CN115725602A - Peanut AhBADH1 gene and application thereof - Google Patents

Abstract

The invention discloses a peanut AhBADH1 gene and application thereof, belonging to the technical field of genetic engineering. The AhBADH1 gene has a sequence shown in SEQ ID NO. 1 and is obtained by separating from peanuts; the gene can improve the salt tolerance of plants in the germination stage and seedling stage, and plays a role in the synthesis regulation of betaine and proline; the contents of proline and betaine in a plant transformed with the AhBADH1 gene can be rapidly increased under the condition of salt stress, so that the damage of the salt stress to the plant can be effectively relieved. Therefore, the AhBADH1 gene has potential application value in the aspect of plant salt tolerance.

Description

Peanut AhBADH1 gene and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a peanut AhBADH1 gene and application thereof.

Background

Salt stress can form high osmotic potential and ion toxicity (Na) around seeds ⁺ And Cl ^- ) Leading to the weakening of seed vitality, reduction of germination, prolonging of germination time and even complete inhibition. The technical problem is usually faced when crops are planted in saline-alkali soil. The stress resistance of crop varieties is improved through stress-resistant breeding and genetic transformation technologies, and the two effective ways of relieving salt stress and improving the rate of emergence are provided at present. However, the traditional conventional crossbreeding has long period, low efficiency and slow development; although mutation frequency is greatly improved in mutation breeding, beneficial mutation frequency is low, mutation direction is difficult to master, and chemical mutagens are high in toxicity and have a residual effect. The genetic transformation has directional high efficiency in improving the quality of crops, but the existing salt-tolerant gene is little mined, and the transgenic achievement is low; therefore, the development of new stress resistance genes can provide gene resources and technical support for directionally improving the crop emergence and the stress resistance character by utilizing a transgenic technology.

Disclosure of Invention

The AhBADH1 gene is separated from peanuts, the CDS sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2. The gene is proved to be capable of improving the salt tolerance of the plant in the germination stage and the seedling stage and plays a role in the synthesis regulation of betaine and proline, and based on the content, the invention provides the following technical scheme:

application of AhBADH1 gene in improving salt tolerance of plants.

In the application, the AhBADH1 gene can be prepared into a recombinant expression vector, an expression cassette, a transgenic cell line, a recombinant bacterium or a recombinant virus for improving the salt tolerance of plants.

A method for improving salt tolerance of a plant comprises the steps of constructing the AhBADH1 gene into an expression vector to form a recombinant expression vector, transforming the recombinant expression vector into a strain to obtain a recombinant strain carrying the AhBADH1 gene, infecting the recombinant strain into a plant leaf to enable the plant to carry the AhBADH1 gene, and finally regulating and controlling the salt tolerance of the plant through the expression of the AhBADH1 gene. By the method, the transgenic plant with the tolerance degree under salt stress larger than that of the wild type of the target plant can be finally obtained.

The recombinant expression vector may include, but is not limited to, the following cloning vectors in addition to the AhBADH1 gene: binary agrobacterium vector and vector for plant micro-bullet bombardment; for example, pROKII, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Co., ltd.), etc.;

the recombinant expression vector may further comprise a 3' untranslated region of a foreign gene, i.e., a polyadenylation signal and any other DNA segment involved in mRNA processing or gene expression. The poly A signal can lead poly A to be added to the 3 'end of mRNA precursor, such as the untranslated region transcribed at the 3' end of Agrobacterium crown gall inducing (Ti) plasmid gene (such as nopaline synthase Nos gene) and plant gene (such as soybean storage protein gene) have similar functions;

when the AhBADH1 gene is used for constructing a recombinant expression vector, any enhanced promoter, such as a cauliflower mosaic virus (CAMV) 35S promoter, a maize Ubiquitin promoter (Ubiquitin) and a constitutive promoter, can be added in front of a transcription initiation nucleotide; or a tissue-specific expression promoter, such as a seed-specific expression promoter; or an inducible promoter; they can be used alone or in combination with other plant promoters;

in addition, when the AhBADH1 gene is used to construct a recombinant expression vector, enhancers, including translational enhancer or transcription enhancer, can be used, and these enhancer regions can be ATG initiation codon or adjacent region initiation codon, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the whole sequence;

