WO2023284035A1

WO2023284035A1 - Neurodegenerative disease marker and application thereof

Info

Publication number: WO2023284035A1
Application number: PCT/CN2021/110284
Authority: WO
Inventors: 陈宇; 屈雪琪; 林力; 陈岳文
Original assignee: 深圳先进技术研究院
Priority date: 2021-07-16
Filing date: 2021-08-03
Publication date: 2023-01-19
Also published as: CN115612728A

Abstract

A neurodegenerative disease marker and an application thereof. The neurodegenerative disease marker comprises a cystatin C coding gene NM_009976.4. It is found for the first time that the expression of cystatin C coding gene in Alzheimer disease brain tissue (cortex, hippocampus, and synapse) is down-regulated, but the level of cystatin C protein in the peripheral serum of Alzheimer disease is increased, and therefore, early diagnosis of Alzheimer disease can be performed by measuring the indicators.

Description

A neurodegenerative disease marker and its application

technical field

The application belongs to the technical field of biological detection, and relates to a neurodegenerative disease marker and its application.

Background technique

Alzheimer's disease (AD) is a neurodegenerative disease with insidious onset and progressive development. Clinically, it is characterized by memory impairment, aphasia, apraxia, agnosia, impairment of visuospatial skills, and executive dysfunction. As well as personality and behavioral changes and other manifestations.

Since the course of AD is an irreversible process, and there is currently no specific drug or cure for the disease, the key to AD treatment lies in early diagnosis, intervention in the early stage of the disease and delaying the progression of the disease. The method can carry out early prediction or diagnosis to AD.

At present, the diagnosis method of AD is mainly combined diagnosis, which mainly includes: neuropsychological assessment, cognitive impairment test; brain senile plaque and Tau protein PET scan; brain magnetic resonance (MRI) and cerebrospinal fluid (CSF) markers, β - Amyloid, detection of phosphorylated Tau protein, etc. (See Selkoe DJ.Alzheimer disease and aducanumab: adjusting our approach.Nat Rev Neurol.2019;15(7):365-6.), but because the early symptoms of AD are not obvious, When a definite diagnosis of the disease is made, most patients reach the late stage of the disease course, and most neurons die. If a rapid diagnosis can be made in the early stage of the disease or potential patients can discover risks in advance, targeted treatment or prevention will be helpful. The patient's disease course stays in the stage of mild cognitive impairment (MCI) to slow down the deterioration, so as to ensure the quality of life of the patient and reduce the social burden.

At present, early molecular screening techniques for AD include positron emission tomography (PET) and detection of Aβ molecular levels in cerebrospinal fluid. Surgical infection is caused, and the reliability of the above-mentioned diagnostic techniques for early diagnosis of AD is not stable, so it is difficult to be used for early screening of AD.

Therefore, the development of new markers for the early diagnosis of AD is one of the important directions for the diagnosis and treatment of AD in the future.

Cystatin C (Cystatin C, CST3), a protein encoded by the CST3 gene, is also called cysteine protease inhibitor C, and is involved in the regulation of the innate immune system and circadian rhythm-related signaling pathways. Exist in all tissues and body fluids in the body, it plays a role in cardiovascular disease (see: Go AS, Chertow GM, Fan D, McCulloch CE, Hsu CY. Chronic kidney disease and the risks of death, cardiovascular events, and hospitalization. The New England journal of medicine.2004; 351(13):1296-305), brain amyloid plays a regulatory role in the development of brain dysfunction and age-related diseases (see: Chuo LJ, Sheu WH, Pai MC, Kuo YM. Genotype and plasma concentration of cystatin C in patients with late-onset Alzheimer disease. Dementia and geriatric cognitive disorders. 2007; 23(4):251-7).

At present, there is no record of using CST3 as a detection standard for AD in the prior art.

Contents of the invention

The present application provides a neurodegenerative disease marker and its application. Early diagnosis of Alzheimer's disease can be carried out by detecting the expression level of the marker, and has the characteristics of timeliness, convenience, high specificity and high sensitivity.

In the first aspect, the present application provides a neurodegenerative disease marker, the neurodegenerative disease marker includes cystatin C coding gene NM_009976.4.

