtatgtg cagacgaagc tcgcgagggt cgcgattgag 360
ggcctgttgg gccgtgggtt gctttgggcg gaaggggagt ctcataaacg gcaacgcaag 420
gcgatatccc ccgccttcag caacattgcc attcgaaggc ttacctccgt gttctacgac 480
tccgtctaca agctcaagac caattgggac aaccaattgg cttcagtgga tttcgccacg 540
atagatgtac agaaatggat gaaccacgtc tcccttgaca gtatcggcat cgcgggattc 600
tctcatgact ttggctccct cgaaggcaag cactccgctg tcgccgaagt attcgatgcc 660
atgggtcatg tcaagccggg catctttacc gctgcggccc tcttcttcgg caatgtcttc 720
cccgtcctct ggcgtctccc cacagaaacg cgccgtctcc aactgaagct gaataagtgt 780
atggaggaga tcgctgtacc cctgctggag aacacgcgca atgagatgag gggtctaggc 840
gagaagggta aggaggagaa gagtatcatt ggcctgttga ttaaggcgga ggatgccaat 900
tcaagcctgc aaatgtctca ggaagagatc atggcccaga tgaaggtgct aatcttggca 960
ggatacgaaa ctacgtcaat cagtctcacg tgggccctca tcgagttatc acgcaagcca 1020
gagacccagg aacgccttcg tgaggagctg aaagaggagt tcccgaacgc ggatccaacc 1080
tgggaacagc tcacgaacgg ctccggtcta cattacctcg acgccgtcgt gcacgagatc 1140
ctcagactcc acgcgccgct caacgtcacc actcgtgttg ccgcaaagga tgacgtcatt 1200
ccactctcca cacccttgcg cctcccaact ggcgagctca ccgaccacgt cgccatcacc 1260
gagggccaag aggtcaccgt gcccatcagc tgcatgaaca ccgccgtcgc attctggggc 1320
cccgacgcac gcgagttccg cccggaacgc tggctcaacg aagacgggct cccgaagaag 1380
gcgcaggaga ttcaggggca ccgccacctg ctcaccttcg tcgacgggca ccgcatctgt 1440
ctcgggcgcg gctttgcgct agcagagttc aaggccgtgc tcggggtgtt gatcaagaac 1500
taccagttcg agctgccgga cgggccagag accaagatcg agttctgtcg tggggtcctt 1560
ccgcgcccgc gcgtcgtcgg cgagaagggc gcgaacctcc cgatgcgggt gcgtcgtgca 1620
gactga 1626
<210> 2
<211> 541
<212> PRT
<213> P450 Gene GL20421 (Artificial Sequence)
<400> 2
Met Ile Ile Pro Val Asp Ile Val Ser Pro Leu Ser Val Trp Gln Val
1 5 10 15
Ala Ala Val Leu Thr Ala Val Tyr Phe Ala His Ser Phe Val Arg Ala
20 25 30
Arg Arg Lys Ala Ala Arg Glu Thr Pro Leu Ala Cys Pro Pro Arg Gln
35 40 45
Ser Trp Leu Phe Gly Ile Arg Asn Leu Ile Ala Gly Asn Pro Glu Ala
50 55 60
Gly Ser Ile Tyr Glu Ala Trp Ile Glu Glu Tyr Gly Ser Val Tyr Arg
65 70 75 80
Val Pro Ala Pro Leu Gly Ser Thr Arg Val Ile Leu Thr Asp Pro Lys
85 90 95
Ala Ile Ala His Phe Tyr Ser Val Glu Thr Trp Thr Tyr Val Gln Thr
100 105 110
Lys Leu Ala Arg Val Ala Ile Glu Gly Leu Leu Gly Arg Gly Leu Leu
115 120 125
Trp Ala Glu Gly Glu Ser His Lys Arg Gln Arg Lys Ala Ile Ser Pro
130 135 140
Ala Phe Ser Asn Ile Ala Ile Arg Arg Leu Thr Ser Val Phe Tyr Asp
145 150 155 160
Ser Val Tyr Lys Leu Lys Thr Asn Trp Asp Asn Gln Leu Ala Ser Val
165 170 175
Asp Phe Ala Thr Ile Asp Val Gln Lys Trp Met Asn His Val Ser Leu
180 185 190
Asp Ser Ile Gly Ile Ala Gly Phe Ser His Asp Phe Gly Ser Leu Glu
195 200 205
Gly Lys His Ser Ala Val Ala Glu Val Phe Asp Ala Met Gly His Val
210 215 220
Lys Pro Gly Ile Phe Thr Ala Ala Ala Leu Phe Phe Gly Asn Val Phe
