CN106243209B - Plant stress resistance related protein GsNAC019 and coding gene and application thereof - Google Patents

Abstract

The invention discloses a plant stress resistance related protein GsNAC019, and a coding gene and application thereof. The GsNAC019 protein provided by the invention is the protein of the following a) or b) or c): a) the amino acid sequence is a protein shown in a sequence 2; b) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in the sequence 2; c) and (b) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2. Experiments prove that the GsNAC019 gene is overexpressed in arabidopsis thaliana, the tolerance of the obtained transgenic arabidopsis thaliana to carbonate stress is obviously higher than that of wild arabidopsis thaliana, and the GsNAC019 protein has the function of regulating and controlling the alkali resistance of plants and can lay a foundation for the research of culturing transgenic plants with carbonate stress tolerance.

Description

Plant stress resistance related protein GsNAC019 and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a plant stress resistance related protein GsNAC019, and a coding gene and application thereof.

Background

The saline-alkali stress restricts agricultural production in northeast and even nationwide of China, wherein the alkaline stress is an important environmental limiting factor influencing plant growth, development and geographical distribution and seriously influences the yield and quality of crops. The development and utilization of saline-alkali soil and the exploitation of the production potential of adversity agricultural ecological regions are important problems to be solved urgently, such as the sustainable and efficient development of agriculture in China is maintained, and the food safety in China is guaranteed. However, the research on the alkali-resisting molecular mechanism of plants is only reported so far.

The soybean is an important crop in China, particularly Heilongjiang province, not only provides protein, but also provides oil, and the symbiotic relationship with azotobacter makes it a high-profit crop in a crop rotation system. In the domestication process of soybeans, the cultivated species lose a plurality of important genes related to environmental adaptation, so that the cultivated soybeans have much lower genetic diversity than wild soybeans, for example, many cultivated soybeans are sensitive to salt and alkali, and wild soybeans have strong adaptability to salt and alkali. Therefore, the method for improving the soybean variety is a quick method for improving the soybean variety by reintroducing the gene which can adapt to a certain specific environment in the wild soybean into the cultivated soybean. This strategy of transferring the wild species elite trait gene into cultivars to accelerate crop improvement has been successful in a variety of crop breeding studies.

With the continuous development of molecular biology, the cultivation of new varieties of crops with excellent properties and good stress tolerance by using the increasingly mature genetic engineering technology has become one of the important means for modern crop improvement. The transcription factor plays a key role in regulation and control in abiotic stress signal conduction, and the expression of a single gene can start a signal conduction network and activate the transcription and expression of a plurality of downstream stress-related functional genes, thereby achieving the effect of more obviously improving the stress resistance of crops. Therefore, the excavation of the anti-retroviral factor gene provides a gene resource with more obvious functions for crop transgenic breeding.

Disclosure of Invention

The invention aims to solve the technical problem of how to regulate and control the stress resistance of plants.

In order to solve the technical problems, the invention firstly provides a protein related to plant stress resistance, the name of the protein related to plant stress resistance is GsNAC019 protein, and the GsNAC019 protein is protein of a) or b) or c) as follows:

a) the amino acid sequence is a protein shown in a sequence 2;

b) a fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in the sequence 2;

c) and (b) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2.

Wherein, the sequence 2 consists of 343 amino acid residues.

In order to facilitate the purification of the protein in a), the amino terminal or the carboxyl terminal of the protein shown in the sequence 2 in the sequence table can be connected with a label shown in the table 1.

TABLE 1 sequence of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The protein of c) above, wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The protein in the c) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The gene encoding the protein of c) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in the 46 th to 1077 th positions of the sequence No. 1, and/or by carrying out missense mutation of one or several base pairs, and/or by connecting the coding sequence of the tag shown in the above Table 1 to the 5 'end and/or the 3' end thereof.

In order to solve the technical problem, the invention also provides biological materials related to the GsNAC019 protein.

The biological material related to the GsNAC019 protein provided by the invention is any one of the following A1) to A12):

A1) a nucleic acid molecule encoding GsNAC019 protein;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising a1) the nucleic acid molecule;

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising a4) said recombinant vector;

A9) a transgenic plant cell line comprising the nucleic acid molecule of a 1);

A10) a transgenic plant cell line comprising the expression cassette of a 2);

A11) a transgenic plant cell line comprising the recombinant vector of a 3);

A12) a transgenic plant cell line comprising the recombinant vector of a 4).

In the above-mentioned related biological material, the nucleic acid molecule according to A1) is a gene represented by the following 1) or 2) or 3):

1) the coding sequence is a cDNA molecule or a genome DNA molecule shown in 46 th to 1077 th positions of the sequence 1;

2) a cDNA molecule or a genome DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by 1) and codes GsNAC019 protein;

3) a cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in 1) or 2) and encodes a GsNAC019 protein.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The GsNAC019 protein-encoding nucleotide sequence of the present invention can be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which have been artificially modified to have 75% or more identity to the nucleotide sequence encoding GsNAC019 protein are derived from and identical to the nucleotide sequence of the present invention, as long as they encode GsNAC019 protein and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 2 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In the above biological material, the stringent conditions are hybridization and membrane washing at 68 ℃ for 2 times, 5min each, in a solution of 2 XSSC, 0.1% SDS, and hybridization and membrane washing at 68 ℃ for 2 times, 15min each, in a solution of 0.5 XSSC, 0.1% SDS; alternatively, hybridization was carried out at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS, and the membrane was washed.

In the above-mentioned biological material, the expression cassette containing a nucleic acid molecule encoding GsNAC019 protein (GsNAC019 gene expression cassette) described in a2) refers to DNA capable of expressing GsNAC019 protein in a host cell, which may include not only a promoter that initiates transcription of GsNAC019 but also a terminator that terminates transcription of GsNAC 019. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: a constitutive promoter; tissue, organ and development specific promoters and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter of cauliflower mosaic virus 35S: the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al (1999) Plant Physiol 120: 979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1(PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible with methyl jasmonate); heat shock promoters (U.S. patent 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128(CN101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators (see, e.g., Odell et al (I)⁹⁸⁵) Nature 313: 810; rosenberg et al (1987) Gene,56: 125; guerineau et al (1991) mol.gen.genet,262: 141; proudfoot (1991) Cell,64: 671; sanfacon et al Genes Dev.,5: 141; mogen et al (1990) Plant Cell,2: 1261; munroe et al (1990) Gene,91: 151; balladEt al (1989) Nucleic Acids Res.17: 7891; joshi et al (1987) Nucleic Acid Res, 15: 9627).

The recombinant vector containing the GsNAC019 gene expression cassette can be constructed by using the existing expression vector. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Co., Ltd.), etc. The plant expression vector may also comprise a 3' untranslated region of the foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The poly A signal can lead poly A to be added to the 3 'end of mRNA precursor, and the untranslated regions transcribed at the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (such as nopaline synthase gene Nos) and plant genes (such as soybean storage protein gene) have similar functions. When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound capable of producing a color change (GUS gene, luciferase gene, etc.), a marker gene for antibiotics (e.g., nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to phosphinothricin as an herbicide, hph gene conferring resistance to hygromycin as an antibiotic, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or a marker gene for chemical resistance (e.g., herbicide resistance), a mannose-6-phosphate isomerase gene providing the ability to metabolize mannose, which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector.

In the above biological material, the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium.

In the above biological material, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not comprise propagation material.

In order to solve the technical problems, the invention also provides a new application of the GsNAC019 protein or the related biological materials.

The invention provides application of GsNAC019 protein or the related biological material in regulating and controlling plant stress resistance.

The invention also provides application of the GsNAC019 protein or the related biological material as a transcription activator.

The invention also provides application of the GsNAC019 protein or the related biological material in cultivating stress-resistant transgenic plants.

In the above application, the regulation is an improvement.

In the application, the stress resistance is alkali stress resistance; the alkali stress resistance is specifically NaHCO resistance₃Stress, embodied in 7mM or 150mM NaHCO₃Under conditions of stress: the root length of the transgenic plant is longer than that of the receptor plant, or the chlorophyll content of the transgenic plant is higher than that of the receptor plant, or the survival rate of the transgenic plant is higher than that of the receptor plant, or the expression amount of the alkali stress related gene of the transgenic plant is higher than that of the receptor plant; the alkali stress related gene is specifically H⁺-ATPase gene and/or RD29A gene and/or KIN gene.

In order to solve the above technical problems, the present invention finally provides a method for breeding transgenic plants with improved stress resistance.

The method for cultivating the transgenic plant with improved stress resistance comprises the steps of over-expressing GsNAC019 protein in a receptor plant to obtain the transgenic plant and obtaining the transgenic plant; the transgenic plant has higher stress resistance than the recipient plant.

In the above method, the overexpression is carried out by introducing a gene encoding GsNAC019 protein into a recipient plant;

the nucleotide sequence of the GsNAC019 protein coding gene is a DNA molecule shown in a sequence 1. In the embodiment of the invention, the GsNAC019 protein coding gene (namely the DNA molecule shown in the sequence 1 in the sequence table) is introduced into a receptor plant through a pCAMBIA330035Su vector, and the pCAMBIA330035Su vector is formed by inserting the GsNAC019 gene shown in the sequence 1 in the sequence table between two enzyme cutting sites of PacI and Nt.BbvCI of the pCAMBIA330035Su vector. The pCAMBIA330035Su vector expresses GsNAC019 protein shown in sequence 2.

In the above method, the stress resistance is alkali stress resistance.

In the above method, the transgenic plant exhibits higher stress resistance than the recipient plant exhibits in any one of the following (1) to (4):

(1) the transgenic plant has a longer root length than the recipient plant;

(2) the chlorophyll content of the transgenic plant is higher than that of the receptor plant;

(3) the survival rate of the transgenic plant is higher than that of the receptor plant;

(4) the expression level of the alkali stress related gene of the transgenic plant is higher than that of the receptor plant; the alkali stress related gene is specifically H⁺-ATPase gene and/or RD29A gene and/or KIN gene.

In the above method, the plant is a monocotyledon or dicotyledon; the dicotyledons can be plants of Leguminosae and/or Brassicaceae and/or plants of Compositae; the leguminous plant can be soybean, Lotus corniculatus, alfalfa or wampee; the cruciferous plant may be arabidopsis thaliana or brassica napus; the Compositae plant can be sunflower; the Arabidopsis thaliana may be Arabidopsis thaliana (Columbia ecotype col-0).

In the above method, the transgenic plant is understood to comprise not only the first generation transgenic plant obtained by transforming the GsNAC019 gene into a plant of interest, but also the progeny thereof. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.

Primer pairs for amplifying the whole length of the nucleic acid molecule encoding the GsNAC019 protein or fragments thereof also belong to the protective scope of the invention.

Hundreds of northeast wild soybeans (Glycine soja L.) are collected from severe saline-alkali soil in the northeast white city area, have the characteristics of wide adaptability, strong stress resistance and the like, have rich high-quality gene resources, are ideal materials for cloning stress-resistant genes, and clone a GsNAC019 gene related to plant stress resistance from the wild soybeans. Experiments prove that the GsNAC019 gene is overexpressed in arabidopsis thaliana, and the tolerance of the obtained GsNAC 019-converted arabidopsis thaliana to carbonate stress is obviously higher than that of wild arabidopsis thaliana, so that the GsNAC019 protein has the function of regulating and controlling the alkali resistance of plants, and a foundation can be laid for the research of culturing transgenic plants with the carbonate stress tolerance.

Drawings

FIG. 1 shows that the GsNAC019 gene in wild soybean root and leaf is 50mM NaHCO₃(pH 8.5) and 200mM NaCl stress treatment. Wherein, in figure 1a, the GsNAC019 gene in wild soybean leaves is 50mM NaHCO₃(pH 8.5) expression pattern under stress treatment; FIG. 1b shows that the GsNAC019 gene in wild soybean root is 50mM NaHCO₃(pH 8.5) expression pattern under stress treatment; FIG. 1c is the expression pattern of the GsNAC019 gene in wild soybean roots under 200mM NaCl stress treatment.

FIG. 2 is a subcellular localization analysis of the GsNAC019 gene.

FIG. 3 is an analysis of the transcriptional activation activity of the GsNAC019 gene in yeast cells.

FIG. 4 is the binding element of the GsNAC019 gene analyzed using yeast single hybrid.

FIG. 5 is phenotypic analysis of GsNAC019 gene-transferred Arabidopsis under alkali stress. FIGS. 5a and 5b show GsNAC019 transgenic Arabidopsis thaliana in 7mM NaHCO₃Measuring the phenotype and root length of the treated seedlings; FIGS. 5c, 5d and 5e show GsNAC019 transgenic Arabidopsis thaliana at 150mM NaHCO₃Under treatmentStatistical analysis of seedling stage phenotype, chlorophyll content and survival rate. Wherein, 6#, 16# and 22# are all T₃GsNAC019 gene Arabidopsis thaliana was transferred, and WT was wild type Arabidopsis thaliana.

FIG. 6 shows the relative expression level of each alkali stress related gene in GsNAC019 transgenic Arabidopsis.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results averaged.

The wild soybean G07256 seeds in the following examples are disclosed in the documents "Mingzhe Sun, Xiaooli Sun, Yang ZHao, Hua Cai, Chaoyue ZHao, Wei Ji, Huizi Duanmu, Yang Yu, Yang ming Zhu, Ectopic expression of GsPPCK3and SCMRP in medical go of the plant of the individual alkaline stress tolerance and methionine content PLOS ONE 2014,9(2): e 89578" publicly available from the northeast agricultural university.

Saccharomyces cerevisiae AH109 in the examples below is described in the literature "Sun Korea"; segment is small red; talent bloom; the plum is brave; hinoki; ji Wei; a quarterly sovereign; screening proteins interacting with AtbZIP1 by using a yeast two-hybrid technology. The Chinese journal of biochemistry and molecular biology, 2010, 26(11) 1050-.

Yeast Y187 in the following examples is disclosed in the documents "Liang Yang, Wei Ji, Yanming Zhu, Peng Gao, Yong Li, Hua Cai, Xi Bai and dianying Guo.GsCBRLK, a calcium/calcium-binding receptor-like kinase, is a functional regulator of plant tolerance to salt and ABA stress, journal of experimental botanic.2010619-.

Wild type Arabidopsis thaliana (Columbia-0 subtype) in the following examples is disclosed in the literature "Kim H, Hyun Y, Park J, Park M, Kim M, Kim H, Lee M, Moon J, Lee I, Kim J.A genetic link between cool columns and marketing time through FVE in Arabidopsis thaliana. Nature genetics.2004,36: 167-.

pGBKT7 vectors in the following examples are described in the literature "Xiao Luo, Na Cui, Yanming Zhu, Lei Cao, Hong Zhu, Hua Cai, Wei Ji, Xuedong Wang, Dan Zhu, Yong Li, Xi Bai Over-expression of Gs ZFP1, an ABA-responsive C2H2-type zinc finger protein kinase a QALGG motif, reduce ABA sensitivity and yield storage size. journal of Plant Physiology 169 (12); 1192-.

pGBKT7-DREB vectors in the following examples are disclosed in the documents Xiao Luo, Xi Bai, Xiaoli Sun, Dan Zhu, Baohui Liu, Wei Ji, Hua Cai, Lei Cao, Jing Wu, Mentran Hu, Xin Liu, Lili Tang and Yanming Zhu, expression of world soybean WRKY20in Arabidopsis genes handling water tolerance and regulations ABsignal. journal of Experimental Botany,2013,64(8). 2155-2169 ", publicly available from the northeast university of agriculture.

pGADT7 vectors in the following examples are disclosed in the documents "Liang Yang, Wei Ji, Yanming Zhu, Peng Gao, Yong Li, Hua Cai, Xi Bai and dianking guide. GsCBRLK, a calcium/calcium-binding receptor-like kinase, is a positional regulator of plant tolerance to salt and ABA stress, journal of experimental botanic.20106133 (9) 2519-2533", publicly available from the northeast agricultural university.

The pBSK-35S-eGFP vector in the following examples is disclosed in the literature "Xiioli Sun, Wei Ji, Xiaodong Ding, Xi Bai, Hua Cai, Shanshan Yang, Xue Qian, Mingzhe Sun, Yanming Zhu. GsVAMP72, a novel Glycine soja R-SNARE protein, is involved in regulating plant tolerance and sensitivity. plant tissue Organ Cult 2013,113: 199-.

The pCAMBIA330035Su vector in the following examples is disclosed in the documents "Xiaolin Sun, Wei Ji, Xiaodong Ding, Xi Bai, Hua Cai, Shanghan Yang, Xue Qian, Mingzhe Sun, Yanming Zhu.GsVAMP72, a novel Glycine soja R-SNARE protein, is involved in regulating plant tolerance and sensitivity.plant Cell tissue Organ Cult 2013,113: 199-.

Agrobacterium LBA4404 in the following examples is disclosed in the literature "Ailin Liu, Yang Yu, Xiangbo Duan, Xiioli Sun, Huizi Duanmu, Yanming Zhu.GsSKP21, a Glycine soja S phase kinase associated protein, media of the regulation of plant alkali tolerance and ABA sensitivity. plant Mol Biol (2015)87: 111-.

Example 1 cloning of the Soybean transcription factor GsNAC019 Gene

1. Treatment of plant material

Selecting plump wild soybean G07256 seeds in concentrated H₂SO₄Neutralizing for 10min to remove waxy membrane and purifying to obtain concentrated H₂SO₄Washing with sterile water for 3-4 times, placing on wet filter paper, performing dark culture at 25 ℃ for 3d for accelerating germination, transferring the buds into a pot containing a Hoagland culture solution when the buds grow to about 1-2 cm, fixing with space cotton to immerse the buds into the culture solution, and placing in an artificial climate box for culture. And (3) when the seedlings grow to 3 weeks, taking 3cm of roots of the seedlings, putting the seedlings into an EP (EP) tube, and storing at-80 ℃.

2. RNA extraction

Extracting the total RNA of the roots of the 3-week-old wild soybean seedlings obtained in the step 1 by using an RNAprep pure kit (TRANSGEN BIOTECH).

3. Obtaining of cDNA

And (3) carrying out reverse transcription by taking the total RNA obtained in the step (2) as a template to obtain cDNA.

4. PCR amplification

And 3, performing PCR amplification by using the cDNA obtained in the step 3 as a template and adopting Primer-KS and Primer-KAS primers to obtain a PCR amplification product. The primer sequences are as follows:

Primer-KS：5’-CAGTGGTTCTTTTCCTTCTGAGA-3’；

Primer-KAS：5’-AAGAATCCCCACCTATTTACACC-3’。

PCR amplificationIncrement system (50 μ l): cDNA 4. mu.l, 10 XPS buffer (Mg 2)⁺)10μl，dNTP Mixture(2.5mM)4μl，Primer-F 1μl，Primer-R 1μl，PrimeSTAR DNA Polymerase(TaKaRa)0.5μl，ddH₂O29.5μl。

The PCR amplification conditions were: 8min at 98 ℃; 30 cycles of 98 ℃ for 10s, 60 ℃ for 10s and 72 ℃ for 1 min; 10min at 72 ℃; and terminated at 4 ℃.

Carrying out 1.5% agarose gel electrophoresis detection on the PCR amplification product to obtain a band with the molecular weight slightly larger than 1Kb, and recovering the PCR amplification product by using an agarose gel recovery kit (TRANSGEN BIOTECH); the recombinant plasmid is obtained by connecting the recombinant plasmid with pEASY-Blunt Zero vector (TRANSGEN BIOTECH), is named as pEASY-Blunt Zero-GsNAC019, and is subjected to cross sequencing after being transformed into escherichia coli DH5 alpha competent cells.