According to some specific embodiments of the present application, early diagnosis of Alzheimer's disease can be performed by analyzing the expression level of the cystatin C coding gene NM_009976.4, including analyzing the level of mRNA transcribed from the cystatin C coding gene and/or Ultimately translated to cystatin C protein levels. The present application found for the first time that the expression of cystatin C coding gene in Alzheimer's disease brain tissue (cortex, hippocampus and synapse) was down-regulated, and the protein level of cystatin C in peripheral serum or plasma of Alzheimer's disease raised.

According to some specific embodiments of the present application, the neurodegenerative disease includes Alzheimer's disease.

According to some specific embodiments of the present application, the early diagnosis refers to a period when amyloid does not appear in the subject's brain.

According to some specific embodiments of the present application, the cystatin C protein level can be determined by enzyme-linked immunosorbent assay (ELISA).

In the present application, the nucleic acid sequence of the cystatin C coding gene NM_009976.4 is shown in SEQ ID NO:15.

SEQ ID NO: 15:

In a second aspect, the present application provides a primer composition for detecting the expression level of neurodegenerative disease markers as described in the first aspect, said primer composition comprising SEQ ID NO: 1 and SEQ ID NO: 2 nucleic acid sequence.

SEQ ID NO: 1: atacaggtggtgagagctcg.

SEQ ID NO: 2: tgccttcctcatcagatggg.

In a third aspect, the present application provides the neurodegenerative disease markers described in the first aspect or the primer composition for detecting the expression level of neurodegenerative disease markers described in the second aspect in the preparation of products for detecting neurodegenerative diseases application.

In a fourth aspect, the present application provides a kit for detecting neurodegenerative diseases, the kit including the primer composition for detecting expression levels of neurodegenerative disease markers described in the second aspect.

Preferably, the kit further includes any one or a combination of at least two of RNA extraction reagents, reverse transcription reagents or transcriptome detection reagents.

Preferably, the kit further includes primers for detecting housekeeping genes.

Preferably, the housekeeping genes include GAPDH and/or HPRT.

Preferably, the detection primers of the GAPDH include the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4.

Preferably, the detection primers of the HPRT include the nucleic acid sequences shown in SEQ ID NO:5 and SEQ ID NO:6.

SEQ ID NO: 3: TCAACAGCAACTCCCACTCTTCCA.

SEQ ID NO: 4: ACCCTGTTGCTGTAGCCGTATTCA.

SEQ ID NO: 5: GGAGTCCTGTTGATGTTGCCAGTA.

SEQ ID NO: 6: GGGACGCAGCAACTGACATTTCTA.

In the fifth aspect, the present application provides a method of using the kit for detecting neurodegenerative diseases described in the fourth aspect for the purpose of non-disease diagnosis and/or treatment, and the method of use includes:

Obtain the total RNA of the brain synapse to be tested, and perform reverse transcription to obtain cDNA, use the kit for detecting neurodegenerative diseases described in the fourth aspect to perform transcriptome sequencing or real-time fluorescent quantitative PCR, and analyze the code of cystatin C Gene expression levels.

In the sixth aspect, the present application provides an expression inhibitor of neurodegenerative disease markers described in the first aspect, the expression inhibitor of neurodegenerative disease markers includes shRNA of cystatin C coding gene NM_009976.4, Any one or a combination of at least two of siRNA, dsRNA, miRNA or antisense nucleic acid.

Preferably, the target sequence of the siRNA comprises the target nucleic acid sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14.

SEQ ID NO: 13: CCCAGACAAATTTGACTGACT.

SEQ ID NO: 14: CGAGTACAACAAGGGCAGCAA.

Preferably, the siRNA comprises the sequence shown in SEQ ID NO: 16 or SEQ ID NO: 17.

SEQ ID NO: 16:AGUCAGUCAAAUUUGUCUGGG.

SEQ ID NO: 17: UUGCUGCCCUUGUUGUACUCG.

According to the practice in the art, when an siRNA is represented by a specific nucleotide sequence, the sequence refers to the sense strand of the siRNA duplex.

In the seventh aspect, the present application provides an expression vector, which expresses the expression inhibitor of neurodegenerative disease markers described in the sixth aspect.

In the eighth aspect, the present application provides a composition comprising the expression inhibitor of neurodegenerative disease markers described in the sixth aspect or the expression vector described in the seventh aspect.