225 230 235 240
Pro Val Leu Trp Arg Leu Pro Thr Glu Thr Arg Arg Leu Gln Leu Lys
245 250 255
Leu Asn Lys Cys Met Glu Glu Ile Ala Val Pro Leu Leu Glu Asn Thr
260 265 270
Arg Asn Glu Met Arg Gly Leu Gly Glu Lys Gly Lys Glu Glu Lys Ser
275 280 285
Ile Ile Gly Leu Leu Ile Lys Ala Glu Asp Ala Asn Ser Ser Leu Gln
290 295 300
Met Ser Gln Glu Glu Ile Met Ala Gln Met Lys Val Leu Ile Leu Ala
305 310 315 320
Gly Tyr Glu Thr Thr Ser Ile Ser Leu Thr Trp Ala Leu Ile Glu Leu
325 330 335
Ser Arg Lys Pro Glu Thr Gln Glu Arg Leu Arg Glu Glu Leu Lys Glu
340 345 350
Glu Phe Pro Asn Ala Asp Pro Thr Trp Glu Gln Leu Thr Asn Gly Ser
355 360 365
Gly Leu His Tyr Leu Asp Ala Val Val His Glu Ile Leu Arg Leu His
370 375 380
Ala Pro Leu Asn Val Thr Thr Arg Val Ala Ala Lys Asp Asp Val Ile
385 390 395 400
Pro Leu Ser Thr Pro Leu Arg Leu Pro Thr Gly Glu Leu Thr Asp His
405 410 415
Val Ala Ile Thr Glu Gly Gln Glu Val Thr Val Pro Ile Ser Cys Met
420 425 430
Asn Thr Ala Val Ala Phe Trp Gly Pro Asp Ala Arg Glu Phe Arg Pro
435 440 445
Glu Arg Trp Leu Asn Glu Asp Gly Leu Pro Lys Lys Ala Gln Glu Ile
450 455 460
Gln Gly His Arg His Leu Leu Thr Phe Val Asp Gly His Arg Ile Cys
465 470 475 480
Leu Gly Arg Gly Phe Ala Leu Ala Glu Phe Lys Ala Val Leu Gly Val
485 490 495
Leu Ile Lys Asn Tyr Gln Phe Glu Leu Pro Asp Gly Pro Glu Thr Lys
500 505 510
Ile Glu Phe Cys Arg Gly Val Leu Pro Arg Pro Arg Val Val Gly Glu
515 520 525
Lys Gly Ala Asn Leu Pro Met Arg Val Arg Arg Ala Asp
530 535 540
<210> 3
<211> 1515
<212> DNA
<213> P450 Gene GL21117 (Artificial Sequence)
<400> 3
atggcgacgt tggaggaccc tcaggcgctc atcctcgctg gtgtcgcgac cctagtcgca 60
atatggatag tacgatggaa gaccaaccca ctaagttcga ttcccaccgt cggtggatcg 120
gatgcgccag ggctgtcgat attggcatgg ctcaacttct tgcgccgcgg gaaggacttg 180
ctccaggagg gttaccaaaa gtatcatggc tcgacgttca agatcgctct tttcgaccaa 240
tggcttgttg tgttttccgg gtccaatatg gtcgacgagc ttatgaggcg gcccgatagt 300
gagttatcgt tcttggaggg cattgaagaa gtagtccaca tgaagtacac tgtcgggcac 360
gaagccttgg gcgacccgta ccacgtcggg attatcaaag agaagcttac gcgcatgctt 420
cctaccgttc tcccggactt gaccgaagag ttggcgatat ccgtgcaaga atacatcccc 480
acccaaggcg acgaatggac cgccgtgaat gtgatgacga cgatgcaaaa gatcgtcgcc 540
agggccagca accgtgtctt cgtcggactt ccactttgtc gcaatgagga gtttttggca 600
ttgccccttc gcttcacgtt ggatgtgatg aaagacatgg tagtcatgag catcactccg 660
gacattttga agaggcccgt tggtcatctg gttagcaacg caaggcggac tatggcgcaa 720
gccatgaagt atatccaacc tgtgatcgcc gagaggaagg cgaacatgaa ggacttgggt 780
gaggactggt ccgacaagcc gaatgacgtg cttcagtggg tcatcgacga agccgtccgc 840
cggaaccact ccgacgtcag cgtcgtcgag cgaatattcc tcgtcaactt tgcagccatc 900
cacacctcct ccaccaacat gacccatgtg ctttacgacc tggcctcaag accggagtgt 960
attcaaccac tccgagagga gatcgaaggt atcgtcgcaa cagacggttg gagcaagtca 1020