the sources of the above translational control signals and initiation codons are wide ranging from natural to synthetic; the translation initiation region may be from a transcription initiation region or a structural gene; in order to facilitate identification and selection of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound which can produce a color change (a selectable marker gene such as GUS gene, luciferase gene, etc.), a marker gene for antibiotics (e.g., nptII gene which confers resistance to kanamycin and related antibiotics, bar gene which confers resistance to phosphinothricin which is a herbicide, hph gene which confers resistance to hygromycin which is an antibiotic, dhfr gene which confers resistance to methatrexate, EPSPS gene which confers resistance to glyphosate) which can be expressed in plants, or a marker gene for chemical resistance (e.g., herbicide resistance), mannose-6-phosphate isomerase gene which provides the ability to metabolize mannose. If the safety of the transgenic plant is considered, the transformed plant can be directly screened by the phenotypic character without adding any selective marker gene.

The plant expression vector carrying the AhBADH1 gene of the present invention can be used to transform plant cells or tissues by using conventional biological methods such as Ti plasmid, ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation, etc., and the transformed plant tissues can be cultivated into plants. The transformed plant host can be monocotyledons such as wheat, corn and rice, and can also be dicotyledons such as tobacco, arabidopsis, soybean, rape, poplar and alfalfa.

The above-mentioned strain for infecting a plant may be selected from Agrobacterium tumefaciens (e.g., GV3101, LBA4404 and EHA 105), agrobacterium rhizogenes and the like.

Specifically, the AhBADH1 gene is used for improving the salt tolerance of the plant in the germination period. Further, under the salt stress, the plants transformed with AhBADH1 gene have the characteristics of faster germination speed, higher germination rate and the like compared with wild type in the germination period.

Specifically, the AhBADH1 gene is used for improving the salt tolerance of the plant in the seedling stage. Further, under the salt stress, the plants transformed with AhBADH1 gene have the characteristics of longer root length, higher fresh weight, better growth, more salt stress resistance and the like compared with wild type in seedling stage.

The invention also provides application of the AhBADH1 gene in regulating and controlling betaine synthesis in plants. Further, the expression level of betaine in a plant transformed with the AhBADH1 gene under salt stress is obviously increased compared with that of a wild type.

The invention also provides application of the AhBADH1 gene in regulation and control of proline synthesis in plants. Further, the term "control" means that the expression level of proline in a plant transformed with the AhBADH1 gene is significantly increased compared with that of a wild type plant under salt stress.

In further studies, we found that under normal conditions, betaine did not affect seed germination, but under salt stress conditions, betaine was able to increase seed germination. Based on the above, the invention provides an application of betaine in improving the germination rate of plant seeds under salt stress. Specifically, the concentration of betaine is selected from 0 to 15mM, preferably 10mM.

The invention has the beneficial effects that:

in a salt stress response test, the AhBADH1 gene obtained by separating peanuts can improve the salt tolerance of the plants in the germination period and the seedling period, plays a role in synthesis regulation of betaine and proline, is transformed into the plants with the AhBADH1 gene, and the contents of the proline and the betaine in the plants can be rapidly increased under the salt stress, so that the damage of the salt stress to the plants can be effectively relieved. The invention aims to provide gene resources for directionally improving the seedling emergence and the stress resistance of crops by utilizing a transgenic technology.

Drawings

FIG. 1 is a diagram of vector construction; wherein, the band in the graph A is a schematic diagram of a cloned target gene AhBADH1, and the size is 1512bp; FIG. B is a schematic diagram showing the restriction enzyme digestion result of a positive cloning plasmid obtained by connecting a target gene with a pMD19-T1simple cloning vector; FIG. C is a schematic diagram showing the digestion result of a plasmid in which a target gene is linked to a pBI121 expression vector;

FIG. 2 is the identification of positive seedlings of transgenic lines; wherein, lane 1 is wild type WT, and the rest lanes are transgenic lines;

FIG. 3 is the germination phase phenotype; wherein, panel A is a phenotype diagram of transgenic line 35S and wild type WT growing for 10d on different NaCl concentration culture dishes; FIG. B is a statistical graph of germination rates corresponding to FIG. A;

FIG. 4 shows the seedling phenotype; wherein, panel A is a phenotype diagram of the germination of the transgenic strain 35S AhBADH1 and wild type WT on different NaCl concentration culture dishes for 21 d; FIG. B is a root length histogram corresponding to FIG. A; FIG. C is a fresh weight statistical chart corresponding to FIG. A;