According to the present application, the expression inhibitor of neurodegenerative disease markers can reduce the expression of cystatin C coding gene NM_009976.4, and can be applied to the research of verifying the relationship between the expression level of cystatin C coding gene and disease.

Compared with the prior art, the present application has the following beneficial effects:

The present application found for the first time that the expression of cystatin C coding gene in Alzheimer's disease brain tissue (cortex, hippocampus and synapse) was down-regulated, and the protein level of cystatin C in peripheral serum or plasma of Alzheimer's disease Early diagnosis of Alzheimer's disease can be carried out by detecting the expression level of the marker, and has the characteristics of timeliness, convenience, high specificity and high sensitivity.

Description of drawings

Figure 1A is a volcano map of neurodegenerative disease-related genes in 3-month-old littermates of wild-type and AD mice;

Figure 1B is a volcano map of neurodegenerative disease-related genes in 6-month-old littermates of wild-type and AD mice;

Figure 2 is a heat map of the expression of genes related to neurodegenerative diseases in brain tissue synapses analyzed by RNA-seq, in which the grid filled marks represent up-regulation, unmarked represent down-regulation, and different gray levels represent different degrees of difference. The darker represents the higher degree of difference;

Figure 3 is the data classification analysis diagram, take the genes with FDR (false discovery rate)<0.01, and find the genes whose expression changes are greater than 2, 1 is the binding of amyloid β protein, 2 is the negative regulation of dendritic spines, and 3 is the negative regulation of dendritic spines. Copper ion binding, 4, regulation of age-related behavioral decline, 5, regulation of calcium ion entry through the cell membrane, 6, protein binding, 7, detoxification of copper ions, 8, protection of glial cells, 9 is myelin, 10 is the regulation of chemical synapses;

Figure 4A is a graph showing the expression levels of CST3 in the cerebral cortex and hippocampus of 3-month-old and 6-month-old littermate wild-type and AD mice;

Figure 4B is a graph showing the expression level of CST3 in the synaptosome (SD) of 3-month-old and 6-month-old littermate wild-type and AD mice;

Figure 5A is a diagram of primary neurons after calcium phosphate transfection experiments;

Figure 5B is a dendritic spine and synaptosome density map of primary neurons;

Fig. 6 is a diagram showing the levels of CST3 secreted protein in peripheral blood serum of 3-month-old and 6-month-old wild-type mice (WT) and AD mice (AD).

detailed description

In order to further illustrate the technical means and effects adopted by the present application, the present application will be further described below in conjunction with the embodiments and accompanying drawings. It can be understood that the specific implementation manners described here are only used to explain the present application, but not to limit the present application.

If no specific technique or condition is indicated in the examples, it shall be carried out according to the technique or condition described in the literature in this field, or according to the product specification. The reagents or instruments used were not indicated by the manufacturer, and they were all conventional products commercially available through formal channels.

Materials, equipment and methods:

The transgenic AD mouse strain used came from Jackson Laboratory, and was bred and bred in the SFP animal room of Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences. The operation complied with animal ethics and experimental specifications; primary neuron cells were used to culture 14-day pregnant Sprague Sprague-Dawley (SD) was purchased from Beijing Weitong Lihua, and the operation conformed to animal ethics and experimental specifications; relevant surgical instruments such as anatomy were purchased from Ruiwode; ultracentrifuges, supporting rotors and centrifuge tubes were purchased from Beckman Company; gradient centrifuge from Thermo Fisher Scientific; TRIzol ^TM Reagent from Invitrogen; RNA-seq service and primary data processing service provided by Novogene; phosphate buffer saline (PBS) etc. produced by Gibco; SYBR Green and The corresponding qPCR detection instrument is from Thermo Fisher Scientific; the CST3 quantitative detection ELISA kit is from R&D Company (Cat. No.: MSCTC0); the microplate reader for CST3 quantitative determination is provided by BioTek.

Example 1

In this embodiment, brain tissue samples are collected.

The 3-month-old (3M) and 6-month-old (6M) littermate wild-type (WT) and AD mice (AD) were anesthetized with isoflurane (gas), and quickly decapitated with scissors after neck dissection. Put it on ice, quickly separate the cerebral cortex and separate the cerebral cortex and hippocampus tissue of the mouse, use DPBS containing 4U/mL protease inhibitor and RNase inhibitor to wash the separated tissue twice, and obtain the cerebral cortex tissue sample .

Example 2

The present embodiment separates and purifies brain synapse (SD), comprises the following steps:

(1) Place the cerebral cortex tissue sample obtained in Example 1 on ice, remove the pia mater and vascular tissue in the tissue homogenate equilibrium liquid containing protease inhibitors and RNase inhibitors, take 2mL of the cerebral cortex and place it in the same tissue Homogenize in the homogenate balance solution, filter the tissue homogenate with a 40 μm tissue filter to remove large tissue fragments;

(2) Centrifuge the filtered tissue homogenate horizontally at 4°C and 10000×g for 10 minutes to collect the precipitate;

(3) Then suspend the pellet in 35% OptiPrep tissue homogenate balance solution, place in 9%, 12.5%, 15%, 25% and 35% OptiPrep gradient centrifuge tubes, at 4 °C, 10000 × g Carry out gradient centrifugation for 24 minutes, and collect the suspension located between the 9%-12.5% interface, which is the suspension containing brain synaptosomes;

(4) The collected brain synaptosome suspension was centrifuged at 4° C. and 6000×g for 30 minutes, and the obtained precipitate was the brain synapse (SD).

Example 3

In this example, RNA extraction is carried out.

Total RNA was extracted from brain tissue (cortex and hippocampus) and brain synapses using the Trizon method. For detailed methods, refer to the instructions for use of TRIzol ^™ Reagent from Invitrogen Company, as follows:

(1) Preparation of reagents: chloroform, isopropanol, 75% ethanol, RNase-free water, all solutions need to be prepared with DEPC-treated water;

(2) Operation steps:

1) Homogenization treatment: Grind the tissue or cells in liquid nitrogen, add 1mL TRIzol per 100mg of tissue, and use a homogenizer for homogenization treatment. The sample volume should not exceed 10% of the volume of TRIzol;

2) Place the homogenized sample at 25°C for 5 minutes to completely separate the nucleic acid-protein complex;

3) Add 0.2mL chloroform for every 1mL TRIzol used, shake vigorously for 15 seconds, and place at 25°C for 3 minutes;

4) Centrifuge at 4°C and 10000×g for 15 minutes, the RNA is mainly located in the water phase;

5) Transfer the aqueous phase to a new tube, precipitate the RNA in the aqueous phase with isopropanol, add 0.5mL isopropanol for every 1mL TRIzol used, and place at room temperature for 10 minutes;

6) Centrifuge at 4°C and 10000×g for 10 minutes, remove the supernatant;

7) Wash the RNA pellet with 75% ethanol, add at least 1mL 75% ethanol for every 1mL TRIzol used, centrifuge at 4°C, 6500×g for 5 minutes, and discard the supernatant;

8) Dry the RNA pellet at 25°C for 6 minutes, add 100 μL of RNase-free water, place at 60°C for 10 minutes to dissolve the RNA, and store at -70°C.

Example 4

In this example, cDNA synthesis, transcriptome sequencing (RNA-seq) and quantitative PCR detection were carried out.

The synthesis of cDNA was completed using the reverse transcription kit K1632 of ThermoFisher Company, the RNA of different sources obtained in Example 3 was reverse-transcribed into cDNA, and the synthetic cDNA was subjected to quantitative RT-PCR detection (reaction program: pre-denaturation: 95 Incubate at ℃ for 10 minutes; cycle amplification: incubate at 95°C for 15 seconds; incubate at 60°C for 1 minute; form melting curve: incubate at 95°C for 20 seconds; The rate is 1.6°C/s.)

And transcriptome sequencing, the housekeeping genes used are GAPDH and HPRT as internal reference genes.

The amplified sequence of CST3 gene is NM_009976.4.

CST3 gene amplification primers are:

F: atacagtggtgagagctcg (SEQ ID NO: 1), R: tgccttcctcatcagatggg (SEQ ID NO: 2).

The amplified sequence of GAPDH gene is NM_008084.3.

GAPDH gene amplification primers are:

F: tcaacagcaactcccactcttcca (SEQ ID NO: 3), R: accctgttgctgtagccgtattca (SEQ ID NO: 4).

The amplified sequence of HPRT gene is NM_013556.2.

Primers for HPRT gene amplification are:

F: ggagtcctgttgatgttgccagta (SEQ ID NO: 5), R: gggacgcagcaactgacatttcta (SEQ ID NO: 6).

Using RNA-seq to amplify and high-throughput sequence the cDNA derived from brain neuron synapse samples, use bioinformatics to analyze the data, draw volcano maps, heat maps, and gene enrichment analysis (GO analysis). In GO analysis, the difference between wild-type and AD mice was analyzed and compared, genes with FDR (false discovery rate) <0.01 were screened, and gene enrichment analysis was performed on genes with a relative expression difference of more than 2 times. There were 12 differences Significant genes were enriched in pathways related to energy metabolism, and were significantly associated with neurodegenerative diseases.

Through the analysis of the volcano map (Fig. 1A and Fig. 1B) and the heat map (Fig. 2), it was found that compared with the littermate wild-type group and the AD group in the SD of 3-month-old mice and 6-month-old mice, it can be seen that AD is smaller. The expression of mouse CST3 decreased significantly, and comparing the expression difference between 3-month-old and 6-month-old AD mice, it can be seen that the differential expression becomes more obvious with the increase of time.

After the gene function enrichment analysis (GO analysis) of the genes with significant gene expression in the transcriptome, 12 genes with significant differences were enriched in pathways related to energy metabolism, and it was found that they were significantly related to the signaling pathways of AD diseases. The core gene is CST3, and the functions of CST3 gene are mainly enriched in: recognition and binding of Aβ, regulation of dendritic spines, protein binding and other pathways, regulation of age-related neurodegenerative diseases, etc. (Figure 3), therefore, CST3 can be used as a neurotransmitter Candidate biomarkers for early diagnosis of degenerative diseases.

Quantitative RT-PCR (qRT-PCR) was used to verify the differences in CST3 gene expression in different time periods from brain neuron synapse samples, cerebral cortex tissue, and hippocampus tissue of wild-type mice and AD mice, and the data were applied to GraphPad Prism software was used for data processing, and the statistical method was T test, and P<0.05 was considered statistically significant.

qRT-PCR results are shown in Fig. 4A and Fig. 4B, for the cerebral cortex and hippocampus results show (Fig. 4A), compared with AD mice in 3-month-old and 6-month-old wild-type mice, the expression of CST3 in AD mice is all significant decreased, while the results for brain synapses showed (Fig. 4B), compared with AD mice in 3-month-old wild-type mice, the expression of CST3 in AD mice was significantly reduced, while 6-month-old mice did not show this difference.

From the above experimental results, it can be seen that different detection methods and different detection sources will affect the early diagnosis of Alzheimer's. The results of RNA-seq and qPCR are combined, and the early detection results of neuron dendrites show that The same trend, that is, in the early stage of Alzheimer's development, the expression of CST3 in neuronal dendrites was significantly reduced, and for the AD mouse model, amyloid plaques did not appear in the brain of 3-month-old mice , while amyloid plaques had appeared in the brains of 6-month-old mice, both qPCR results and RNA-seq results showed that there was a significant difference in the expression of CST3 before the appearance of amyloid plaques, indicating that neuronal synapses The expression level of CST3 in can be used as a marker of early Alzheimer's disease for early screening and detection of Alzheimer's disease.

Example 5

In this example, the calcium phosphate transfection experiment of primary neurons was carried out.

shRNA, siRNA, dsRNA and miRNA are all interference RNAs, which can be applied to reduce the expression of target genes. In this example, a gene expression interference plasmid was constructed and transfected into primary neurons by calcium phosphate to reduce the expression of CST3. The plasmid construction method is as follows: The shRNA primers were co-incubated with the pSUPER vector plasmid to obtain a plasmid capable of producing siRNA in the transfected cells.

The primers used for each group of plasmids are as follows:

shCST3 1#:

F: gatctccccccagacaaatttgactgactttcaagagaagtcagtcaaatttgtctgggtttttggaac (SEQ ID NO: 7);

R: tcgagttccaaaaacccagacaaatttgactgacttctcttgaaagtcagtcaaatttgtctggggga (SEQ ID NO: 8).

shCST3 2#

F: gatctcccgagtacaacaagggcagcaattcaagagattgctgcccttgttgtactcgtttttggaac (SEQ ID NO: 9);

R: tcgagttccaaaaacgagtacaacaagggcagcaatctcttgaattgctgcccttgttgtactcggga (SEQ ID NO: 10).

scr-CST3:

F: gatctccgaaggtcgagatgctctgtttcaagagaacagagcatctcgaccttctttttggaac (SEQ ID NO: 11);

R: tcgagttccaaaaagaaggtcgagatgctctgttctcttgaaacagagcatctcgaccttcgga (SEQ ID NO: 12).

The target sequences of the siRNAs expressed by shCST3 1# and shCST3 2# obtained by sequencing are:

CST3 siRNA 1#: CCCAGACAAATTTGACTGACT (SEQ ID NO: 13);

CST3 siRNA 2#: CGAGTACAACAAGGGCAGCAA (SEQ ID NO: 14).

Take the hippocampus tissue of rat embryos on day 18 of pregnancy, and perform the primary culture of hippocampal neurons in vitro. The primary neuron cell culture methods include:

(1) Separation of hippocampal tissue: After the 18-day pregnant mouse was sacrificed, the abdomen of the pregnant mouse was quickly cut open with scissors, the embryo was taken out and placed on a 100mm cell culture dish, and placed on ice. After the placenta was separated, the separated brain tissue was placed in CMF-HBSS, and stripped hippocampal tissue, placed in a 15mL centrifuge tube previously filled with CMF-HBSS;

(2) Transfer the separated hippocampus to an ultra-clean bench, wash twice with CMF-HBSS, transfer the hippocampus tissue into a new 15mL centrifuge tube, add 10mL CMF-HBSS/Trysin (9mL CMF-HBSS, 1mL Trysing, 100mL DNase), put it in a 37℃ water bath for 15min to digest;

(3) After digestion, add 1:20 volume of Trysin inhibitor, mix well, wait for the hippocampal tissue to sink to the bottom of the tube, and discard the digestion solution;

(4) Add 2.5mL NB, shake gently to wash the hippocampal tissue, discard NB, and repeat the washing once;

(5) Add 5mL NB, gently pipette 13 times with a 1mL pipette, mix well, pass through a 70μL filter membrane, and count the cells;

(6) Incubate 2x 10 ⁶ cells in a 60mm petri dish with 4 coverslips in a 5% CO ₂ incubator at 37°C for 30min, suck up the medium in the culture plate, and add 1mL NB , continue to incubate at 37°C for 30min in a 5% CO ₂ incubator;

(7) After the incubation, directly clamp the 60mm coverslip into a 12-well plate, add medium, continue to culture in a 5% CO ₂ incubator at 37°C, change the medium after 5 days, and then every 5 days Change the medium in half.

And on the 14th day, the calcium phosphate transfection experiment was carried out. The slides of cultured neurons on the inner surface of the 24-well plate were placed in the balanced 1.5mL DMEM medium, and starved for 1 hour in a 7.5% _CO2 incubator. Plasmids and transfection reagents were prepared during this period. The experiment was divided into 4 groups. The plasmids were respectively used pSUPER vector plasmid (blank group), pSUPER vector plasmid transfected with scr-CST3 (negative control), and SUPER vector plasmid transfected with shCST3 1# and the pSUPER vector plasmid transfected with shCST3 2#, add the required amount of plasmid and 5 μL 2M CaCl2 into water to make a 50 μL system, add 50 μL 2×HBS (pH=7.05) drop by drop while vortexing CaCl2/plasmid mixture In the dark environment, let it stand for about 20 minutes to form a transfection solution, evenly drop the transfection solution on the slide in the well, put it in a 7.5% CO ₂ incubator and let it stand for 15 minutes, then wash it twice with 1mL DMEM, Put the slides into the neuron maintenance culture medium, put them back into the 5% CO ₂ incubator, and change the medium halfway after 1 hour, continue to culture the neurons for 2.5 days after the transfection, and then use 4% paraformaldehyde Fix, mount on glass slides, and image with a confocal microscope. The results are shown in Figure 5A and Figure 5B.