gccattgcca agatgtggaa gcttgacagc ctgttcaggg agtcttcgcg gtaccacggg 1080
atctccctca ttggcctgat gcgcaagtcc gtgaaagaca tcaccctcag cgacgggacg 1140
ttcatcccga agggcaccgt gctcgcgact gctgcgcggc cgatgcacca cgacggctcg 1200
aaatacgcca acgcggacgt gctcgacccg ttccgcttcg agaggatgcg gcacggcgag 1260
ggcgagggcc tgaagcacca gttcgtcaac acttccaacg acttcgtctc cttcggccac 1320
ggcaagcacg catgcccggg acggttcttc gcggcgagcg agctgaaggc gctgctcgcg 1380
tacatcctca tcaactacga tatcaagctt gggggggacg gcacccggcc ggcgaacttt 1440
tactatggca cgaacgtcgt cccgtctgtc accggacagg tgctgttcag gaaacggcat 1500
gcgcaggctt cttga 1515
<210> 4
<211> 504
<212> PRT
<213> P450 Gene GL21117 (Artificial Sequence)
<400> 4
Met Ala Thr Leu Glu Asp Pro Gln Ala Leu Ile Leu Ala Gly Val Ala
1 5 10 15
Thr Leu Val Ala Ile Trp Ile Val Arg Trp Lys Thr Asn Pro Leu Ser
20 25 30
Ser Ile Pro Thr Val Gly Gly Ser Asp Ala Pro Gly Leu Ser Ile Leu
35 40 45
Ala Trp Leu Asn Phe Leu Arg Arg Gly Lys Asp Leu Leu Gln Glu Gly
50 55 60
Tyr Gln Lys Tyr His Gly Ser Thr Phe Lys Ile Ala Leu Phe Asp Gln
65 70 75 80
Trp Leu Val Val Phe Ser Gly Ser Asn Met Val Asp Glu Leu Met Arg
85 90 95
Arg Pro Asp Ser Glu Leu Ser Phe Leu Glu Gly Ile Glu Glu Val Val
100 105 110
His Met Lys Tyr Thr Val Gly His Glu Ala Leu Gly Asp Pro Tyr His
115 120 125
Val Gly Ile Ile Lys Glu Lys Leu Thr Arg Met Leu Pro Thr Val Leu
130 135 140
Pro Asp Leu Thr Glu Glu Leu Ala Ile Ser Val Gln Glu Tyr Ile Pro
145 150 155 160
Thr Gln Gly Asp Glu Trp Thr Ala Val Asn Val Met Thr Thr Met Gln
165 170 175
Lys Ile Val Ala Arg Ala Ser Asn Arg Val Phe Val Gly Leu Pro Leu
180 185 190
Cys Arg Asn Glu Glu Phe Leu Ala Leu Pro Leu Arg Phe Thr Leu Asp
195 200 205
Val Met Lys Asp Met Val Val Met Ser Ile Thr Pro Asp Ile Leu Lys
210 215 220
Arg Pro Val Gly His Leu Val Ser Asn Ala Arg Arg Thr Met Ala Gln
225 230 235 240
Ala Met Lys Tyr Ile Gln Pro Val Ile Ala Glu Arg Lys Ala Asn Met
245 250 255
Lys Asp Leu Gly Glu Asp Trp Ser Asp Lys Pro Asn Asp Val Leu Gln
260 265 270
Trp Val Ile Asp Glu Ala Val Arg Arg Asn His Ser Asp Val Ser Val
275 280 285
Val Glu Arg Ile Phe Leu Val Asn Phe Ala Ala Ile His Thr Ser Ser
290 295 300
Thr Asn Met Thr His Val Leu Tyr Asp Leu Ala Ser Arg Pro Glu Cys
305 310 315 320
Ile Gln Pro Leu Arg Glu Glu Ile Glu Gly Ile Val Ala Thr Asp Gly
325 330 335
Trp Ser Lys Ser Ala Ile Ala Lys Met Trp Lys Leu Asp Ser Leu Phe
340 345 350
Arg Glu Ser Ser Arg Tyr His Gly Ile Ser Leu Ile Gly Leu Met Arg
355 360 365
Lys Ser Val Lys Asp Ile Thr Leu Ser Asp Gly Thr Phe Ile Pro Lys
370 375 380
Gly Thr Val Leu Ala Thr Ala Ala Arg Pro Met His His Asp Gly Ser
385 390 395 400
Lys Tyr Ala Asn Ala Asp Val Leu Asp Pro Phe Arg Phe Glu Arg Met
405 410 415
Arg His Gly Glu Gly Glu Gly Leu Lys His Gln Phe Val Asn Thr Ser
420 425 430