FIG. 5 is a graph of betaine and proline content; wherein, the graph A shows the betaine content of the 21d transgenic line 35S; FIG. B shows proline content at different NaCl concentrations for 21d transgenic line 35S;

FIG. 6 is a graph of the effect of exogenous betaine on peanut seed germination under salt stress; wherein, the graph A shows the germination rate of peanut seeds under 0mM NaCl by applying exogenous betaine with different concentrations; FIG. B is the germination rate of peanut seeds at 50mM NaCl after exogenous application of various concentrations of betaine; graph C shows the germination rate of peanut seeds applied with different concentrations of betaine from an external source under 100mM NaCl; panel D shows the germination rate of peanut seeds at 150mM NaCl when exogenous betaine was applied at different concentrations.

Detailed Description

The invention takes peanut seeds (Tifrunner variety) as experimental materials, switches in from transcriptomics analysis, searches key regulating factors responding to high salt stress, and identifies 256 differential genes in total. Wherein, arachis hygaea Betaine Aldehyde Dehydrogenase 1 (key enzyme for synthesizing Betaine) is coded by Arahy.59SDUF gene and is obviously up-regulated by 50 times under the induction of salt. The invention is named AhBADH1. Finding the AhBADH1 gene from a peanut genomic database website Peanutbase, wherein the CDS sequence of the gene is 1512bp and is shown as SEQ ID NO: 1; the dehydrogenase with 503 amino acids is coded, and the amino acid sequence is shown as SEQ ID NO. 2.

SEQ ID NO:1：

5'-ATGGCGATCTCAACACCAAGAAGAGAGCTCTTCATAGATGGAGAGTGGAAAGCCCCTCTCCTCAACAACCGAATTCCAATCATCAACCCTTCCACTGAACTCATCATAGGGGATATCCCAGCAGCTACTAAGGAAGATGTGGAACTTGCGGTGGATGCTGCAAGAAGAGCACTGTCTCGGAACAAGGGAAAAGATTGGTCAACGGCTTCTGGCTCTCTTCGTGCTACATATCTTAGAGCCATTGCTGCAAAGATAACGGAGAAAAAGGATGAGCTTGCAAAGCTTGAAGCTACTGATAATGGGAAACCGCTTGATGAAGCAGCAGCCGACATGGATGATGTTATTGGTTGTTTTAGCTACTATGCTGAACTTGCTGAAGGGTTGGATGCAAAGCAAAAGGCACATGTGTCTCTTCCTATGGAGAACTTCAAGAGTTATGTGATCAAGGAGCCAATTGGTGTTGTTGCGTTGATTACTCCATGGAACTATCCATTGCTAATGGCGGCATGGAAAGTTGGTGCTGCTCTGGCTGCTGGTTGTACTGCAGTATTGAAGCCATCTGAACTGGCATCTGTGACATGTTTGGAGTTGGCCGAAATATGCAAAGAAGTAGGTCTTCCAGCAGGGGTGTTAAACGTGATCACTGGATTAGGCACTGAAGCCGGGGCTCCTTTGGCTTCACATCCTGATGTAGACAAGATATCCTTTACTGGAAGTTCTGCAACTGGAAGCAAAATTATGCAAGCTGCAGCTCTGCAAGTCAAGCCTGTTTCACTAGAGCTTGGTGGAAAAAGTCCAATTATTGTTTTTGACGATGTTGACATTGATAAGGTTGCTGAATGGACCATGCTGGGCTGTTTCTTTACCAATGGTCAGATATGTAGTGCAACATCTCGGCTTATTGTCCATGAAAATATAGCAACAAAGTTTTTGAATAGGCTTGTGGAATGGGCTAAAAACATCAAAGTTTCAGATCCCTTGGAAGATGGTTGCAAATTAGGCGCCATTGTTAGCGAAGCTCAGTATCAAAAAGTTCTCAAGTTTATTTCAACTGCTAAGAGTGAGGGTGCAACAATTTTGACCGGAGGGTCTCGCCCTGAGAATTTAAAGAAGGGTTACTTTGTTGAACCAACCATTATAACTGATGTGAGTACCTCAATGCAAATTTGGAGAGAGGAAGTTTTTGGACCTGTGCTCTGTGCCAAAACATTTAGCAGTGAGGAAGAAGCCATTGAACTAGCAAATGATACCCACTATGGCTTAGGGTCAGCTGTGATGTCAAATGATCCAGAAAGATGTGAGCGGATATCCAAGGCTGTTCAGGCTGGAATTGTATGGATCAACTGTTCTCAACCAACTTTCATTCAAGCCCCATGGGGTGGCATTAAACGTAGTGGGTTTGGTCGCGAATTAGGAGAATGGGGACTTGATAATTTCCTGAGTGTGAAGCAAGTCACAAAGTATATTTCTGATGAACAGTGGGGCTGGTATAAGTGTCCTTCAAAGATGTAA-3'

SEQ ID NO:2：

MAISTPRRELFIDGEWKAPLLNNRIPIINPSTELIIGDIPAATKEDVELAVDAARRALSRNKGKDWSTASGSLRATYLRAIAAKITEKKDELAKLEATDNGKPLDEAAADMDDVIGCFSYYAELAEGLDAKQKAHVSLPMENFKSYVIKEPIGVVALITPWNYPLLMAAWKVGAALAAGCTAVLKPSELASVTCLELAEICKEVGLPAGVLNVITGLGTEAGAPLASHPDVDKISFTGSSATGSKIMQAAALQVKPVSLELGGKSPIIVFDDVDIDKVAEWTMLGCFFTNGQICSATSRLIVHENIATKFLNRLVEWAKNIKVSDPLEDGCKLGAIVSEAQYQKVLKFISTAKSEGATILTGGSRPENLKKGYFVEPTIITDVSTSMQIWREEVFGPVLCAKTFSSEEEAIELANDTHYGLGSAVMSNDPERCERISKAVQAGIVWINCSQPTFIQAPWGGIKRSGFGRELGEWGLDNFLSVKQVTKYISDEQWGWYKCPSKM

The method for constructing the arabidopsis transgenic line by using the AhBADH1 gene comprises the following steps:

(I) construction of recombinant expression vectors

Primers were designed based on the CDS sequence of the peanut AhBADH1 gene, and the sequences of the primers are as follows:

upstream primer 5-GGTACCATGGCGATCTCAACACCAAGAAGAG-3'(SEQ ID NO:3)；

Downstream primer 5-GTCGACTTACATCTTTGAAGGACACTTATACCAGCC-3'(SEQ ID NO:4)。

In the above primer sequences, the underlined position is the restriction site, the restriction site of the upstream primer is BamHI, and the restriction site of the downstream primer is SalI.

1. Extraction of RNA

Taking 0.1g of fresh peanut tissue material, fully grinding the fresh peanut tissue material into powder in liquid nitrogen, adding 450 mu LRL (beta-mercaptoethanol needs to be added in advance), carrying out vortex oscillation and uniform mixing, and standing for 1-3 min at room temperature. Transferring the solution to a filter column CS (the filter column CS is placed in a collecting tube), centrifuging at 12000rpm for 2-5 min, carefully sucking the supernatant in the collecting tube into an RNase-Free centrifuge tube, and preventing the suction head from contacting with the cell debris sediment in the collecting tube as much as possible. Slowly adding absolute ethyl alcohol with the volume of 0.5 time of the supernatant, uniformly mixing, transferring all the solution into an adsorption column CR3, centrifuging at 12000rpm for 30-60s, pouring off waste liquid in the collecting pipe, and putting the adsorption column CR3 back into the collecting pipe. 350 mu L of deproteinized liquid RW1 is added into the adsorption column CR3, centrifugation is carried out at 12000rpm for 30-60s, waste liquid in the collection tube is poured out, and the adsorption column CR3 is placed back into the collection tube. Add 80. Mu.L of DNase I working solution to the center of the adsorption column CR3, and leave it at room temperature for 15min. 350 mu L of deproteinized liquid RW1 is added into the adsorption column CR3, centrifugation is carried out at 12000rpm for 30-60s, waste liquid in the collection tube is poured out, and the adsorption column CR3 is placed back into the collection tube. Adding 500 μ L of rinsing solution RW (ethanol is required to be added in advance) into the adsorption column CR3, standing at room temperature for 2min, centrifuging at 12000rpm for 30-60s, pouring out waste liquid in the collection tube, and placing the adsorption column CR3 into the collection tube. Repeating the steps once. Centrifuging at 12000rpm for 2min, and discarding waste liquid. And placing the adsorption column CR3 at room temperature for 5-10 min to thoroughly dry the residual rinsing liquid in the adsorption material. The adsorption column CR3 is put into a new RNase-Free centrifuge tube, and 50 mu LRNase-Free ddH is suspended and dripped into the middle part of the adsorption membrane ₂ Placing at 37 ℃ for 2min, and centrifuging at 12000rpm for 2min to obtain RNA extract.

2. Synthesis of reverse transcribed cDNA first Strand

Determination of RNA concentration followed by Novonoprazan

III All-in-one RT Supermix Perfect for qPCR reverse transcription. Mu.l of 5 xAll-in-one qRT SuperMix and 1. Mu.l Enzyme Mix were added to 1. Mu.g of total RNA, and water was replenished to 20. Mu.l, reacted at 50 ℃ for 15min, and inactivated at 85 ℃ for 5s.

3. Cloning of AhBADH1 Gene

Use of nunoprazan

Max Super-Fidelity DNA Polymerase high Fidelity enzyme is used for amplification, and the reaction system is as follows: 25. Mu.L of 2 XPhanta Max Buffer, 1. Mu.L of dNTP Mix (10 mM each), 2. Mu.L of the forward primer, 2. Mu.L of the reverse primer, 1. Mu.L of LPhanta Max Super-Fidelity DNA Polymerase, 1. Mu.L of cDNA template, and water to 50. Mu.L.

The reaction procedure is as follows: pre-denaturation at 95 ℃ for 3min; denaturation at 95 ℃ for 15s, annealing at 55 ℃ for 15s, and extension at 72 ℃ for 1min for 35 cycles; stretching for 5min at 72 ℃.

After the reaction, agarose gel electrophoresis was performed, and after the band of interest was detected, as shown in FIG. 1A, the gel was cut and recovered according to the general agarose gel DNA recovery kit (DP 209) from Tiangen corporation. The end of the product of high fidelity enzyme amplification is a flat end, and a tailing reaction is needed to be carried out, wherein the reaction system is as follows: mu.L of 10 × reaction buffer, 1.2. Mu.L dNTP, 0.15. Mu.L Taq enzyme, and 15. Mu.L gel recovery product. The reaction was carried out at 72 ℃ for 30min. The sequence was performed by Limited Biotechnology (Shanghai) Inc.

4. Obtaining of Positive plasmids

mu.L of the above-mentioned tailed product was ligated with pMD19-T simple cloning vector overnight at 16 ℃ and transformed into E.coli DH 5. Alpha. Strain by heat shock method and grown overnight on LB plate containing ampicillin. Selecting white single colonies to LB culture solution, culturing for 4-6 h at 37 ℃, then carrying out PCR on the bacterial solution, and selecting positive colonies to stay overnight in the LB liquid culture medium. Plasmid DNA was extracted using a Tiangen plasmid miniextract kit to obtain AhBADH1-pMD19-T simple vector plasmid.

5. Construction of expression vectors

The AhBADH1-pMD19-T simple and pBI121 empty vector with 35S were digested with BamHI and SalI, digested at 37 ℃ for 1h, subjected to agarose gel electrophoresis, and the correct band was excised and recovered as shown in FIG. 1B. Ligation was performed overnight using T4DNA ligase from Thermo, and the ligation product was transformed into DH 5. Alpha. Strain and grown overnight on LB plate containing kanamycin. Selecting white single colonies to LB culture solution, culturing for 4-6 h at 37 ℃, then carrying out PCR on the bacterial solution, and selecting positive colonies to stay overnight in the LB liquid culture medium. Plasmid DNA was extracted using the Tiangen plasmid miniprep kit and identified by digestion with BamHI and SalI, as shown in FIG. 1C. An overexpression vector of 35S.