The sequencing result shows that: PCR amplification is carried out to obtain an amplification product with the size of 1145bp, the nucleotide sequence of the amplification product is shown as a sequence 1 in a sequence table, the amplification product is named as a GsNAC019 gene, ORF is the 46 th to 1077 th site of the sequence 1, and the amino acid sequence of the protein coded by the GsNAC019 gene is shown as a sequence 2 in the sequence table.

Example 2 analysis of expression characteristics of wild Soybean transcription factor GsNAC019 Gene

Expression pattern analysis of GsNAC019 gene in wild soybean roots and leaves at different time under alkali stress treatment

1. Treatment of plant material

Selecting plump wild soybean G07256 seeds in concentrated H₂SO₄Performing neutralization for 10min to remove mud film, and purifying to obtain concentrated H₂SO₄And washing with sterile water for 3-4 times, placing on wet filter paper, performing dark culture at 25 ℃ for 3d for accelerating germination, moving out when the sprouts grow to about 1-2 cm, and performing water culture by using a Hoagland liquid culture medium.

When the wild soybean seedlings grow to 3 weeks, the wild soybean seedlings are respectively cultured in 50mM NaHCO₃(pH 8.5) and 200mM NaCl for 0h, 1h, 3h, 6h, 12h and 24h, quickly shearing tender leaves and roots, and storing at-80 deg.C.

2. Extraction of Total RNA and obtaining of cDNA

Respectively extracting total RNA of leaves and roots of the wild soybean seedlings treated at different times obtained in the step 1 by adopting an RNAprep pure kit (TRANSGEN BIOTECH); and reverse transcription is carried out by taking the obtained total RNA as a template to obtain cDNA.

3、Real-time PCR

And (3) detecting the expression quantity of the GsNAC019 gene by Real-time PCR by using the cDNA obtained in the step (2) as a template and Primer-BS and Primer-BAS primers. The primer sequences are shown below:

Primer-BS：5’-CTTCCCGAAAGAACACTGGC-3’；

Primer-BAS：5’-CCGTTGCTGTATTGAGTGTGC-3’；

conditions for Real-time PCR reaction: 95 ℃ 7min → [95 ℃ 15s → 60 ℃ 1min ]. times.40 → 95 ℃ 1min → 55 ℃ 1min → 95 ℃ 30 s.

Real-time PCR was performed by using comparative CT method (. DELTA.CT) to calculate the gene expression level, using wild soybean GsGAPDH gene as an internal reference gene and an untreated sample as a control. Differences in target gene expression are expressed as fold of treated samples relative to untreated samples at each time point. Each sample included 3 biological replicates and 3 technical replicates, and the data were averaged over 3 biological replicates, and two data were averaged if there was a large deviation in one value. The raw data is normalized. And carrying out difference significance analysis on the data subjected to the standardization treatment through T-test. The relative expression amount calculation method comprises the following steps: 2^-ΔΔCT＝2^{- (Delta CT treatment-Delta CT control)}＝2^{- [ (CT treatment target Gene-CT treatment reference Gene) - (CT control target Gene-CT control reference Gene)]}. The sequences of the primers for the internal reference gene are shown as follows:

GsGAPDH-S：5'-GACTGGTATGGCATTCCGTGT-3'；

GsGAPDH-AS：5'-GCCCTCTGATTCCTCCTTGA-3'。

the results are shown in FIG. 1: in untreated wild soybean leaves, the expression level of GsNAC019 gene is up-regulated in 12h and 50mM NaHCO₃Under the treatment, the expression of the GsNAC019 gene in wild soybean leaves shows the tendency of up-regulation, down-regulation and up-regulation, and peaks appear at 1h and 12h, which shows that the wild soybean expresses the gene in advance to respond to the alkali stress treatmentThe alkaline stress also indicates that the expression quantity of the gene shows rhythmical change in the alkaline stress. The expression level of the GsNAC019 gene in wild soybean roots subjected to alkali stress reaches the maximum value within 12h, and the expression level of each time point is higher than that of an untreated group, so that the expression of the GsNAC019 gene in the roots is obviously induced by alkali stress; under 200mM NaCl treatment, the expression level of the GsNAC019 gene shows a tendency of continuous increase, which indicates that the GsNAC019 gene also responds to salt stress, and the influence of salt stress and alkali stress on wild soybeans is different for the same gene.

Example 3 particle gun bombardment-mediated transient expression of the GsNAC019 Gene and subcellular localization of the protein of interest

1. Construction of subcellular localization vectors

Taking the wild soybean total cDNA as a template, and carrying out PCR amplification by adopting GsNAC019-YS and GsNAC019-YAS primers to obtain a PCR amplification product, namely a GsNAC019 gene, wherein the primer sequence is shown as follows (the sequence of an introduced enzyme cutting site is marked by underlining, and the left side of the sequence is a protective base):

GsNAC019-YS：5'-ACGCGTCGACATGGGAGTTCCAGAGAAAGACCC-3'；

GsNAC019-YAS：5'-AAAACTGCAG ATTSCTGACCCGAACCCG-3'；

system of PCR reaction: 20 μ L of 5 XPrimeSTAR^TMHS PCR buffer, 8. mu.L dNTP mix (A, G, T, C, 2.5mM each), 2. mu.L upstream and downstream primers (10. mu.M), 1. mu.L universal template diluted 100-fold (plasmid containing the gene of interest), 1. mu.L Hi-Fi enzyme [ PrimeSTAR DNA Polymerase (TaKaRa)]Sterile ddH₂O make up volume (total volume 100. mu.L).

And (3) PCR reaction conditions: 8min at 98 ℃; 30 cycles of 98 ℃ for 10s, 60 ℃ for 10s and 72 ℃ for 1 min; 10m at 72 ℃; and terminated at 4 ℃.

Carrying out double enzyme digestion on the GsNAC019 gene and the pBSK-35S-eGFP vector by using restriction enzymes Sal I and Pst I respectively, and connecting to obtain the subcellular localization vector containing the GsNAC019 gene. Sequencing the subcellular localization vector containing the GsNAC019 gene.

The sequencing result shows that: the GsNAC019 gene-containing subcellular localization vector is obtained by replacing a DNA fragment between Sal I and Pst I enzyme cutting sites of a pBSK-35S-eGFP vector with the GsNAC019 gene shown in a sequence 1 in a sequence table and keeping other sequences of the pBSK-35S-eGFP vector unchanged.

2. Gene gun bombardment-mediated GsNAC019 gene transient expression

Bombarding the onion epidermal cells with the GsNAC019 gene-containing subcellular localization vector obtained in the step 1 by adopting a gene gun method (the specific method is shown in the specification of a Bio-Rad Berl Helios gene gun system in the United states), taking a pBSK-35S-eGFP empty vector as a positive control, shearing the onion epidermal cells bombarded with the GsNAC019 gene-containing subcellular localization vector and the empty vector, loading the onion epidermal cells into a film, and observing the film under a laser confocal microscope.

The results are shown in FIG. 2: the GFP positive control is expressed in the cell membrane, cytoplasm and nucleus of the cell, the green fluorescence signal can be detected in the whole cell, and the GsNAC019 is mainly positioned in the nucleus.

Example 4 analysis of transcriptional activation Activity of wild Soybean transcription factor GsNAC019 Gene

1. Construction of recombinant vector containing GsNAC019 gene or domain thereof

And replacing the DNA fragment between Nde I and BamH I enzyme cutting sites of pGBKT7 vector by GsNAC019 gene shown in sequence 1 in the sequence table, and keeping other sequences of pGBKT7 vector unchanged to obtain pGBKT7-GsNAC019-1 recombinant vector.

And replacing the DNA molecule shown in the 1 st to 39 th sites of the sequence 1 in the sequence table with the DNA fragment between the Nde I and BamH I enzyme cutting sites of the pGBKT7 vector, and keeping other sequences of the pGBKT7 vector unchanged to obtain the pGBKT7-GsNAC019-2 recombinant vector.

And replacing the DNA molecule shown in the 40 th-1032 th site of the sequence 1 in the sequence table with the DNA fragment between the Nde I and BamH I enzyme cutting sites of the pGBKT7 vector, and keeping other sequences of the pGBKT7 vector unchanged to obtain the pGBKT7-GsNAC019-3 recombinant vector.

And replacing the DNA molecule shown in 1 st-417 th site of the sequence 1 in the sequence table with the DNA fragment between Nde I and BamH I enzyme cutting sites of the pGBKT7 vector, and keeping other sequences of the pGBKT7 vector unchanged to obtain the pGBKT7-GsNAC019-4 recombinant vector.

The DNA molecule shown in the 418-1032 th site of the sequence 1 in the sequence table is substituted for the DNA fragment between the Nde I and BamH I enzyme cutting sites of the pGBKT7 vector, and other sequences of the pGBKT7 vector are kept unchanged to obtain the pGBKT7-GsNAC019-5 recombinant vector.

2. Obtaining of recombinant bacteria

And (2) respectively transforming the pGBKT7-GsNAC019-1 recombinant vector, the pGBKT7-GsNAC019-2 recombinant vector, the pGBKT7-GsNAC019-3 recombinant vector, the pGBKT7-GsNAC019-4 recombinant vector and the pGBKT7-GsNAC019-5 recombinant vector obtained in the step (1) into the yeast AH109 to respectively obtain a recombinant strain GsNAC019-1, a recombinant strain GsNAC019-2, a recombinant strain GsNAC019-3, a recombinant strain GsNAC019-4 and a recombinant strain GsNAC 019-5. Transforming the pGBKT7-DREB into yeast AH109 to obtain a positive control strain; the pGBKT7 empty vector was transformed into yeast AH109 to obtain a negative control strain. The preparation of Yeast competent cells (LiAc method) and the transformation of Yeast competent cells by the small-scale LiAc/PEG method are described in molecular cloning, instruction for experiments, third edition and Handbook of Clontech Yeast Protocols.

3. Beta-galactosidase Activity detection

Inoculating recombinant strain GsNAC019-1, recombinant strain GsNAC019-2, recombinant strain GsNAC019-3, recombinant strain GsNAC019-4 and recombinant strain GsNAC019-5 to SD/-Trp solid culture medium by using an inoculating loop for streaking, culturing for 3 days at 30 ℃, and then photocopying thalli on filter paper for carrying out beta-galactosidase activity detection.

The results are shown in FIG. 3: the positive control strain was able to turn the substrate blue, while the negative control strain was not able to turn the substrate blue. The recombinant bacterium 1 and the recombinant bacterium 5 can change the substrate to blue, and the recombinant bacterium GsNAC019-2, the recombinant bacterium GsNAC019-3 and the recombinant bacterium GsNAC019-4 can not change the substrate to blue. No other yeast except the positive control strain, the recombinant strain 1 and the recombinant strain 5 grows on the SD/-Trp-Leu culture medium, which shows that the protein expressed by the GsNAC019 gene and the C end of the complete sequence have the self-activation function. It is presumed that it makes it possible to make plants respond to alkali stress by actuating downstream genes.

Example 5 GsNAC019 analysis with downstream binding element

1. Acquisition of GsNAC019 Gene

Taking the total cDNA of wild soybean as a template, and adopting GsNAC019-JS and GsNAC019-JAS primers to carry out PCR amplification to obtain a PCR amplification product with the size of 1032bp, namely the GsNAC019 gene.

GsNAC019-JS：5’-GGAATTCCATATGATGGGAGTTCCAGAGAAAGACCC-3’

GsNAC019-JAS：5’-CGGGATCCTCAATTCTGACCCGAACCCG-3’

2. Acquisition of pGADT7-GsNAC019

And (2) carrying out double enzyme digestion and connection on the pGADT7 vector and the PCR amplification product obtained in the step 1 by using restriction enzymes Nde I and BamH I to obtain a pGADT7-GsNAC019 recombinant vector, and carrying out sequencing verification on the pGADT7-GsNAC019 recombinant vector.

The sequencing result shows that: the pGADT7-GsNAC019 recombinant vector is obtained by replacing a DNA fragment between Nde I and BamH I enzyme cutting sites of a pGADT7 vector with a GsNAC019 gene shown in a sequence 1 in a sequence table and keeping other sequences of a pGADT7 vector unchanged, and expresses a GsNAC019 protein.

3. Acquisition of pHIS2-cis and pHIS2-mcis vectors

Replacing a DNA fragment between EcoRI and SacI enzyme cutting sites of the pHIS2 vector by the nucleotide sequence of the NAC-CIS-1 binding element, and keeping other sequences of the pHIS2 vector unchanged to obtain a pHIS2-CIS-1 recombinant vector;

replacing a DNA fragment between EcoRI and SacI enzyme cutting sites of the pHIS2 vector by the nucleotide sequence of the NAC-CIS-2 binding element, and keeping other sequences of the pHIS2 vector unchanged to obtain a pHIS2-CIS-2 recombinant vector;

replacing a DNA fragment between EcoRI and SacI enzyme cutting sites of a pHIS2 vector by a nucleotide sequence of a NAC-MCIS binding element, and keeping other sequences of the pHIS2 vector unchanged to obtain a pHIS2-cis-MCIS recombinant vector;

the nucleotide sequence of the NAC-CIS-1 binding element is: CGTGTATACGTGTATACGTG, respectively;

the nucleotide sequence of the NAC-CIS-2 binding element is: CGTATTAACGTATTAACGTA, respectively;

the nucleotide sequence of the NAC-CIS-1 binding element is: GGGGTTAAGGGGTTAAGGGG are provided.

4. Obtaining of recombinant bacteria

The recombinant vector pGADT7-GsNAC019 and the recombinant vector pHIS2-cis-1 were co-transformed into yeast Y187 to obtain yeast Y187 containing plasmid pGADT7-GsNAC019/pHIS 2-cis-1.

The recombinant vector pGADT7-GsNAC019 and the recombinant vector pHIS2-cis-2 were transformed into yeast Y187 to obtain yeast Y187 containing plasmid pGADT7-GsNAC019/pHIS 2-cis-2.

Yeast Y187 is transformed by pGADT7-GsNAC019 recombinant vector and pHIS2-cis-mcis recombinant vector together, and yeast Y187 containing plasmid pGADT7-GsNAC019/pHIS2-cis-mcis is obtained.

Yeast Y187 was transformed with pGADT7 vector and pHIS2 vector together to obtain yeast Y187 containing plasmid pGADT7/pHIS 2.

5. Binding Activity assay

1ul of yeast Y187 liquid containing plasmid pGADT7-GsNAC019/pHIS2-cis-1, yeast Y187 liquid containing plasmid pGADT7-GsNAC019/pHIS2-cis-2, yeast Y187 liquid containing plasmid pGADT7-GsNAC019/pHIS2-cis-mcis and yeast Y187 liquid containing plasmid pGADT7/pHIS2 are respectively sucked by a micropipette, and the HIS protein is expressed by taking the yeast Y187 liquid containing plasmid pGADT7/pHIS2 as a negative control when SD/-Trp/-Leu and SD/-Trp/-Leu His/-His +50mM 3-AT solid culture media are spotted, and if transcription factors are combined with each element and have an activating function. After 3 days of incubation at 30 ℃, the colonies were observed for growth.

The results are shown in FIG. 4: all colonies were able to grow on SD/-Trp/-Leu, indicating that each set of plasmids was transformed into yeast Y187. Negative controls and yeast Y187 containing plasmid pGADT7-GsNAC019/pHIS2-CIS-1 were unable to grow on SD/-Trp/-Leu/-His +50mM 3-AT, indicating that GsNAC019 is unable to bind to the NAC-CIS-1 binding element. While yeast Y187 containing plasmid pGADT7-GsNAC019/pHIS2-CIS-2 was able to grow on SD/-Trp/-Leu/-His +50mM 3-AT, indicating that GsNAC019 binds to the NAC-CIS-2 binding element.

Example 6 obtaining of GsNAC019 Arabidopsis plants and analysis of their alkali tolerance

Obtaining of GsNAC019 arabidopsis thaliana plant

1. Acquisition of GsNAC019 Gene

PCR amplification is carried out by using pEASY-Blunt Zero-GsNAC019 obtained in the step 4 in the example 1 as a template and using Primer-UA and Primer-UAS to obtain a PCR amplification product, namely a GsNAC019 gene. The primer sequences are as follows:

Primer-UA：5’-GGCTTAAU CAGTGGTTCTTTTCCTTCTGAGA-3’；

Primer-UAS：5’-GGTTTAAU AAGAATCCCCACCTATTTACACC-3’。

PCR amplification System (10. mu.l): template 1. mu.l, buffer 1. mu.l, dNTP mix (2.5mM) 0.4. mu.l, Primer-UA 0.5. mu.l, Primer-UAS 0.5. mu.l, PfuCx DNA Polymerase (TaKaRa) 0.2. mu.l, ddH₂O 6.4μl。

PCR amplification conditions: 2min at 95 ℃; 30 cycles of 95 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 1 min; 10min at 72 ℃; the reaction was terminated at 4 ℃.

2. Obtaining of plant expression vectors

Carrying out enzyme digestion on pCAMBIA330035Su vector by using restriction enzymes PacI and Nt.BbvCI, incubating the obtained vector enzyme digestion product, USER enzyme (NEB, M5505S) and GsNAC019 gene for 20min at 37 ℃, cutting uracil of the GsNAC019 gene fragment by using the USER enzyme to form a viscous end which can be complemented with pCAMBIA330035Su vector after double enzyme digestion, and recording the obtained recombinant expression vector as pCAMBIA330035Su-GsNAC 019. The obtained recombinant expression vector pCAMBIA330035Su-GsNAC019 is incubated for 20min at 25 ℃, transformed into escherichia coli competent cell DH5 alpha (whole gold, CD201-01) and sent for sequencing.

The sequencing result shows that: the GsNAC019 gene shown as a sequence 1 in a sequence table is inserted between PacI and Nt.BbvCI enzyme cutting sites of a pCAMBIA330035Su vector. The pCAMBIA330035Su vector expresses GsNAC019 protein shown in sequence 2.

3. Transformation of

The pCAMBIA330035Su-GsNAC019 vector is transformed to Agrobacterium tumefaciens LB4404 by a freeze-thawing method to obtain recombinant Agrobacterium pCAMBIA330035Su-GsNAC019/LB4404, and pCAMBIA330035Su is transformed to Agrobacterium tumefaciens LB4404 to obtain recombinant Agrobacterium pCAMBIA330035Su/LB 4404. And obtaining a positive transformant (a transformant containing the GsNAC019 gene shown in the sequence 1 in the sequence table) through PCR identification, wherein the positive transformant is used for infecting the arabidopsis thaliana plant.

4. Obtaining of GsNAC019 Arabidopsis thaliana

Infecting the recombinant agrobacterium pCAMBIA330035Su-GsNAC019/LB4404 with wild type arabidopsis (Columbia ecological col-0) by a Floral-dip method, and culturing the infected arabidopsis to obtain T₀GsNAC019 Arabidopsis seeds were transferred. Will T₀Inoculating GsNAC019 Arabidopsis thaliana seed on 1/2MS culture medium containing 25mg/L of glufosinate-ammonium, Sigma, 45520, and screening to obtain T₁GsNAC019 Arabidopsis seedlings were transferred. Repeating the steps until T is obtained₃The GsNAC019 Arabidopsis homozygote strain is transferred.

Extraction of T₃Transferring genome RNA of GsNAC019 arabidopsis seedlings, and performing RT-PCR identification. The method comprises the following specific steps:

extraction of T₃Transferring total RNA of a GsNAC019 arabidopsis plant, and performing reverse transcription to obtain cDNA; and (3) taking the cDNA AS a template, and respectively adopting a Primer-BS Primer pair, a Primer-BAS Primer pair, an Actin 2-S Primer pair and an Actin 2-AS Primer pair to detect the expression quantity of the GsNAC019 gene to obtain a PCR amplification product. The primer sequences are shown below:

Primer-BS：5’-CTTCCCGAAAGAACACTGGC-3’；

Primer-BAS：5’-CCGTTGCTGTATTGAGTGTGC-3’；

Actin 2-S：5’-TTACCCGATGGGCAAGTC-3’；

Actin 2-AS：5’-GCTCATACGGTCAGCGATAC-3’。

the PCR reaction system is as follows: mu.L of 2 × Easy Taq DNA Polymerase, 0.8. mu.L of upstream and downstream primers (10. mu.M), 1. mu.L of 100-fold diluted cDNA, sterile ddH₂O make up volume (total volume 10. mu.L).

Conditions of the PCR reaction:

GsNAC 019: the reaction was terminated at 94 ℃ for 10min → [94 ℃ for 30s → 60 ℃ for 30s → 72 ℃ for 90s ]. times.30 → 72 ℃ for 10min → 4 ℃.

And (3) Actin 2: the reaction was terminated at 94 ℃ for 10min → [94 ℃ for 30s → 60 ℃ for 30s → 72 ℃ for 90s ]. times.28 → 72 ℃ for 10min → 4 ℃.

Test result tableBright: RT-PCR of wild type Arabidopsis plants did not have amplification products, whereas T₃GsNAC019 arabidopsis homozygous lines #6 and T₃GsNAC019 Arabidopsis homozygous lines #16 and T₃The GsNAC019 Arabidopsis homozygous line #22 can amplify a target band with the size of 1032bp, which shows that the exogenous gene GsNAC019 gene not only can be successfully integrated on the genome of Arabidopsis, but also can be normally transcribed and expressed in transgenic Arabidopsis. Selecting T₃GsNAC019 arabidopsis homozygous strain No. 6 and T₃GsNAC019 arabidopsis homozygous lines 16# and T₃GsNAC019 Arabidopsis homozygous line #22 was used for next phenotypic analysis.

Phenotype analysis of GsNAC019 arabidopsis thaliana under alkaline stress

1. GsNAC019 transgenic Arabidopsis thaliana in 7mM NaHCO₃Seedling stage phenotype, root length under stress

Selecting plump wild type Arabidopsis thaliana (Columbia ecotype) and T₃GsNAC019 arabidopsis homozygous lines 6# and T₃Transferring GsNAC019 arabidopsis homozygous strain No. 16 seeds, sterilizing with 5% sodium hypochlorite disinfectant for 10min, vernalizing at 4 deg.C for 3d, and sowing on 1/2MS solid culture medium. After 1 week, GsNAC019 arabidopsis seedlings and wild type arabidopsis seedlings with consistent growth vigor are selected and horizontally placed in a 7mM NaHCO₃Arabidopsis seedlings grown in stressed medium dishes, and grown in normal medium as a control. After 12 days, the growth vigor and the root length of arabidopsis thaliana of the alkali stress treatment group and the control group are observed, and all experimental technology repetition and biological repetition are respectively carried out for 3 times. Each line was 5 strains per experiment.

The results are shown in fig. 5a and 5 b: statistical analysis of the data showed that under normal conditions, the average root length of the wild type was 68.2mm, whereas T was₃The average root length of the GsNAC019 arabidopsis homozygous line 6# is 64.8mm, and T₃The average root length of the GsNAC019 arabidopsis homozygous line 16# is 67.9 mm; in NaHCO₃Under the stress treatment condition, the average root length of the wild type is 34.0mm, and T is₃The average root length of the GsNAC019 arabidopsis homozygous line 6# is 44.0mm, and T₃The average root length of the GsNAC019 arabidopsis homozygous line 16# is 47.6mm. The above results show that: under normal conditions, T₃GsNAC019 arabidopsis homozygous lines 6# and T₃The GsNAC019 transgenic arabidopsis homozygous strain 16# has no obvious difference with the growth and development of wild arabidopsis, and shows that the introduced GsNAC019 gene does not influence the growth and development of arabidopsis at the seedling stage; in NaHCO₃Under the condition of stress treatment, the GsNAC019 arabidopsis and wild arabidopsis are inhibited in growth but are inhibited in 7mM NaHCO₃Under the treatment, the growth inhibition of the wild type is more obvious, and the root length of GsNAC019 arabidopsis is obviously longer than that of the wild type. Therefore, the GsNAC019 gene is over-expressed to improve the tolerance of arabidopsis thaliana to alkali stress at the seedling stage.

2. GsNAC019 transgenic Arabidopsis thaliana at 150mM NaHCO₃Phenotype, chlorophyll content and survival rate of treated seedling

Selecting plump wild type Arabidopsis thaliana (Columbia ecotype) and T₃GsNAC019 arabidopsis homozygous strain No. 6 and T₃GsNAC019 arabidopsis homozygous lines 16# and T₃GsNAC019 Arabidopsis homozygous line 22# seed is transferred, vernalization is carried out for 3d at 4 ℃, then the seed is sowed in a nutrition pot (nutrition soil, kaffir lily soil and vermiculite are mixed according to the ratio of 1: 1: 1), and the seed is placed in a greenhouse for culture (22 ℃ and illumination is carried out for 16 h/d). After 3 weeks, the alkali-treated seedlings were watered once every 2-3 days with 150mM NaHCO₃Solution and with unused NaHCO₃Solution-watered arabidopsis seedlings grown under normal conditions served as controls. After 15d each base treated group was observed (150mM NaHCO)₃) And a control group, and the chlorophyll content and the survival rate of each group were measured (see the literature, "plant physiology experiment/Haebipin et al, Press, Haerbin university of Industrial university, Inc., 2004.9"). All experimental technical and biological replicates were repeated 3 times each. Each line was 30 strains per experiment.

150mM NaHCO₃The growth of the treated transgenic GsNAC019 Arabidopsis thaliana and the wild type Arabidopsis thaliana is shown in FIG. 5 c: under normal conditions, T₃GsNAC019 arabidopsis homozygous strain No. 6 and T₃GsNAC019 arabidopsis homozygous lines 16# and T₃The seedling growth and development conditions of the GsNAC019 arabidopsis homozygous line 22# and wild arabidopsis are not metThe significant difference shows that the introduced GsNAC019 gene does not influence the growth and development of arabidopsis thaliana at the seedling stage; for irrigation 150mM NaHCO₃The solution becomes seedling, most leaves of the wild type become yellow and curl, and finally die, but T₃GsNAC019 arabidopsis homozygous strain No. 6 and T₃GsNAC019 arabidopsis homozygous lines 16# and T₃The leaves of the GsNAC019 Arabidopsis homozygous line No. 22 are slightly wilted, and basically completely survive and start reproductive growth.

150mM NaHCO₃Chlorophyll content and survival rate of treatment-transgenic GsNAC019 arabidopsis thaliana versus wild-type arabidopsis thaliana are shown in fig. 5d and fig. 5 e: under normal conditions, T₃GsNAC019 arabidopsis homozygous lines 6#, T₃GsNAC019 arabidopsis homozygous lines 16# and T₃The chlorophyll content and the survival rate of the GsNAC019 arabidopsis homozygous line 22# and the wild arabidopsis are not obviously different, but are 150mM NaHCO₃Under the condition of T₃GsNAC019 arabidopsis homozygous strain No. 6 and T₃GsNAC019 arabidopsis homozygous lines 16# and T₃The chlorophyll content and the survival rate of the GsNAC019 arabidopsis homozygous line 22# and the wild arabidopsis are obviously higher than those of the wild arabidopsis.

3. GsNAC019 transgenic Arabidopsis thaliana in 50mM NaHCO₃Analysis of relative expression amount of marker gene associated with alkali stress under treatment

Wild type Arabidopsis thaliana (Columbia ecotype), T₃GsNAC019 arabidopsis homozygous strain No. 6 and T₃Seeds of the GsNAC019 arabidopsis homozygous line 16# are sown on 1/2MS solid culture medium, are cultured for 10 days at 22 ℃ in illumination, are removed and are placed into a culture medium added with 50mM NaHCO ₃1/2MS liquid medium, collecting treated and untreated samples at 0h and 6h, extracting whole genome RNA and carrying out reverse transcription to obtain cDNA at each time point, and detecting the expression level of marker gene related to alkali stress by RT-PCR according to the method of 4 in the first step of the example 6. Primers for marker gene and reference gene ACTIN2 are shown in Table 3.

TABLE 3 primer sequences of marker genes

Conditions for Real-time PCR reaction: 95 ℃ 7min → [95 ℃ 15s → 60 ℃ 1min ]. times.40 → 95 ℃ 1min → 55 ℃ 1min → 95 ℃ 30 s.

Real-time PCR the gene expression was calculated by comparative CT method (. DELTA.CT) using Arabidopsis thaliana ACTIN2 gene as reference gene and untreated sample as control. The difference in target gene expression is expressed as a fold of the treated samples relative to the untreated samples at each time point. Each sample included 3 biological replicates and 3 technical replicates, and the data were averaged over 3 biological replicates, and two data were averaged if there was a large deviation in one value. The raw data is normalized. And carrying out difference significance analysis on the data subjected to the standardization treatment through T-test. The relative expression amount calculation method comprises the following steps: 2^-ΔΔCT＝2^{- (Delta CT treatment-Delta CT control)}＝2^{- [ (CT treatment target Gene-CT treatment reference Gene) - (CT control target Gene-CT control reference Gene)]}。A

The results of the detection are shown in FIG. 6. As can be seen from the figure: overexpression of GsNAC019 gene in GsNAC 019-transgenic arabidopsis thaliana makes alkali-resistant related gene H⁺The up-regulation of expression of-ATPase, RD29A and KIN occurred with little effect on the expression level of NADP-ME, RD22 and COR47 genes. GsNAC019 is presumed to be by upregulation H⁺-genes like ATPase, RD29A and KIN to improve alkali resistance in plants.

Claims (6)

1. The use of any one of the following for increasing stress resistance in a plant;

1) the protein has an amino acid sequence shown as a sequence 2 in a sequence table;

2) a nucleic acid molecule encoding the protein of 1);

3) an expression cassette comprising 2) the nucleic acid molecule;

4) a recombinant vector comprising 2) said nucleic acid molecule;

5) a recombinant vector comprising 3) said expression cassette;

6) a recombinant microorganism containing 2) said nucleic acid molecule;

7) a recombinant microorganism comprising 3) said expression cassette;

8) a recombinant microorganism containing 4) the recombinant vector;

9) a recombinant microorganism containing 5) the recombinant vector;

the plant is arabidopsis thaliana or soybean;

the stress resistance is alkali stress resistance;

the alkali stress resistance is NaHCO resistance₃And (5) stressing.

2. Use of any of the following in the breeding of transgenic plants having increased stress resistance;

1) protein, the amino acid sequence of which is shown as the sequence 2 in the sequence table;

2) a nucleic acid molecule encoding the protein of 1);

3) an expression cassette comprising 2) the nucleic acid molecule;

4) a recombinant vector comprising 2) said nucleic acid molecule;

5) a recombinant vector comprising 3) said expression cassette;

6) a recombinant microorganism containing 2) said nucleic acid molecule;

7) a recombinant microorganism comprising 3) said expression cassette;

8) a recombinant microorganism containing 4) the recombinant vector;

9) a recombinant microorganism containing 5) the recombinant vector;

the plant is arabidopsis thaliana or soybean;

the stress resistance is alkali stress resistance;

the alkali stress resistance is specifically NaHCO resistance₃And (5) stressing.

3. Use according to claim 1 or 2, characterized in that: 2) the coding sequence of the nucleic acid molecule is a cDNA molecule or a genome DNA molecule shown in 46 th-1077 th sites of a sequence 1 in a sequence table.

4. A method for producing a transgenic plant having improved stress resistance, comprising the steps of overexpressing the protein of claim 1 in a recipient plant to obtain a transgenic plant, and obtaining a transgenic plant; the transgenic plant has higher stress resistance than the recipient plant; the stress resistance is alkali stress resistance; the plant is arabidopsis thaliana or soybean;

the alkali stress resistance is specifically NaHCO resistance₃And (5) stressing.

5. The method of claim 4, wherein:

the method of overexpression comprises introducing a gene encoding the protein of claim 1 into a recipient plant;

the nucleotide sequence of the coding gene of the protein is a DNA molecule shown in sequence 1.

6. The method according to claim 4 or 5, characterized in that:

the transgenic plant has higher stress resistance than the acceptor plant and expresses higher alkali stress related genes in the transgenic plant than the acceptor plant; the alkali stress related gene is specificallyH ⁺ -ATPaseGenes and/orRD29AGenes and/orKINGene。

Images