Asn Asp Phe Val Ser Phe Gly His Gly Lys His Ala Cys Pro Gly Arg
435 440 445
Phe Phe Ala Ala Ser Glu Leu Lys Ala Leu Leu Ala Tyr Ile Leu Ile
450 455 460
Asn Tyr Asp Ile Lys Leu Gly Gly Asp Gly Thr Arg Pro Ala Asn Phe
465 470 475 480
Tyr Tyr Gly Thr Asn Val Val Pro Ser Val Thr Gly Gln Val Leu Phe
485 490 495
Arg Lys Arg His Ala Gln Ala Ser
500
<210> 5
<211> 40
<212> DNA
<213> HF-CYP5150L8-F(Artificial Sequence)
<400> 5
ggcaaaggaa taatctcgag tcatgtaatt agttatgtca 40
<210> 6
<211> 40
<212> DNA
<213> HF-CYP5150L8-R(Artificial Sequence)
<400> 6
cgagcggtct aaggcggttt acttctcgta ggaacaattt 40
<210> 7
<211> 20
<212> DNA
<213> HF-CYP5150L8-CX-F(Artificial Sequence)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> HF-CYP5150L8-CX-R(Artificial Sequence)
<400> 8
acatcaaaat ccacattctc 20
<210> 9
<211> 40
<212> DNA
<213> GL21117-F(Artificial Sequence)
<400> 9
taattttaat caaaaagttt atggcgacgt tggaggaccc 40
<210> 10
<211> 40
<212> DNA
<213> GL21117-R(Artificial Sequence)
<400> 10
attaatttga attaacgttt tcaagaagcc tgcgcatgcc 40
<210> 11
<211> 20
<212> DNA
<213> P450-CX-F(Artificial Sequence)
<400> 11
gccaatactt cacaatgttc 20
<210> 12
<211> 20
<212> DNA
<213> P450-CX-R(Artificial Sequence)
<400> 12
tcattttgtc attgaccttc 20
<210> 13
<211> 26
<212> DNA
<213> P1-F(Artificial Sequence)
<400> 13
tttgtttgtt tatgtgtgtt tattcg 26
<210> 14
<211> 20
<212> DNA
<213> P1-R(Artificial Sequence)
<400> 14
<210> 15
<211> 20
<212> DNA
<213> P2-F(Artificial Sequence)
<400> 15
<210> 16
<211> 20
<212> DNA
<213> P2-R(Artificial Sequence)
<400> 16
<210> 17
<211> 20
<212> DNA
<213> P3-F(Artificial Sequence)
<400> 17
<210> 18
<211> 23
<212> DNA
<213> P3-R(Artificial Sequence)
<400> 18
ggagattgat aagacttttc tag 23
<210> 19
<211> 38
<212> DNA
<213> A9-GL20421-F(Artificial Sequence)
<400> 19
gaaaagtctt atcaatctcc tcagtctgca cgacgcac 38
<210> 20
<211> 40
<212> DNA
<213> A9-GL20421-R(Artificial Sequence)
<400> 20
aacacacata aacaaacaaa atgatcatcc cagtagacat 40
<210> 21
<211> 20
<212> DNA
<213> P1-P2-FP(Artificial Sequence)
<400> 21
<210> 22
<211> 21
<212> DNA
<213> P2-P3-FP(Artificial Sequence)
<400> 22
gttgagtgtt gttccagttt g 21
<210> 23
<211> 20
<212> DNA
<213> P3-P4-FP(Artificial Sequence)
<400> 23
atgtgatttc gaccattgac 20
<210> 24
<211> 20
<212> DNA
<213> P1-P4-RP(Artificial Sequence)
<400> 24
Claims (6)
1. A ganoderma triterpene is characterized by comprising the following components: 3, 15-dihydroxy-lanosta-8, 24-dienyl-26-oic acid (15-hydroxy-nonderic acid HLDOA), ganoderic acid Y (Ganoderic acid Y), 3,15, 30-trihydroxy-lanosta-8, 24-dienyl-26-oic acid (15, 30-dihydroxy-nonderic acid HLDOA), 7-oxo-3, 15-dihydroxy-lanosta-8, 24-dienyl-26-oic acid (7-oxo-15-hydroxy-nonderic acid HLDOA) and 24,25-dialkyl-3, 30-dihydroxy-lanosta-8-enyl-26-oic acid (24, 25-dihydroxy-30-hydroxy-nonderic acid HLDOA) having the following structural formula:
2. a method for preparing the ganoderma triterpene of claim 1, comprising: the method comprises the steps of catalyzing novel ganoderma lucidum triterpene formed by Ganoderic acid HLDOA through P450 gene GL21117 or catalyzing novel ganoderma lucidum triterpene formed by Ganoderic acid HLDOA through P450 gene GL21117 and P450 gene GL21117, respectively or jointly cloning two P450 genes GL20421 and GL21117 into saccharomyces cerevisiae overexpression plasmids, respectively transforming the saccharomyces cerevisiae overexpression plasmids into recombinant transformed microorganism saccharomyces cerevisiae for heterologous expression, and fermenting the transformed strain;
the nucleotide sequence of the P450 gene GL20421 is shown as Seq ID No.1, and the amino acid sequence thereof is shown as Seq ID No. 2; the nucleotide sequence of the P450 gene GL21117 is shown as Seq ID No.3, and the amino acid sequence thereof is shown as Seq ID No. 4.
3. The method of claim 2, comprising any one of:
a) Transferring a saccharomyces cerevisiae expression plasmid pRS426HF-GL21117-G418r into saccharomyces cerevisiae YL-T3 to form a recombined and transformed saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117, and transferring yeast expression plasmids pRS426HF-G418r and pRS425-CYP5150L8-iGLCPR-Hygr into the saccharomyces cerevisiae YL-T3 to form a corresponding saccharomyces cerevisiae strain YL-T3-CYP5150L8-iGLCPR-GL21117 for over-expressing the GL21117; fermenting the constructed saccharomyces cerevisiae overexpression strain YL-T3-CYP5150L8-iGLCPR-GL21117 to obtain the ganoderma triterpenoids from the fermentation product;
b) Transferring the Saccharomyces cerevisiae expression plasmids pRS426HF-GL21117-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr into Saccharomyces cerevisiae YL-T3 to form a recombined and transformed Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117; yeast expression plasmids pRS426HF-G418r and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr are transferred into Saccharomyces cerevisiae YL-T3 to form a corresponding Saccharomyces cerevisiae strain YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117 overexpressing GL21117 and GL 20421; fermenting constructed saccharomyces cerevisiae overexpression strains YL-T3-CYP5150L8-iGLCPR-GL21117 and YL-T3-GL20421-CYP5150L8-iGLCPR-GL21117, and obtaining the ganoderma triterpenes from fermentation products.
4. The method of claim 2, wherein the Saccharomyces cerevisiae overexpression plasmid comprises: pRS426HF-GL21117-G418r, pRS425-CYP5150L8-iGLCPR-Hygr and pRS425-GL20421-CYP5150L8-iGLCPR-Hygr.