(II) transformation of Agrobacterium

Transforming agrobacterium EHA105 by taking 3 mu L of plasmid through an electrical transformation method, and operating as follows:

electric rotating cup (Gene) with electrode spacing of 0.1cm

electrophoresis cuvettes) is sterilized, then is inserted into crushed ice, the ice surface is compacted, and is kept stand for 5min in the ice, so that the electric rotating cup is fully cooled. The agrobacterium-infected state preserved at-70 ℃ is taken and inserted into ice for 5-10 min, 3 mu L of plasmid DNA is added after the agrobacterium-infected state is melted, the agrobacterium-infected state is immediately inserted into the ice, the competent-plasmid mixture is quickly transferred into an electric transfer cup by a sterile suction head in a super clean bench, a cup cover is covered, and an empty tube is reserved for standby. Starting the electrotransfer instrument, and setting electric shock parameters: c =25 μ F, PC =200ohm, v =2400v. And wiping moisture outside the electric rotating cup by using a paper towel, and quickly putting the electric rotating cup into the electric rotating groove for electric shock. After the electric shock is finished, the electric rotating cup is quickly inserted into ice, 700 mu L of YEP is added and transferred into an original competent empty tube, and the electric rotating cup is subjected to shaking culture at the temperature of 28 ℃ and the rpm of 150-200 for 2-3 h. Centrifuging, discarding the supernatant, taking the precipitate, coating the precipitate on a YEP plate containing kanamycin and rifampicin, and inversely placing the YEP plate on an incubator at 28 ℃ for 2-3 days. Selecting a single colony to a YEP culture solution, culturing at 28 ℃ for 4-6 h, then carrying out bacterial liquid PCR, selecting 3-4 positive colonies, and adding about 20mL of YEP (kanamycin and rifampicin) toIn the medium, the culture was performed overnight. And obtaining the agrobacterium liquid containing AhBADH1.

(III) Agrobacterium mediated inflorescence infection, overexpression AhBADH1 transgenic Arabidopsis positive seedling screening

1. Inflorescence infection of arabidopsis

Infection formula (10 mL system): 0.5g of cane sugar; silwet (toxic, light-tight) 3.0 μ L; ddH ₂ And O is metered to 10mL.

Infection steps:

50 mu.L of AhBADH1 Agrobacterium liquid is sucked and added into a conical flask containing 50mLYEP culture solution, and the culture is performed with shaking overnight in an incubator at 28 ℃. Centrifuging at 5000rpm for 5min at room temperature, collecting thallus for 2-3 times, and re-suspending thallus with 10mL infection liquid. The bloomed flowers are soaked into the dye liquor for 6-7 s at about 10-11 am. Dark treatment and wet wrapping for 24h. And after 5-7 d of interval, secondarily infecting to improve infection efficiency.

2. Screening of transgenic Positive seedlings

The infected seeds of Arabidopsis thaliana were the T0 generation. And (3) spreading seeds of the T0 generation on a culture medium containing kanamycin for culture, selecting green seedlings as potential positive strains, carrying out PCR identification, and harvesting single plants to obtain the T1 generation. Seeds of the T1 generation are scattered on a culture medium containing kanamycin for culture, green seedlings in a strain with the green seedling ratio of about 3. The T2 generation seeds are spread on a culture medium containing kanamycin, strains which are all green seedlings are selected for propagation, namely, homozygous transgenic plants are obtained, the genome of the transgenic strains is extracted, the transgenic strains are detected by RT-PCR, and the strains with high expression are selected for further experiments. The test result is shown in figure 2, 5 AhBADH1 overexpression transgenic strains are obtained in total, and RT-PCR detection shows that the expression quantities of transgenic materials OE1, OE2, OE3 and OE5 are all higher than those of a control, wherein the expression quantities of OE3 and OE5 are higher and the transgenic materials are used as subsequent experimental materials.

Other terms used in the present invention have generally the meanings that are commonly understood by those of ordinary skill in the art, unless otherwise specified. The present invention will be described in further detail with reference to the following data in conjunction with specific examples. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

Example 1

The transgenic lines have a salt-tolerant phenotype:

1. germination phenotype of transgenic Arabidopsis overexpressing AhBADH1

Through RT-PCR detection and analysis, transgenic positive strains OE3 and OE5 with high AhBADH1 expression quantity are selected as experimental materials. Sterilizing Arabidopsis seeds with 70% ethanol for 5min, centrifuging, removing supernatant, sterilizing with 2.6% sodium hypochlorite for 10min, centrifuging, removing supernatant, and sterilizing with sterile ddH containing Tween-20 ₂ And flushing for 5-6 times by using O, and regularly and spotlighting the sterilized sterile seeds on a 1/2MS solid culture medium containing NaCl with different concentrations. Treating at 4 deg.C in dark for 3 days, placing in 22 deg.C long-day incubator for 10 days, and germinating once every 12 h. And (4) judging the seed breaking through the seed coat as germination, and counting the germination rate of the arabidopsis seeds every day. All experiments were performed in 3 biological replicates.

The experimental results are shown in fig. 3:

both FIG. 3A and FIG. 3B show that the transgenic positive plants have salt-tolerant phenotype in germination period. Transgenic arabidopsis seeds showed no difference in germination rate from the control in 1/2MS medium, but when grown on NaCl-containing medium, the difference was significant: wherein, under the condition of 150mM NaCl, the WT germination rate is about 82%, and the OE3 germination rate and the OE5 germination rate can respectively reach 98% and 91%; under the condition of 200mM NaCl, the WT germination rate is about 54%, the germination rates of OE3 and OE5 can reach 84% and 66% respectively, the germination rates of seeds of two over-expression strains are obviously higher than those of a control, the salt-resistant capability of OE3 is higher than that of OE5, the germination is faster, the germination rate is higher, and the tolerance to salt stress is shown.

2. Seedling phenotype of transgenic Arabidopsis overexpressing AhBADH1

After seeds of transgenic Arabidopsis with overexpression AhBADH1 are disinfected by 70% ethanol and sodium hypochlorite, the seeds are regularly spotted on 1/2MS solid culture media containing NaCl with different concentrations. And (3) processing at 4 ℃ in a dark place for 3 days, vertically culturing in a long-day incubator at 22 ℃ for 21 days, and counting the root length and the fresh weight of the Arabidopsis strains on different culture dishes. All experiments were performed in 3 biological replicates.

The results of the experiment are shown in table 1 and fig. 4:

table 1, FIG. 4A, FIG. 4B and FIG. 4C all show that the transgenic positive plants have salt tolerant phenotype at seedling stage. Transgenic Arabidopsis seeds in 1/2MS medium have substantially the same growth vigor as the control, while under 150mM NaCl conditions, the root length of OE3 and OE5 is 65.12% and 68.11% higher than the control, and the fresh weight is 12.81% and 9.92% higher than the control; under the condition of 200mM NaCl, the root lengths of OE3 and OE5 are 110.52 percent and 46.32 percent higher than those of the control, and the fresh weights are 10.02 percent and 5.30 percent higher than those of the control; the salt tolerance of the transgenic plant OE3 in the seedling stage is obviously higher than that of OE5.

TABLE 1

Example 2

Salt stress induced accumulation of betaine and proline in transgenic lines:

after seeds of transgenic Arabidopsis thaliana overexpressing AhBADH1 are sterilized by 70% ethanol and sodium hypochlorite, the seeds are uniformly scattered on 1/2MS solid culture media containing NaCl with different concentrations. Treating at 4 deg.C in dark for 3 days, standing in 22 deg.C long-day incubator for 21 days, and collecting materials for determination of betaine and proline content.

1. Betaine content determination

Preparing standard solutions of betaine with different concentrations, measuring OD values at 525nm, and drawing a standard curve. 0.1g of each Arabidopsis thaliana seedling on different treatment culture dishes is respectively put into a mortar added with distilled water and ground into homogenate. Shaking and shaking in a shaking table at 23 deg.C for 20 hr, centrifuging for 15min, and adjusting pH of the supernatant to 1.0 with concentrated hydrochloric acid. Storing in a refrigerator at 4 ℃ for 15min, adding 15mg/mL of Rayleigh salt to 5mL, and standing at 4 ℃ for 1h. Centrifuging at 10000rpm for 15min, discarding the supernatant, adding 5mL of diethyl ether, shaking up, and centrifuging again. After standing for 10min, the ether was completely evaporated, and 5mL of 70% acetone was added. The absorbance values were determined at 525nm using 70% acetone as a blank.

2. Determination of proline content

Preparing proline standard solutions with different concentrations, boiling in a water bath for 30min, taking out, cooling to room temperature, adding toluene, mixing uniformly, extracting red substances, measuring an OD value at 520nm, and drawing a standard curve. 0.1g of each arabidopsis thaliana seedling on different treatment culture dishes is taken and put into a mortar, 3 percent of sulfosalicylic acid is added, fully ground into homogenate and transferred into a test tube with a plug. The tube was placed in a boiling water bath for 15min and filtered. Respectively taking out 2mL of filtrate, transferring the filtrate into a test tube with a plug, sequentially adding 2mL of distilled water, 4mL of acidic ninhydrin and 2mL of glacial acetic acid, mixing and shaking uniformly, and then carrying out boiling water bath for 2h. After 2h, the filtrate was taken out, cooled to room temperature, and added with 4mL of toluene respectively, and shaken up for extraction. After standing for 10min, the supernatant was aspirated and the absorbance at 520nm was measured.

The results of the experiment are shown in table 2 and fig. 5:

table 2, FIG. 5A and FIG. 5B can show that betaine and proline in transgenic positive plants under salt stress are rapidly accumulated, and are significantly higher than those in a control, and the difference of a transgenic plant OE3 is more significant than that of OE5, and the two osmoregulation substances can effectively relieve the damage of salt stress on the plants and enhance the salt tolerance of the plants.

TABLE 2

Example 3

Applying betaine externally to improve the germination rate of peanut seeds under salt stress:

peanut seeds (Tifrunner variety) are germinated for 10 days on filter paper dishes containing betaine (0 mM, 5mM, 10mM and 15 mM) with different concentrations and 1/10hogland culture solution containing NaCl (0 mM, 50mM, 100mM and 150 mM) with different concentrations, the germination rate is counted, and the emergence of a white tip with the diameter of 3mM is the germination. All experiments were performed in 3 biological replicates.

Germination rate (%) = (number of germinated seeds/total number of test peanut seeds) × 100%.

The experimental results are shown in fig. 6:

under normal conditions, betaine does not influence peanut seed germination (figure 6A), the peanut seed germination inhibition degree is more obvious as the salt concentration is increased, but the betaine under different salt concentrations can promote peanut seed germination, improve the germination rate, and the promotion effect shows the trend of increasing first and then decreasing, wherein 10mM betaine is the optimal betaine concentration for improving the salt tolerance of the peanut in the germination period, and different treatment differences are obvious under the salt concentrations of 100mM NaCl and 150mM NaCl (figures 6B, 6C and 6D). The 10mM betaine can improve the germination rate of peanut seeds by 7.50 percent and 16.03 percent under 100mM NaCl and 150mM NaCl respectively.

The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.

Claims (10)

1. AhBADH1 gene, characterized in that the nucleic acid sequence is shown in SEQ ID NO. 1.
2. 2. Use of the AhBADH1 gene according to claim 1 for improving salt tolerance of plants.
3. 3. Use according to claim 2, wherein the AhBADH1 gene is used for improving the salt tolerance of plants during germination and/or seedling stage.
4. 4. The use of claim 2 or 3, wherein the AhBADH1 gene can be prepared into recombinant expression vector, expression cassette, transgenic cell line, recombinant bacterium or recombinant virus for improving the salt tolerance of plant.
5. 5. A method for improving the salt tolerance of a plant, which is characterized in that the AhBADH1 gene of claim 1 is constructed into an expression vector to form a recombinant expression vector, then the recombinant expression vector is transformed into a strain to obtain a recombinant strain carrying the AhBADH1 gene, then the recombinant strain is infected into a plant leaf, so that the plant carries the AhBADH1 gene, and finally the salt tolerance of the plant is regulated and controlled through the expression of the AhBADH1 gene.
6. 6. The method according to claim 5, wherein the strain is selected from Agrobacterium tumefaciens or Agrobacterium rhizogenes.
7. 7. The method of claim 5, wherein the recombinant expression vector comprises a cloning vector comprising: binary agrobacterium vectors or vectors that can be used for microprojectile bombardment of plants.
8. 8. Use of the AhBADH1 gene according to claim 1 for regulating betaine and/or proline synthesis in plants.
9. 9. The use according to any one of claims 2 to 4, or the method according to any one of claims 5 to 7, or the use according to claim 8, wherein the plant is a monocotyledonous or dicotyledonous plant.
10. 10. Application of betaine in improving germination rate of plant seeds under salt stress.

Images