CN115707713A

CN115707713A - Fruit shape related protein and coding gene and application thereof

Info

Publication number: CN115707713A
Application number: CN202110955318.5A
Authority: CN
Inventors: 李传友; 朱强; 邓磊; 杨天霞; 蒋红玲
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2021-08-19
Filing date: 2021-08-19
Publication date: 2023-02-21
Anticipated expiration: 2041-08-19
Also published as: CN115707713B

Abstract

The invention discloses a SlKRP7 protein related to plant fruit shape regulation and control, and a related biological material and application thereof. The SlKRP7 protein can be specifically the following protein A1), A2) or A3): a1 Protein of which the amino acid sequence is a sequence 1 in a sequence table; a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the protein of A1), has more than 90 percent of identity with the protein shown by A1) and has the activity of regulating and controlling the fruit shape of plants; a3 A fusion protein obtained by attaching a protein tag to the N-terminus or/and C-terminus of A1) or A2). SlKRP7 protein and its related biological materials can be used for transforming long fruit into round fruit.

Description

Fruit shape related protein and coding gene and application thereof

Technical Field

The invention relates to a fruit shape related protein and a coding gene and application thereof in the technical field of biology.

Background

Tomatoes are one of the most important vegetables and fruits in the world. Tomato fruits are most commonly round in shape and elongated, round fitting the aesthetic of most consumers, but round fruits are more easily crushed than elongated, elongated fruits offer consumers a new choice of shapes, and elongated fruits are more resistant to pressure. The round shape is the most prevalent shape, so it is very necessary to cultivate fruits of both shapes simultaneously.

Disclosure of Invention

The invention aims to solve the technical problem of simply and efficiently regulating and controlling the shape of the fruit of a plant.

The invention provides a protein, which is named as SlKRP7 and is the protein of A1), A2) or A3) as follows:

a1 Protein of which the amino acid sequence is a sequence 1 in a sequence table;

a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the protein of A1), has more than 90 percent of identity with the protein shown by A1) and has the activity of regulating and controlling the fruit shape of plants;

a3 A fusion protein obtained by linking a protein tag to the N-terminus or/and C-terminus of A1) or A2).

Wherein, the sequence 3 of the sequence table consists of 212 amino acid residues.

The protein can be derived from tomato (Solanum lycopersicum).

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

In the above protein, the protein tag (protein-tag) refers to a polypeptide or protein that is expressed by fusion with a target protein using in vitro recombinant DNA technology, so as to facilitate the expression, detection, tracking and/or purification of the target protein. The protein tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others.

In the above proteins, identity refers to the identity of amino acid sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, the preservation Gap cost, and the Lambda ratio to 11,1, and 0.85 (default values), respectively, and performing a calculation by searching for the identity of a pair of amino acid sequences, a value (%) of the identity can be obtained.

In the above protein, the 90% or more identity may be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

Biological materials related to the protein SlKRP7 also belong to the protection scope of the invention.

The biological material related to the protein SlKRP7 provided by the invention is any one of the following B1) to B5):

b1 Nucleic acid molecules encoding the protein;

b2 An expression cassette containing the nucleic acid molecule according to B1);

b3 A recombinant vector containing the nucleic acid molecule according to B1) or a recombinant vector containing the expression cassette according to B1);

b4 A recombinant microorganism containing the nucleic acid molecule according to B1), or a recombinant microorganism containing the expression cassette according to B2), or a recombinant microorganism containing the recombinant vector according to B3);

b5 A transgenic plant cell line containing the nucleic acid molecule according to B1), or a transgenic plant cell line containing the expression cassette according to B2), or a transgenic plant cell line containing the recombinant vector according to B3).

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In the biological material, the nucleic acid molecule of B1) is a gene represented by the following B1) or B2):

b1 The coding sequence of the coding chain is a cDNA molecule or a DNA molecule of a sequence 3 in a sequence table;

b2 The nucleotide of the coding chain is a cDNA molecule or a DNA molecule of a sequence 3 in a sequence table.

Wherein, the sequence 3 in the sequence table is composed of 639 nucleotides and encodes the protein shown in the sequence 1 in the sequence table.

In the above biological material, the expression cassette containing the nucleic acid molecule (SlKRP 7 gene expression cassette) described in B2) refers to a nucleic acid molecule capable of expressing SlKRP7 in a host cell, and the nucleic acid molecule may include not only a promoter that initiates transcription of SlKRP7 gene, but also a terminator that terminates transcription of SlKRP7. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiology 120; a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with jasmonic acid 26353; heat shock promoters (U.S. patent 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN 101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators (see, e.g., odell et al (I) ⁹⁸⁵ ) Nature 313; rosenberg et al (19)87 Gene, 56; guerineau et al (1991) mol.gen.genet, 262; proudfoot (1991) Cell, 64; sanfacon et al Genes dev., 5; mogen et al (1990) Plant Cell, 2; munroe et al (1990) Gene, 91; ballad et al (1989) Nucleic Acids Res.17:7891; joshi et al (1987) Nucleic Acid Res., 15.

The existing plant expression vector can be used for constructing a recombinant vector containing the protein SlKRP7 coding gene or the expression cassette of the protein SlKRP7 coding gene. The plant expression vector can be a Gateway system vector or a binary agrobacterium vector and the like, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pGWB18, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb. When SlKRP7 is used to construct recombinant vector, any enhanced, constitutive, tissue-specific or inducible promoter such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiqutin promoter (pUbi) and the like can be added before transcription initiation nucleotide, and can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct plant expression vectors, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are wide ranging from natural to synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound which can produce a color change (GUS gene, luciferase gene, etc.), an antibiotic marker having resistance (gentamicin marker, kanamycin marker, etc.), or a chemical-resistant marker gene (e.g., herbicide-resistant gene), etc., which can be expressed in plants.

In the above biological material, the recombinant microorganism can be yeast, bacteria, algae and fungi; the bacterium can be Agrobacterium LBA4404 strain as described.

Use of the protein or the biomaterial as described above in any one of the following:

c1 Regulating the shape of the plant fruit;

c2 Preparing a product for regulating the shape of a plant fruit;

c3 To convert the plant fruit shape from long fruit to round fruit;

c4 To prepare a product that converts the shape of the plant fruit from long fruit to round fruit.

In order to solve the technical problems, the invention also provides a plant reagent which is used for regulating and controlling the fruit shape of the plant.

The plant reagent provided by the invention contains the protein or/and biological materials related to the protein.

The active component of the plant reagent can be the protein or/and biological materials related to the protein, and the active component of the plant reagent can also contain other biological components or/and non-biological components, and the other active components of the plant reagent can be determined by the technicians in the field according to the nitrogen absorption effect of the plant.

In order to solve the technical problems, the invention also provides a method for cultivating the round fruit plants.

The method for cultivating the round fruit plants comprises the step of introducing a nucleic acid molecule for coding the protein into a target plant to obtain the round fruit plants.

The plant of interest may be a monocot or a dicot. The dicot may be any one of F1) -F4):

f1 Tubular plants of the order florida;

f2 ) plants of the Solanaceae family;

f3 Plants of the genus Lycopersicon;

f4 ) tomatoes.

In the above method, the nucleic acid molecule may be modified as follows and then introduced into the target plant to achieve better expression effect:

1) Modifying the sequence of the gene adjacent to the initiating methionine to allow efficient initiation of translation; for example, modifications are made using sequences known to be effective in plants;

2) Linking with promoters expressed by various plants to facilitate the expression of the promoters in the plants; such promoters may include constitutive, inducible, time-regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space requirements of expression, and will also depend on the target species; for example, tissue or organ specific expression promoters, depending on the stage of development of the desired receptor; although many promoters derived from dicots have been shown to be functional in monocots and vice versa, desirably, dicot promoters are selected for expression in dicots and monocot promoters for expression in monocots;

3) The expression efficiency of the gene of the present invention can also be improved by linking to a suitable transcription terminator; tml derived from CaMV, E9 derived from rbcS; any available terminator which is known to function in plants may be linked to the gene of the invention;

4) Enhancer sequences, such as intron sequences (e.g., from Adhl and bronzel) and viral leader sequences (e.g., from TMV, MCMV, and AMV) were introduced.

The nucleic acid molecules can be introduced into Plant cells by conventional biotechnological methods using Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation and the like (Weissbach, 1998, method for Plant Molecular Biology VIII, academic Press, new York, pp.411-463.

In the method, the round fruit plant can be a transgenic plant or a plant obtained by conventional breeding techniques such as hybridization.

In the above methods, the transgenic plant is understood to include not only the first to second generation transgenic plants but also the progeny thereof. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.

Transgenic experiments for introducing the SlKRP7 coding sequence into solanum lycopersicum varieties prove that compared with acceptor solanum lycopersicum, the solanum lycopersicum expressing SlKRP7 protein is changed from solanum lycopersicum to round solanum lycopersicum, which indicates that SlKRP7 protein is a gene related to the shape of the solanum lycopersicum, and that SlKRP7 protein can be used for changing the solanum lycopersicum into round solanum lycopersicum. The method of the invention has simple operation and low cost, greatly accelerates the breeding process and has wide application prospect.

Drawings

FIG. 1 is a photograph of fruit phenotypes of wild type M82 tomatoes of long fruits and transgenic homozygous tomatoes of round fruits.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

In the quantitative tests in the following examples, three replicates were set up and the results averaged.

The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The tomato variety M82 of the following examples is the American tomato genetic resource center product (TGRC, http:// TGRC. Ucdavis. Edu /), and is numbered LA3475.

The vector pGWB18 and the vector pQB used in the following examples are Addgene vector library products

(http://www.addgene.org/)。

The E.coli Top10 strain and the Agrobacterium LBA4404 strain used in the following examples were both products of Beijing-Huayu biological Limited.

The MS solid medium used in the following examples, which contained 1.0mg/L of indoleacetic acid and 1.75mg/L of zeatin and had a pH of 5.9, was a medium in which an MS minimal medium (a Beijing Huayuyo biological product) was used as a minimal medium, and indoleacetic acid and zeatin nucleoside were added to the minimal medium to obtain an indoleacetic acid concentration of 1.0mg/L, a zeatin nucleoside concentration of 1.75mg/L and a pH of 5.9.

The MS solid medium used in the following examples, which contained 1.0mg/L indole acetic acid, 1.75mg/L zeatin, 200mg/L timentin and 75mg/L kanamycin and had a pH of 5.9, was a medium based on MS minimal medium (Beijing Huayu biological product), to which indole acetic acid, zeatin, timentin and kanamycin were added to give an indole acetic acid concentration of 1.0mg/L, zeatin concentration of 1.75mg/L, timentin concentration of 200mg/L, kanamycin concentration of 75mg/L and pH of 5.9.

The MS solid medium containing 200mg/L of timentin and 50mg/L of kanamycin and having a pH value of 5.9 used in the following examples was a medium in which an MS minimal medium (Beijing Huayu biological product) was used as a basal medium, and timentin was added to the basal medium at a concentration of 200mg/L, kanamycin was 50mg/L and a pH value of 5.9.

The MS culture medium containing 150mg/L hygromycin used in the following examples was MS minimal medium (Beijing Huayu biological products) as basal medium, and hygromycin was added to the basal medium to obtain a hygromycin concentration of 150mg/L and a pH of 5.9.

The 1/2MS culture medium containing 800mg/L hygromycin used in the following examples was a 1/2MS minimal medium as a basal medium, and hygromycin was added to the basal medium to obtain a hygromycin concentration of 800mg/L and a pH of 5.9.

Example 1 transformation of siliques into round fruits by transgenic methods

The inventor of the invention finds a tomato fruit shape related gene SlKRP7, the sequence of the gene is shown as sequence 2 and consists of 990 nucleotides; the coding sequence of SlKRP7 is sequence 3 in the sequence table, which is composed of 639 nucleotides, and the protein shown in coding sequence 1 is named as protein SlKRP7.

1. Construction of recombinant vectors

Carrying out PCR amplification on the genome DNA of wild tomato M82 plants, wherein the used primer sequences are as follows:

a forward primer: 5 'ATGAGAAGAAAGTATAAGTGC-containing 3';

reverse primer: 5 'TCATTGTCGAACCCAATTCGTAGCG) -3'.

Amplifying to obtain a SlKRP7 coding sequence (the nucleotide sequence is protein shown in a sequence 3 and a coding sequence 1 in a sequence table), and recovering for later use.

And (3) digesting the entry vector pQB by using EcoRV enzyme to obtain linearized pQB, and then connecting the SlKRP7 coding sequence with the linearized pQB by using T4 ligase to obtain a connection product.

And transforming the ligation product into the competence of an escherichia coli Top10 strain, extracting a plasmid, sequencing, and identifying a clone with a correct sequence to obtain an intermediate plasmid pQB-SlKRP7.

And recombining the SlKRP7 coding sequence in the intermediate plasmid pQB-SlKRP7 into a final vector pGWB18 through an LR reaction to obtain a recombinant vector pGWB18-SlKRP7. The recombinant vector pGWB18-SlKRP7 contains a SlKRP7 coding sequence shown in a sequence 3 in a sequence table, can transcribe mRNA shown in a sequence 4 in the sequence table, and further expresses protein shown in a sequence 1 in the sequence table.

2. Obtaining and identifying transgenic tomato

One), obtaining transgenic tomato:

and (3) introducing the recombinant plasmid pGWB18-SlKRP7 obtained in the step one into the Agrobacterium LBA4404 strain to obtain a recombinant strain pGWB18-SlKRP7/LBA4404.

Infecting a long-shaped less-juice variety tomato M82 explant (a cut cotyledon is used as the explant) with a bacterial liquid of a recombinant bacterium pGWB18-SlKRP7/LBA4404, and then co-culturing for 48 hours in an MS solid culture medium containing 1.0mg/L of indoleacetic acid, 1.75mg/L of zeatin nucleoside and pH of 5.9 at the temperature of 25 +/-1.5 ℃ and the illumination intensity of 100-200 lx; transferring into MS solid culture medium containing 1.0mg/L indoleacetic acid, 1.75mg/L zeatin, 200mg/L timentin and 75mg/L kanamycin and having pH of 5.9, and culturing at 25 + -1.5 deg.C under illumination for 16h/d, dark for 8h/d and illumination intensity of 800-1200lxCulturing under the condition until a regeneration bud grows out; cutting the regenerated bud when the regenerated bud grows to 2-3cm, transferring into MS solid culture medium containing 200mg/L timentin and 50mg/L kanamycin and having pH of 5.9, culturing at 25 + -1.5 deg.C under illumination of 16h/d, dark 8h/d and illumination intensity of 800-1200lx to root, and obtaining T ₀ And (5) tomato plant generation.

II) identification of transgenic tomatoes:

on the MS culture medium containing 150mg/L hygromycin, the seedlings capable of growing roots are transgenic positive seedlings. Will T ₀ The generation-positive tomatoes and the wild type M82 tomatoes are inserted into an MS culture medium containing 150mg/L hygromycin, and compared with the wild type M82 tomatoes, the T-positive tomatoes and the wild type M82 tomatoes have the advantages that ₀ The tomato-generation has grown roots while the wild type M82 tomato has not rooted, T ₀ The generation-positive tomato is the T with the SlKRP7 gene transferred ₀ Transgenic tomato is generated.

Will T ₀ Planting transgenic tomato in greenhouse, and selfing to obtain T ₁ Transgenic tomato seeds are generated. Will T ₁ Sowing the transgenic tomato seeds on 1/2MS culture medium containing 800mg/L hygromycin, selecting 10 normal-growing seedlings, transplanting the seedlings into soil, and harvesting T from each plant ₂ Transgenic tomato seeds are generated. Each sowing 30T ₂ The generation of transgenic tomato seeds is on the 1/2MS culture medium of 800mg/L hygromycin, and the single plant with all the seeds having resistance is the transgenic homozygous tomato.

Gene expression assays showed that SlKRP7 was overexpressed by about 20-fold in transgenic tomatoes.

Three), fruit observation

The plants to be tested are the transgenic homozygous tomato obtained in the step two) and the wild type M82 tomato (used as a control plant).

And (3) growing seedlings of the plants to be detected in a greenhouse, and culturing the seedlings under the conditions of 25 ℃ and 16h of illumination/8 h of darkness for 20d. 10 seedlings with consistent growth vigor are selected from the transgenic homozygous tomatoes and the wild type M82 tomatoes and transplanted into a greenhouse, the plant spacing and the row spacing are more than 60cm, and the two materials are randomly distributed. Normal water and fertilizer management ensures that the water and fertilizer conditions of all plants are basically consistent. After the fruits turned completely red, the fruits of the transgenic homozygous tomatoes and the wild type M82 tomatoes of the control plants were compared and photographed and recorded. For each line, 15 tomato fruits were picked at random and the length and width of the fruits were measured.

The definition and formula for tomato shape is as follows:

fruits with aspect ratios greater than 1 are defined as long fruits.

A fruit with an aspect ratio of approximately 1 is defined as a round fruit.

Aspect ratio refers to the ratio of length to width.

Length refers to the longest diameter of the fruit perpendicular to the pedicel portion.

Width refers to the longest diameter of the fruit parallel to the pedicel portion.

Results as shown in fig. 1, the aspect ratio of the fruits of transgenic homozygous tomatoes, compared to the control plant wild type M82 tomatoes, was about 1.2 for the long to round M82 tomato fruits; the aspect ratio of the transgenic homozygous tomato fruit is about 1.0.

The SlKRP7 gene and the protein coded by the gene can regulate the shape of the tomato, so that the tomato material of long fruits can be converted into the tomato material of round fruits.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of genetics and developmental biology of Chinese academy of sciences

<120> fruit-shape related protein, coding gene and application thereof

<130> GNCSY212245

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 212

<212> PRT

<213> tomato (Lycopersicon esculentum)

<400> 1

Met Arg Arg Lys Tyr Lys Cys Lys Ser Lys Gly Ile Ile Gly Glu Val

1 5 10 15

Val Ile Met Glu Val Ala Glu Val Ala Val Lys Met Thr Arg Glu Arg

20 25 30

Glu Val Leu Glu Val Val Asp Thr Arg Lys Arg Lys Lys Arg Asp Gly

35 40 45

Asp Leu Glu Met Ser Pro Thr Val Ala Arg Val Arg Arg Asn Ser Val

50 55 60

Ile Ser Glu Ser Pro Ala Ser Glu Leu Ser Ser Gln Gly Asn Thr Val

65 70 75 80

Leu Cys Glu Pro Ala Val Ser Ser Asn Phe Asp Asn Val Ser Ala Ser

85 90 95

Gly Phe Gly Asp Asn Glu Ser Ser Asn Val Thr Lys Gly Ser Ser Lys

100 105 110

Phe Leu Asp Leu Asp Glu Asp Ser Val Glu Ile Ala Thr Ser Tyr Ser

115 120 125

Glu Leu Arg Glu Ser Arg Glu Ile Ile Leu Ser Ser Ser Lys Phe Lys

130 135 140

Val Glu Phe Gln Ser Thr Pro Lys Pro Gln His Ala Lys Ser Cys Arg

145 150 155 160

Arg Arg Leu Thr Glu Ala Thr Met Pro Ser Glu Ala Glu Leu Asp Val

165 170 175

Phe Phe Ala Ala Ala Glu Lys Asp Leu His Lys His Phe Ala Glu Lys

180 185 190

Tyr Asn Phe Asp Phe Ala Lys Glu Glu Pro Leu Glu Gly Arg Tyr Glu

195 200 205

Trp Val Arg Gln

210

<210> 2

<211> 990

<212> DNA

<213> tomato (Lycopersicon esculentum)

<400> 2

atgagaagaa agtataagtg caagtcgaag ggaattattg gagaagttgt gattatggag 60

gttgcggagg tagcagtgaa gatgacaaga gaacgggagg ttttagaggt ggttgacaca 120

aggaagagga agaagcgtga tggtgatttg gagatgtcac caactgtagc tcgtgttaga 180

aggaattccg taatctcaga atctccagca agcgagctta gttcccaggg aaatactgtg 240

ttgtgtgaac cggctgtgag ttcgaacttt gataacgttt cagcatctgg ttttggagat 300

aatgaatcaa gcaatgtcac aaaaggaagc tcgaaatttt tagatctgga tgtatgtgaa 360

attaaactct ttgaatttta ctagtttcgc tcttccattt ttctgctttg ttattttcag 420

gtctgatagt aatgcattag aattggagcg aattgttatg ctgttctata actgttcatt 480

tatggcggac tgatatttga atttcgaatt tcgaattttt caggaggaca gtgtggaaat 540

tgcaaccagt tattcagagt tgagagaaag gtaaatatgc attctatatg taattttaat 600

ggcgtttcaa ttcactttca gatccgcctt ttctttcaac gtttattgaa aacaaagaat 660

cattctgcag tagagagata atactatcat ccagcaaatt caaagttgaa tttcaatcca 720

caccgaaacc acaacatgct aaatcttgcc gccgccgatt gacagaggca actatgccct 780

ccgaggctga gcttgatgtg ttctttgctg cagccgagaa agatctccat aaacattttg 840

cagaaaagta caaaaactct ctctctctcc ctatctcctt ttttttcaaa attttgcatt 900

actcatgaaa gtgcgtgctg taacagatac aactttgact ttgcaaaaga ggagccattg 960

gaaggtcgct acgaatgggt tcgacaatga 990

<210> 3

<211> 639

<212> DNA

<213> tomato (Lycopersicon esculentum)

<400> 3

atgagaagaa agtataagtg caagtcgaag ggaattattg gagaagttgt gattatggag 60

gttgcggagg tagcagtgaa gatgacaaga gaacgggagg ttttagaggt ggttgacaca 120

aggaagagga agaagcgtga tggtgatttg gagatgtcac caactgtagc tcgtgttaga 180

aggaattccg taatctcaga atctccagca agcgagctta gttcccaggg aaatactgtg 240

ttgtgtgaac cggctgtgag ttcgaacttt gataacgttt cagcatctgg ttttggagat 300

aatgaatcaa gcaatgtcac aaaaggaagc tcgaaatttt tagatctgga tgaggacagt 360

gtggaaattg caaccagtta ttcagagttg agagaaagta gagagataat actatcatcc 420

agcaaattca aagttgaatt tcaatccaca ccgaaaccac aacatgctaa atcttgccgc 480

cgccgattga cagaggcaac tatgccctcc gaggctgagc ttgatgtgtt ctttgctgca 540

gccgagaaag atctccataa acattttgca gaaaaataca actttgactt tgcaaaagag 600

gagccattgg aaggtcgcta cgaatgggtt cgacaatga 639

<210> 4

<211> 639

<212> RNA

<213> tomato (Lycopersicon esculentum)

<400> 4

augagaagaa aguauaagug caagucgaag ggaauuauug gagaaguugu gauuauggag 60

guugcggagg uagcagugaa gaugacaaga gaacgggagg uuuuagaggu gguugacaca 120

aggaagagga agaagcguga uggugauuug gagaugucac caacuguagc ucguguuaga 180

aggaauuccg uaaucucaga aucuccagca agcgagcuua guucccaggg aaauacugug 240

uugugugaac cggcugugag uucgaacuuu gauaacguuu cagcaucugg uuuuggagau 300

aaugaaucaa gcaaugucac aaaaggaagc ucgaaauuuu uagaucugga ugaggacagu 360

guggaaauug caaccaguua uucagaguug agagaaagua gagagauaau acuaucaucc 420

agcaaauuca aaguugaauu ucaauccaca ccgaaaccac aacaugcuaa aucuugccgc 480

cgccgauuga cagaggcaac uaugcccucc gaggcugagc uugauguguu cuuugcugca 540

gccgagaaag aucuccauaa acauuuugca gaaaaauaca acuuugacuu ugcaaaagag 600

gagccauugg aaggucgcua cgaauggguu cgacaauga 639

Claims

1. A protein, wherein the protein is a protein of A1), A2) or A3) as follows:

a1 Protein with the amino acid sequence of sequence 1 in the sequence table;

a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the protein of A1), has more than 90 percent of identity with the protein shown by A1) and has the function of regulating and controlling the fruit-shaped activity of plants;

2. The protein of claim 1, wherein said protein is derived from tomato.

3. The protein-related biomaterial according to claim 1 or 2, characterized by being any one of the following B1) to B5):

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule according to B1);

4. The biomaterial according to claim 3, wherein the nucleic acid molecule of B1) is a gene represented by the following B1) or B2):

5. Use of the protein of claim 1 or 2, or the biomaterial of claim 3 or 4 in any one of the following:

c1 Regulating the shape of the plant fruit;

c2 Preparing a product for regulating the shape of a plant fruit;

c3 To convert the plant fruit shape from long fruit to round fruit;

c4 To produce a product that converts plant fruit shapes from long fruit shapes to round fruit shapes.

6. A plant agent comprising the protein of claim 1 or 2 or the biomaterial of claim 3 or 4, wherein the plant agent is a plant agent that regulates the fruit shape of a plant.

7. A method of producing a round fruit plant, comprising introducing a nucleic acid molecule encoding the protein of claim 1 or 2 into a plant of interest to produce a round fruit plant.

8. The method of claim 7, wherein the plant of interest is a monocot or a dicot.

9. The method according to claim 8, wherein the dicotyledonous plant is any one of F1) to F4):

f1 Tubular plants of the order florida;

f2 Solanaceae plants;

f3 ) plants of the genus Lycopersicon;

f4 ) tomatoes.