5. The method as claimed in claim 2, wherein the Saccharomyces cerevisiae overexpression plasmid is PCR amplified to obtain the sequence fragments of the coding regions of the P450 genes GL20421, GL21117 and CYP5150L8, and then recombinant expression of the expression vectors pRS426, GL21117, yeast HXT7P promoter, yeast FBA1t terminator and KanMX gene expression cassette containing the truncated promoter Ura3 (tP-Ura 3) are ligated by homologous recombination or the like to obtain the corresponding recombinant overexpression plasmid pRS426HF-GL21117-G418r, and recombinant expression of the coding regions of the expression vectors pRS425 and CYP5150L8, yeast HXT7P promoter, yeast FBA1t terminator, GLiCPR expression cassette and HygromycinB gene expression cassette containing the truncated promoter Ura3 (tP-Ura 3) are ligated to obtain the corresponding recombinant overexpression plasmid pRS425-CYP 50L 8-iCPR-GLiCPR expression cassette, and the expression of the corresponding recombinant overexpression plasmid pRS425-CYP 50L 8-iCPR-GLiCPR expression cassette is ligated with the Hygromycin B gene expression cassette containing the truncated promoter GL 425, the cDNA of the CYP5150L 425, the cDNA sequence of the CYP5150, the recombinant overexpression plasmid pRS425, the CYP 5150-RG 26-CYP 5150L8, the recombinant expression vector is transfected by homologous recombination.
6. The method as claimed in claim 3, wherein the Saccharomyces cerevisiae YL-T3 is genetically engineered BY4742 strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111000127.XA CN115725633A (en) | 2021-08-27 | 2021-08-27 | Cytochrome P450 function research and application in ganoderma triterpene synthesis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111000127.XA CN115725633A (en) | 2021-08-27 | 2021-08-27 | Cytochrome P450 function research and application in ganoderma triterpene synthesis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115725633A true CN115725633A (en) | 2023-03-03 |
Family
ID=85290628
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111000127.XA Pending CN115725633A (en) | 2021-08-27 | 2021-08-27 | Cytochrome P450 function research and application in ganoderma triterpene synthesis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115725633A (en) |
-
2021
- 2021-08-27 CN CN202111000127.XA patent/CN115725633A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102652526B1 (en) | Method for producing taurourusodeoxycholic acid by bioconversion and its application | |
| CN115197172B (en) | Sesterterpene compound, synthetic gene cluster and synthetic method thereof | |
| CN114150012B (en) | Recombinant saccharomyces cerevisiae for heterogeneously synthesizing ginsenoside F2 and construction method thereof | |
| CN108929884B (en) | Method for heterogeneously biosynthesizing ganoderic acid by synthetic biological means | |
| CN116987603A (en) | Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof | |
| WO2021088370A1 (en) | Highly efficient and controllable expression system for endogenous piggybacking exogeneous genes | |
| CN115109787B (en) | Glycosyltransferase gene and application thereof in preparation of pseudo-ginseng/ginsenoside | |
| CN111235044B (en) | Recombinant saccharomyces cerevisiae strain for synthesizing delta-tocotrienol, construction method and application | |
| CN113444737B (en) | Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoid | |
| CN107345232B (en) | Glucosyltransferase genes capable of participating in post-biosynthetic conversion modification | |
| CN110713941A (en) | High-expression cytochrome P450 monooxygenase aspergillus ochraceus strain as well as construction method and application thereof | |
| CN115725633A (en) | Cytochrome P450 function research and application in ganoderma triterpene synthesis | |
| CN113956990B (en) | Recombinant saccharomyces cerevisiae for producing dihydronilotinib as well as preparation method and application thereof | |
| CN110684795A (en) | Construction method of monascus purpureus comp50904_ c4 gene overexpression strain | |
| CN115161208B (en) | Saccharomyces cerevisiae genetically engineered bacterium and application thereof in production of cucurbitacin intermediate | |
| CN113402357A (en) | 5-12-5 tricyclic sesterterpene skeleton compounds and preparation thereof | |
| CN115772507A (en) | Application of cytochrome P450 enzyme in synthesis of ganoderma triterpene | |
| CN111363753B (en) | Method for the heterologous production of linear triterpenes | |
| CN114657155A (en) | Novel resolution expression method of non-ribosomal polypeptide synthetase | |
| CN112646834A (en) | Lupeol derivative and synthesis method and application thereof | |
| CN114990086B (en) | Enzyme composition and application thereof | |
| CN114807211B (en) | Recombinant saccharomyces cerevisiae for producing ginsenoside CK by metabolizing glycerol and construction method | |
| CN114196641B (en) | Steroid C14 alpha hydroxylase, expression vector, engineering bacteria and application thereof | |
| CN117143928A (en) | Method for preparing cannabidiol by two-step method | |
| CN116814672A (en) | Saccharomyces cerevisiae engineering strain for producing beta-elemene and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |