CN115612728A

CN115612728A - Neurodegenerative disease marker and application thereof

Info

Publication number: CN115612728A
Application number: CN202110805221.6A
Authority: CN
Inventors: 陈宇; 屈雪琪; 林力; 陈岳文
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2021-07-16
Filing date: 2021-07-16
Publication date: 2023-01-17
Also published as: WO2023284035A1

Abstract

The invention relates to a neurodegenerative disease marker and application thereof. The neurodegenerative disease marker comprises a cystatin C coding gene NM _009976.4. The invention discovers for the first time that the expression of the cystatin C coding gene in brain tissues (cortex, hippocampus and nerve synapse) of the Alzheimer's disease is reduced, the level of the cystatin C protein in peripheral blood serum of the Alzheimer's disease is increased, and early diagnosis of the Alzheimer's disease can be carried out by detecting the indexes.

Description

Neurodegenerative disease marker and application thereof

Technical Field

The invention belongs to the technical field of biological detection, and relates to a neurodegenerative disease marker and application thereof.

Background

Alzheimer's Disease (AD) is a progressive degenerative disease of the nervous system with occult onset, characterized clinically by memory impairment, aphasia, disuse, agnosia, impairment of visuospatial skills, impairment of executive function, and alterations in personality and behavior.

Because the disease course of AD is an irreversible process, and no specific medicine or cure means aiming at the disease is available at present, the key point of AD treatment lies in early diagnosis, intervention is carried out on AD in early stage of disease and the disease course is delayed, but no accurate method for early prediction or diagnosis of AD exists at present.

The current diagnostic methods for AD are mainly combined diagnosis, mainly including: neuropsychological assessment, cognitive impairment testing; brain senile plaques and Tau protein PET scan; brain nuclear Magnetic Resonance (MRI) and cerebrospinal fluid (CSF) markers, beta-amyloid, phosphorylated tau protein detection and the like (see Selkoe DJ. Alzheimer disease and aducanumab: adjusting outer autoproach. Nat Rev Neurol.2019;15 (7): 365-6), but because AD early symptoms are not obvious, when the disease is clearly diagnosed, a patient mostly reaches the late stage of the disease course, most neurons die, if rapid diagnosis can be carried out in the early stage of the disease course of the patient or a potential patient is found risk in advance, and treatment or prevention is carried out specifically, so that the disease course of the patient can be remained in a slight mental impairment (MCI) stage to slow deterioration, thereby ensuring the life quality of the patient and reducing social burden.

At present, early molecular screening technologies for AD include Positron Emission Tomography (PET) and level detection of cerebrospinal fluid Α β molecules, where the former needs to inject a certain dose of radioactive substance into a subject, and the latter has a large operation damage and is prone to surgical infection, and the reliability of the above diagnostic technologies for early diagnosis of AD is unstable, so that it is difficult to use the technologies for early screening of AD.

Therefore, the development of new markers for early diagnosis of AD is one of the important directions for AD diagnosis and treatment in the future.

Cystatin C (CST 3), a protein encoded by the CST3 gene, also called Cystatin C, is involved in the regulation of the innate immune system and circadian rhythm-related signaling pathways, and studies have shown that CST3 is present in almost all tissues and fluids in the body, and is involved in the regulation of cardiovascular diseases (see: go AS, chertow GM, fan D, mcCulloch CE, hsu CY. Chronic kit disease and the disorders of disease, cardiovascular events, and physiology.the New England patent of medicine 2004;351 (13): 1296-305), brain dysfunction of amyloid-exerting brain and the development of age-related diseases (see: chuo LJ, sheu MC, pai, kuo. Genotype and cell of brain related diseases and diagnosis of health related diseases, and diagnosis C251-2007; 3. See: chuo LJ, sheu Mc, sheu MC, pai, kuo.

At present, the use of CST3 as the detection standard of AD has not been recorded in the prior art.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a neurodegenerative disease marker and application thereof, the marker can be used for carrying out early diagnosis on Alzheimer's disease by detecting the expression level of the marker, and has the characteristics of timeliness, convenience, high specificity and high sensitivity.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a neurodegenerative disease marker comprising a cystatin C-encoding gene NM _009976.4.

According to the present invention, it is found for the first time that the expression of the cystatin C coding gene in the brain tissue of alzheimer's disease (cortex, hippocampus and neurosynapses) is down-regulated, while the level of cystatin C protein in the peripheral serum or plasma of alzheimer's disease is increased, by analyzing the expression level of the cystatin C coding gene NM _009976.4, to perform early diagnosis of alzheimer's disease, including analyzing the level of mRNA transcribed from the cystatin C coding gene and/or the level finally translated into cystatin C protein.

According to the invention, the neurodegenerative disease comprises alzheimer's disease.

According to the invention, said early diagnosis refers to a period in which no amyloid is present in the brain of the subject.

Cystatin C protein levels can be determined by enzyme-linked immunosorbent assay (ELISA) according to the invention. In the invention, the nucleic acid sequence of cystatin C coding gene NM _009976.4 is shown in SEQ ID No. 15.

SEQ ID No.15：

ATGGCCAGCCCGCTGCGCTCCTTGCTGTTCCTGCTGGCCGTCCTGGCCGTGGCCTGGGCGGCGACCCCAAAACAAGGCCCGCGAATGTTGGGAGCCCCGGAGGAGGCAGATGCCAATGAGGAAGGCGTGCGGCGAGCGTTGGACTTCGCTGTGAGCGAGTACAACAAGGGCAGCAACGATGCGTACCACAGCCGCGCCATACAGGTGGTGAGAGCTCGTAAGCAGCTCGTGGCTGGAGTGAACTATTTTTTGGATGTGGAGATGGGCCGAACTACATGTACCAAGTCCCAGACAAATTTGACTGACTGTCCTTTCCATGACCAGCCCCATCTGATGAGGAAGGCACTCTGCTCCTTCCAGATCTACAGCGTGCCCTGGAAAGGCACACACTCCCTGACAAAATTCAGCTGCAAAAATGCCTAA。

In a second aspect, the present invention provides a primer composition for detecting the expression level of the neurodegenerative disease marker according to the first aspect, wherein the primer composition comprises the nucleic acid sequences shown as SEQ ID No.1 and SEQ ID No. 2.

SEQ ID No.1：atacaggtggtgagagctcg。

SEQ ID No.2：tgccttcctcatcagatggg。

In a third aspect, the invention provides the application of the neurodegenerative disease marker in the first aspect or the primer composition for detecting the expression level of the neurodegenerative disease marker in the second aspect in preparing a product for detecting neurodegenerative diseases.

In a fourth aspect, the present invention provides a kit for detecting a neurodegenerative disease, the kit comprising the primer composition for detecting an expression level of a neurodegenerative disease marker according to the second aspect.

Preferably, the kit further comprises any one of or a combination of at least two of an RNA extraction reagent, a reverse transcription reagent, or a transcriptome detection reagent.

Preferably, the kit further comprises a primer for detecting the housekeeping gene.

Preferably, the housekeeping gene comprises GAPDH and/or HPRT.

Preferably, the detection primer of GAPDH comprises the nucleic acid sequences shown in SEQ ID No.3 and SEQ ID No. 4.

Preferably, the detection primer of HPRT comprises the nucleic acid sequences shown as SEQ ID No.5 and SEQ ID No. 6.

SEQ ID No.3：TCAACAGCAACTCCCACTCTTCCA。

SEQ ID No.4：ACCCTGTTGCTGTAGCCGTATTCA。

SEQ ID No.5：GGAGTCCTGTTGATGTTGCCAGTA。

SEQ ID No.6：GGGACGCAGCAACTGACATTTCTA。

In a fifth aspect, the present invention provides a method for using the kit for detecting neurodegenerative disease of the fourth aspect for non-disease diagnosis and/or treatment, the method comprising:

obtaining total RNA of the brain synapse to be detected, carrying out reverse transcription to obtain cDNA, carrying out transcriptome sequencing or real-time fluorescent quantitative PCR by using the kit for detecting the neurodegenerative disease, and analyzing the expression level of the cystatin C coding gene.

In a sixth aspect, the present invention provides an inhibitor of expression of the neurodegenerative disease marker of the first aspect, wherein the inhibitor of expression of the neurodegenerative disease marker comprises any one or a combination of at least two of shRNA, siRNA, dsRNA, miRNA or antisense nucleic acid of cystatin C-encoding gene NM _009976.4.

Preferably, the siRNA comprises the nucleic acid sequence shown in SEQ ID No.13 or SEQ ID No. 14.

SEQ ID No.13：CCCAGACAAATTTGACTGACT。

SEQ ID No.14：CGAGTACAACAAGGGCAGCAA。

In a seventh aspect, an expression vector that expresses the inhibitor of expression of the neurodegenerative disease marker of the sixth aspect.

In an eighth aspect, a composition comprising an inhibitor of expression of a neurodegenerative disease marker of the sixth aspect or an expression vector of the seventh aspect.

According to the invention, the expression inhibitor of the neurodegenerative disease marker can reduce the expression of the cystatin C coding gene NM _009976.4, and can be applied to the research of verifying the relevance of the expression level of the cystatin C coding gene and diseases.

Compared with the prior art, the invention has the following beneficial effects:

the invention discovers that the expression of the cystatin C coding gene in brain tissues (cortex, hippocampus and nerve synapse) of the Alzheimer's disease is reduced, the level of the cystatin C protein in peripheral serum or blood plasma of the Alzheimer's disease is increased for the first time, the early diagnosis of the Alzheimer's disease can be carried out by detecting the expression level of the marker, and the invention has the characteristics of timeliness, convenience, high specificity and high sensitivity.

Drawings

FIG. 1A is a volcano of neurodegenerative disease-associated genes in 3-month old littermate wild-type and AD mice;

FIG. 1B is a volcano of neurodegenerative disease associated genes in 6-month old littermate wild-type and AD mice;

FIG. 2 is a heat map of RNA-seq analysis of neurodegenerative disease-related gene expression in brain synapses, wherein the representation with grid-filled markers is upregulated, the unlabeled representation is downregulated, different gray levels represent different degrees of differentiation, and darker gray levels represent higher degrees of differentiation;

FIG. 3 is a data classification analysis chart, which takes FDR (false discovery rate) <0.01 gene, wherein the gene with expression variation greater than 2 is found, 1 is amyloid beta protein binding, 2 is negative regulation dendritic spine, 3 is copper ion binding, 4 is regulation of age-associated behavioral decline, 5 is regulation of calcium ion entry through cell membrane, 6 is protein binding, 7 is detoxification of copper ion, 8 is protection of glial cell, 9 is myelin sheath, and 10 is regulation of chemical synapse;

FIG. 4A is a graph showing the expression level of CST3 in cerebral cortex and hippocampus of 3-month-old and 6-month-old littermate wild-type and AD mice;

FIG. 4B is a graph of CST3 expression levels in Synaptosomes (SD) of 3-and 6-month-old littermates and AD mice;

FIG. 5A is a graph of primary neurons after calcium phosphate transfection experiments;

fig. 5B is a graph of primary neuron dendritic spines and synaptosome densities;

fig. 6 is a graph of CST3 secreted protein levels in peripheral blood serum of wild type mice (WT) and AD mice (AD) at 3 and 6 months of age.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Materials, apparatus and methods:

the used transgenic AD mouse strain is from a Jackson laboratory, is bred and fed in an SFP animal house of Shenzhen advanced technology research institute of Chinese academy of sciences, and the operation accords with animal ethics and experimental specifications; relevant surgical instruments for dissection are purchased from rewelder; ultracentrifuge and associated rotor and centrifuge tubes were purchased from Beckman corporation; gradient centrifuges are from Thermo Fisher Scientific; TRIZOlTMReagent is available from INVitrogen; RNA-seq service and primary data processing service are provided by Novogene corporation; phosphate Buffered Saline (PBS), etc. manufactured by Gibco corporation; SYBR Green and the corresponding qPCR detection instrument are from Thermo Fisher Scientific; the CST3 quantitative detection ELISA kit is from R & D company (cargo number: MSCTC 0); a microplate reader for quantitative determination of CST3 was supplied by BioTek.

Example 1

This example collected brain tissue samples.

A3-month-old (3M) and 6-month-old (6M) littermate Wild Type (WT) and AD mice (AD) are anesthetized with isoflurane (gas), the ends of the mice are quickly cut off by scissors after menopause and killed, the heads of the mice are placed on ice, cerebral cortex is quickly separated, cerebral cortex and hippocampal tissues of the mice are separated, and the separated tissues are washed twice by using DPBS (deep-brain barrier) containing 4U/mL protease inhibitors and RNase inhibitors, so that cerebral cortex tissue samples are obtained.

Example 2

This example isolated and purified brain neurosynaptic (SD) comprising the following steps:

(1) Placing the cerebral cortex tissue sample obtained in example 1 on ice, removing pia mater and vascular tissue in a tissue homogenate balanced solution containing a protease inhibitor and an RNase inhibitor, taking 2mL of cerebral cortex, placing the cerebral cortex in the same tissue homogenate balanced solution for homogenization, and filtering the tissue homogenate with a 40 μm tissue filter to remove large tissue fragments;

(2) Centrifuging the filtered tissue homogenate at 4 deg.C and 10000 Xg for 10min, and collecting precipitate;

(3) Subsequently suspending the pellet in tissue homogenate equilibration solution of 35% OptiPrep, placing in an OptiPrep gradient centrifuge tube of 9%, 12.5%, 15%, 25% and 35%, performing gradient centrifugation at 10000 Xg at 4 ℃ for 24 minutes, and collecting the suspension between 9% and 12.5% interfaces, namely the suspension containing the brain synaptosome;

(4) The collected brain synaptosomal suspension was centrifuged at 6000 Xg for 30 minutes at 4 ℃ to obtain a pellet, which was the brain Synapse (SD).

Example 3

This example was carried out for RNA extraction.

Total RNA in brain tissue (cortex and hippocampus) and brain synapses was extracted by Trizon method, which refers to the instructions of TRIzol TMReagent of Invitrogen company, as follows:

(1) Preparing reagents: chloroform, isopropanol, 75% ethanol, RNase-free water, and the solution is prepared by DEPC treated water;

(2) The method comprises the following operation steps:

1) And (3) homogenization treatment: grinding the tissue or cells in liquid nitrogen, adding 1mL of TRIzol per 100mg of tissue, and homogenizing with a homogenizer, wherein the sample volume should not exceed 10% of that of TRIzol;

2) Placing the homogenate sample at 25 ℃ for 5 minutes to completely separate the nucleic acid protein complex;

3) Adding 0.2mL of chloroform into 1mL of TRIzol, vigorously shaking for 15 seconds, and standing at 25 ℃ for 3 minutes;

4) Centrifuging at 4 deg.C and 10000 Xg for 15min, wherein RNA is mainly in water phase;

5) Transferring the aqueous phase to a new tube, precipitating the RNA in the aqueous phase with isopropanol, adding 0.5mL of isopropanol for each 1mL of TRIzol, and standing at room temperature for 10 minutes;

6) Centrifuging at 10000 Xg for 10min at 4 deg.C, and removing supernatant;

7) Washing RNA precipitate with 75% ethanol, adding at least 1mL 75% ethanol to 1mL TRIzol, centrifuging at 4 deg.C and 6500 Xg for 5min, and removing supernatant;

8) The dried RNA precipitate was left at 25 ℃ for 6 minutes, 100. Mu.L of RNase-free water was added, the mixture was left at 60 ℃ for 10 minutes to dissolve the RNA, and the mixture was stored at-70 ℃.

Example 4

This example was performed for cDNA synthesis, transcriptome sequencing (RNA-seq) and quantitative PCR detection.

The cDNA synthesis was performed using reverse transcription kit K1632 from ThermoFisher, reverse transcription of the RNAs from different sources obtained in example 3 into cDNA, and quantitative RT-PCR detection of the synthesized cDNA was performed (reaction procedure: pre-denaturation: incubation at 95 ℃ for 10min; cyclic amplification: incubation at 95 ℃ for 1min at 60 ℃ for 1min; melting curve: incubation at 95 ℃ for 60s; number of cyclic amplification for 40 times; rate of temperature rise and drop during the detection reaction was 1.6 ℃/s.

And transcriptome sequencing, using the housekeeping genes GAPDH and HPRT as reference genes.

The CST3 gene amplification sequence is NM-009976.4.

The CST3 gene amplification primers are as follows:

F：atacaggtggtgagagctcg(SEQ ID No.1)，R：tgccttcctcatcagatggg(SEQ ID No.2)。

the GAPDH gene amplification sequence is NM _008084.3.

The GAPDH gene amplification primers are as follows:

F：tcaacagcaactcccactcttcca(SEQ ID No.3)，R：accctgttgctgtagccgtattca(SEQ ID No.4)。

the HPRT gene amplification sequence is NM-013556.2.

The HPRT gene amplification primers are as follows:

F：ggagtcctgttgatgttgccagta(SEQ ID No.5)，R：gggacgcagcaactgacatttcta(SEQ ID No.6)。

the cDNA from a brain neuron synapse sample is amplified and sequenced in a high-throughput manner through RNA-seq, data analysis is performed by bioinformatics, volcanic graphs and heat maps are drawn, gene enrichment analysis (GO analysis) is performed, in the GO analysis, the difference between wild type mice and AD type mice is analyzed and compared, the gene of FDR (false discovery rate) <0.01 is screened, the gene with the relative expression difference of more than 2 times is subjected to gene enrichment analysis, and 12 genes with remarkable differences are enriched in a pathway related to energy metabolism and are obviously associated with neurodegenerative diseases.

As a result of analysis of volcano plots (fig. 1A and 1B) and heat maps (fig. 2), it was found that CST3 expression was significantly reduced in the 3-month-old mice and the 6-month-old mice compared to the littermate wild-type group and the AD group, and differential expression was more significant as time passed by comparing the expression difference between the 3-month-old and 6-month-old AD mice.

Through gene function enrichment analysis (GO analysis) on genes with remarkable transcriptome gene expression, 12 genes with remarkable difference are enriched in energy metabolism related pathways, and remarkable association with signal pathways of AD diseases can be found, wherein a core gene is CST3, and the CST3 gene function is mainly enriched in: recognition binding of a β, regulation of dendritic spines, pathways such as protein binding, regulation of age-related neurodegenerative diseases, etc. (fig. 3), and thus, CST3 can be used as a candidate biomarker for early diagnosis of neurodegenerative diseases.

The difference of CST3 gene expression in different time periods is verified by adopting quantitative RT-PCR (qRT-PCR) to RNA of brain neuron synaptic samples, cerebral cortex tissues and brain hippocampus tissues of wild mice and AD mice, the data is processed by applying GraphPad Prism software, a statistical method adopts T test, and the difference has statistical significance by taking P <0.05 as the difference.

The qRT-PCR results are shown in fig. 4A and 4B, and for cerebral cortex and hippocampus results (fig. 4A), AD mice had significantly reduced CST3 expression compared to both 3 and 6 month old wild-type mice and AD mice, while for cerebral synapse results (fig. 4B), AD mice had significantly reduced CST3 expression compared to AD mice, while 6 month old mice did not show this difference.

From the above experimental results, it can be seen that different detection methods and different detection sources all affect the early diagnosis of alzheimer's disease, and the RNA-seq result and the qPCR result are combined, and both show the same trend for the early detection result of the neuronal dendrites, that is, the expression level of CST3 in the neuronal dendrites is significantly reduced in the early development of alzheimer's disease, and for the AD mouse model, amyloid plaques do not appear in the brains of mice of 3 months of age, while amyloid plaques already appear in the brains of mice of 6 months of age, both the qPCR result and the RNA-seq result show that the expression level of CST3 before amyloid plaques appear has significant difference, which indicates that the expression level of CST3 in neuronal synapses can be used as a marker of early alzheimer's disease for early screening and detection of alzheimer's disease.

Example 5

This example performs a primary neuronal calcium phosphate transfection experiment.

shRNA, siRNA, dsRNA and miRNA all belong to interfering RNA and can be applied to reducing target gene expression.

The primers used for each set of plasmids were as follows:

shCST3 1#：

F：gatctcccccagacaaatttgactgactttcaagagaagtcagtcaaatttgtctgggtttttggaac(SEQ ID No.7)；

R：tcgagttccaaaaacccagacaaatttgactgacttctcttgaaagtcagtcaaatttgtctggggga(SEQ ID No.8)。

shCST3 2#

F：gatctcccgagtacaacaagggcagcaattcaagagattgctgcccttgttgtactcgtttttggaac(SEQ ID No.9)；

R：tcgagttccaaaaacgagtacaacaagggcagcaatctcttgaattgctgcccttgttgtactcggga(SEQ ID No.10)。

scr-CST3：

F：gatctccgaaggtcgagatgctctgtttcaagagaacagagcatctcgaccttctttttggaac(SEQ ID No.11)；

R：tcgagttccaaaaagaaggtcgagatgctctgttctcttgaaacagagcatctcgaccttcgga(SEQ ID No.12)。

the siRNA sequences expressed by shCST3 # and shCST3 # obtained by sequencing are respectively as follows:

CST3 siRNA 1#：CCCAGACAAATTTGACTGACT(SEQ ID No.13)；

CST3 siRNA 2#：CGAGTACAACAAGGGCAGCAA(SEQ ID No.14)。

taking rat embryo hippocampal tissue of a pregnant rat at 18 days, and carrying out in-vitro primary culture of hippocampal neurons, wherein the culture method of the primary neurons comprises the following steps:

(1) Separation of hippocampal tissues: after a pregnant mouse is sacrificed for 18 days, the abdomen of the pregnant mouse is cut off by scissors quickly, an embryo is taken out and put on a 100mm cell culture dish and placed on ice, after placenta is separated, brain tissue is separated and placed in CMF-HBSS, hippocampal tissue is stripped and placed in a 15mL centrifuge tube which is filled with CMF-HBSS in advance;

(2) Transferring the separated hippocampus to a super clean bench, washing the hippocampus twice by using CMF-HBSS, transferring hippocampus tissues, putting the tissue into a new 15mL centrifuge tube, adding 10mLCMF-HBSS/Trysin (9 mL CMF-HBSS,1mL Trysing,100mL Dnase), and then placing the tissue in a water bath at 37 ℃ for digestion for 15min;

(3) After digestion, adding a Trysin inhibitor with the volume of 1;

(4) Adding 2.5mL of NB, gently shaking to wash the hippocampal tissue, discarding the NB, and repeating the washing once;

(5) Adding 5mL of NB, gently and repeatedly blowing and beating 13 times by using a 1mL pipette, uniformly mixing, filtering by using a 70-mu L filter membrane, and counting cells;

(6) 2x 10 to ⁶ The individual cells were treated in a 60mm petri dish with 4 coverslips and the CO was reduced at 5% ₂ Incubating at 37 deg.C for 30min in incubatorAfter the medium in the plate was completely aspirated, 1mL of NB was added, and the total concentration of CO was continued at 5% ₂ Incubating for 30min at 37 ℃ in an incubator;

(7) After the incubation was completed, 60mm medium cover glass slides were directly mounted in 12-well plates, the medium was added, and the content of CO was further reduced to 5% ₂ The culture was carried out at 37 ℃ in an incubator, and half of the culture was changed after 5 days, and half of the culture was changed every 5 days.

And performing calcium phosphate transfection assay on day 14 by placing the glass slide with neurons cultured on the inner surface of 24-well plate in balanced 1.5mL DMEM medium, adding 7.5% CO ₂ Starving in an incubator for 1 hour, preparing plasmids and transfection reagents, wherein the experiment is divided into 4 groups, the plasmids adopt pSUPER vector plasmid (blank group), pSUPER vector plasmid (negative control) for transfecting scr-CST3, SUPER vector plasmid for transfecting shCST31# and pSUPER vector plasmid for transfecting shCST3 # respectively, and required amounts of the plasmids and 5 mu L2M CaCl are added ₂ Adding into water to prepare 50 μ L system, adding 50 μ L2 × HBS (pH = 7.05) dropwise while adding CaCl while vortexing ₂ Standing in dark environment for about 20 min to form transfection solution, adding the transfection solution dropwise into the glass slide in the hole, and adding 7.5% CO ₂ The incubator was left to stand for 15 minutes, then washed 2 times with 1mL of DMEM, the slide was put into the neuron maintenance medium, and put back to 5% CO ₂ And (3) carrying out half liquid change in an incubator after 1 hour, continuing to culture the neurons for 2.5 days after transfection is finished, fixing the neurons by 4% paraformaldehyde, fixing the neurons on a glass slide, and imaging by using a confocal microscope. The results are shown in FIGS. 5A and 5B.

As can be seen from fig. 5A and 5B, the density and size of dendritic spines and synapses in neurons transfected with CTS3 gene expression interference plasmid (pSUPER-shCST 3) were reduced compared to neurons transfected with empty vector (pSUPER) only, the dendritic spines are prominent structures on the dendritic stems of neurons as the main structure of postsynaptic components in synaptic structures, the dendritic spines are the most direct anatomical structures of synaptic communication and transmission, and the dynamic changes in its formation and degradation are widely recognized as indicators of synaptic plasticity, and studies have shown that the length, number and density of dendritic spines and synapses in AD mice are significantly less than those in wild-type mice, and that the reduction in dendritic spine and synaptic length and density occurs before plaque amyloid appears, i.e., the characteristics occur early in alzheimer's, and the experimental results of the present invention demonstrate that the reduction in CST3 gene expression can cause synaptic spines to become small, and from the results of transfection, the CST3 gene expression in early brain neurons in alzheimer's can be taken as the results of early alzheimer's RNA and pcr-qq results of the early synaptic anastomosis of the AD-RNA.

Example 6

This example quantitatively detects the CST3 protein in serum.

The level of CST3 protein was measured in peripheral blood serum of 3-month old (3M) and 6-month old (6M) wild type mice (WT) and AD mice (AD) using ELISA test kit, with the following specific steps:

(1) After 3-month-old and 6-month-old littermate wild-type and AD mice were anesthetized with isoflurane gas, blood samples of the mice were collected by fundus blood sampling into a 1.5mL sterile EP tube, the neck was broken and the mice were sacrificed by rapid decapitation with scissors and serum was separated as follows:

1) Placing the anticoagulation sample at 4 ℃ and standing for 4 hours to naturally separate out serum;

2) After the serum is naturally separated out, centrifuging at 4 ℃ and 4000rpm for 30 minutes, separating the serum, removing insoluble substances, transferring the serum to a new sterilized EP tube, and storing at-80 ℃;

(2) The content of CST3 protein in serum is detected by using an ELISA detection kit, and the detection method comprises the following steps:

1) Add 50. Mu.L of assay diluent RD1W to the test wells;

2) Sequentially adding a standard substance, a control sample and a sample to be tested into the test hole, sealing by using a sealing film provided in the kit, and incubating at room temperature for 2h;

3) After the incubation is finished, tearing off the sealing film, discarding the liquid, adding 400 mu L of washing liquid into each hole to wash the detection plate for 4 times, and discarding the washing liquid;

4) Adding 100 mu L of mouse CST3 conjugate into the test hole, sealing by a sealing film, and incubating at room temperature for 2h;

5) Repeating the step (3) for 1 time;

6) Adding 100 μ L of prepared luminescent reagent into the test hole, and incubating at room temperature for 39min in a dark place;

7) Adding 100 μ L of stop solution, and flicking the test board to ensure sufficient mixing;

8) Reading a plate: optical density detection of each well was completed within 30min;

9) And (3) calculating: and (4) carrying out concentration quantitative calculation according to a formula provided by the kit.

As a result, as shown in fig. 6, it is seen from fig. 6 that the level of CST3 protein in the peripheral blood serum of AD mice was significantly increased compared to that of wild type mice.

In conclusion, the invention discovers for the first time that the expression of cystatin C coding genes in brain tissues (cortex, hippocampus and nerve synapse) of Alzheimer's disease is reduced, the level of cystatin C protein in peripheral serum of Alzheimer's disease is increased, and early diagnosis of Alzheimer's disease can be carried out by detecting the indexes.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modifications of the present invention, equivalent substitutions of the raw materials of the product of the present invention, and the addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Shenzhen advanced technology research institute

<120> neurodegenerative disease marker and application thereof

<130> 2021

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

atacaggtgg tgagagctcg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

tgccttcctc atcagatggg 20

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<400> 3

tcaacagcaa ctcccactct tcca 24

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

accctgttgc tgtagccgta ttca 24

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

ggagtcctgt tgatgttgcc agta 24

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<400> 6

gggacgcagc aactgacatt tcta 24

<210> 7

<211> 68

<212> DNA

<213> Artificial sequence

<400> 7

gatctccccc agacaaattt gactgacttt caagagaagt cagtcaaatt tgtctgggtt 60

tttggaac 68

<210> 8

<211> 68

<212> DNA

<213> Artificial sequence

<400> 8

tcgagttcca aaaacccaga caaatttgac tgacttctct tgaaagtcag tcaaatttgt 60

ctggggga 68

<210> 9

<211> 68

<212> DNA

<213> Artificial sequence

<400> 9

gatctcccga gtacaacaag ggcagcaatt caagagattg ctgcccttgt tgtactcgtt 60

tttggaac 68

<210> 10

<211> 68

<212> DNA

<213> Artificial sequence

<400> 10

tcgagttcca aaaacgagta caacaagggc agcaatctct tgaattgctg cccttgttgt 60

actcggga 68

<210> 11

<211> 64

<212> DNA

<213> Artificial sequence

<400> 11

gatctccgaa ggtcgagatg ctctgtttca agagaacaga gcatctcgac cttctttttg 60

gaac 64

<210> 12

<211> 64

<212> DNA

<213> Artificial sequence

<400> 12

tcgagttcca aaaagaaggt cgagatgctc tgttctcttg aaacagagca tctcgacctt 60

cgga 64

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence

<400> 13

cccagacaaa tttgactgac t 21

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<400> 14

cgagtacaac aagggcagca a 21

<210> 15

<211> 423

<212> DNA

<213> Artificial sequence

<400> 15

atggccagcc cgctgcgctc cttgctgttc ctgctggccg tcctggccgt ggcctgggcg 60

gcgaccccaa aacaaggccc gcgaatgttg ggagccccgg aggaggcaga tgccaatgag 120

gaaggcgtgc ggcgagcgtt ggacttcgct gtgagcgagt acaacaaggg cagcaacgat 180

gcgtaccaca gccgcgccat acaggtggtg agagctcgta agcagctcgt ggctggagtg 240

aactattttt tggatgtgga gatgggccga actacatgta ccaagtccca gacaaatttg 300

actgactgtc ctttccatga ccagccccat ctgatgagga aggcactctg ctccttccag 360

atctacagcg tgccctggaa aggcacacac tccctgacaa aattcagctg caaaaatgcc 420

taa 423

Claims

1. A neurodegenerative disease marker, wherein said neurodegenerative disease marker comprises a cystatin C encoding gene NM _009976.4.

2. A primer composition for detecting the expression level of the neurodegenerative disease marker as set forth in claim 1, wherein the primer composition comprises nucleic acid sequences shown as SEQ ID nos. 1 and 2.

3. Use of the neurodegenerative disease marker of claim 1 or the primer composition for detecting the expression level of the neurodegenerative disease marker of claim 2 in the preparation of a product for detecting neurodegenerative disease.

4. A kit for detecting neurodegenerative disease, comprising the primer composition for detecting the expression level of the neurodegenerative disease marker of claim 2.

5. The kit of claim 4, wherein the kit further comprises any one or a combination of at least two of an RNA extraction reagent, a reverse transcription reagent, or a transcriptome detection reagent;

preferably, the kit further comprises a primer for detecting a housekeeping gene;

preferably, the housekeeping gene comprises GAPDH and/or HPRT;

preferably, the detection primer of GAPDH comprises nucleic acid sequences shown as SEQ ID No.3 and SEQ ID No. 4;

6. Use of a kit for the detection of neurodegenerative diseases according to claim 4 or 5 for the purpose of non-disease diagnosis and/or treatment, characterized in that it comprises:

obtaining total RNA of brain tissue to be detected, carrying out reverse transcription to obtain cDNA, carrying out transcriptome sequencing or real-time fluorescent quantitative PCR by using the kit for detecting neurodegenerative disease as claimed in claim 4 or 5, and analyzing the expression level of cystatin C coding gene.

7. An expression inhibitor of the neurodegenerative disease marker of claim 1, wherein the expression inhibitor of the neurodegenerative disease marker comprises any one or a combination of at least two of shRNA, siRNA, dsRNA, miRNA or antisense nucleic acid of cystatin C-encoding gene NM _009976.4.

8. The inhibitor of expression of the neurodegenerative disease marker according to claim 7, wherein the siRNA comprises a nucleic acid sequence represented by SEQ ID No.13 or SEQ ID No. 14.

9. An expression vector expressing the inhibitor of the neurodegenerative disease marker of claim 7 or 8.

10. A composition comprising the expression inhibitor of the neurodegenerative disease marker of claim 7 or 8 or the expression vector of claim 9.