It can be seen from Figure 5A and Figure 5B that the dendritic spines and synapse density and The size of the dendritic spine is reduced. The dendritic spine is the protruding structure on the dendritic trunk of the neuron. It is the main structure of the post-synaptic component in the synaptic structure. The dendritic spine is the most direct anatomical structure for synaptic connection and transmission. Its Dynamic changes in formation and degradation are widely considered to be a hallmark of synaptic plasticity. Studies have shown that the length, number and density of dendritic spines and synapses in AD mice are significantly less than those in wild-type mice, and dendritic spines and synapses The reduction in length and density occurs before the appearance of amyloid plaques, that is, this feature occurs in the early stage of Alzheimer's disease. The experimental results of this application confirm that the reduction in the expression of CST3 gene can cause synapse loss and dendritic spine volume reduction, from phospho The results of calcium transfection experiments showed that the low expression of CST3 gene in early Alzheimer's brain neurons can be used as a marker of early Alzheimer's, which is consistent with the results of qPCR and RNA-seq.

Example 6

In this example, the CST3 protein in serum is quantitatively detected.

Use the ELISA detection kit to detect the level of CST3 protein in the peripheral blood serum of 3-month-old (3M) and 6-month-old (6M) wild-type mice (WT) and AD mice (AD), the specific steps are as follows:

(1) After 3-month-old and 6-month-old littermate wild-type and AD mice were anesthetized with isoflurane gas, the blood samples of the mice were collected by fundus blood sampling into 1.5mL sterilized EP tubes, and the necks were broken and used The mice were killed by quick decapitation with scissors, and the serum was separated as follows:

1) Place the anticoagulated blood sample at 4°C for 4 hours to precipitate the serum naturally;

2) After the serum is naturally precipitated, centrifuge at 4°C and 4000rpm for 30 minutes to separate the serum, discard the insoluble matter, transfer the serum to a new sterilized EP tube, and store it at -80°C;

(2) Use the ELISA detection kit to detect the CST3 protein content in the serum. The detection method includes the following steps:

1) Add 50 μL of assay diluent RD1W to the test well;

2) Add standard substance, control sample and test sample to the test well in sequence, seal with the parafilm provided in the kit and incubate at room temperature for 2 hours;

3) After the incubation, tear off the sealing film, discard the liquid, add 400 μL of washing solution to each well to wash the detection plate, wash 4 times, and discard the washing solution;

4) Add 100 μL mouse CST3 conjugate to the test well, seal with parafilm, and incubate at room temperature for 2 hours;

5) Repeat step (3) once;

6) Add 100 μL of the prepared luminescence reagent to the test well, and incubate at room temperature for 39 minutes in the dark;

7) Add 100 μL of stop solution, flick and mix the test plate to ensure thorough mixing;

8) Plate reading: complete the optical density detection of each well within 30 minutes;

9) Calculation: Concentration quantitative calculation is performed according to the formula provided by the kit.

The results are shown in Figure 6, from which it can be seen that compared with wild-type mice, the level of CST3 protein in peripheral blood serum of AD mice was significantly increased.

In summary, the present application found for the first time that the expression of the gene encoding cystatin C in Alzheimer's disease brain tissues (cortex, hippocampus and synapses) was down-regulated, and that cystatin C in the peripheral serum of Alzheimer's disease Early diagnosis of Alzheimer's disease can be carried out by detecting the above indicators if the level of protein C is increased.

The applicant declares that the present application illustrates the detailed method of the present application through the above-mentioned examples, but the present application is not limited to the above-mentioned detailed method, that is, it does not mean that the application must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement to the present application, the equivalent replacement of each raw material of the product of the present application, the addition of auxiliary components, the selection of specific methods, etc., all fall within the scope of protection and disclosure of the present application.

Claims

A neurodegenerative disease marker comprising cystatin C encoding gene NM_009976.4.
A primer composition for detecting the expression level of neurodegenerative disease markers as claimed in claim 1, comprising the nucleic acid sequences shown in SEQ ID NO:1 and SEQ ID NO:2.
Application of the neurodegenerative disease marker according to claim 1 or the primer composition for detecting the expression level of neurodegenerative disease markers according to claim 2 in the preparation of products for detecting neurodegenerative diseases.
A kit for detecting neurodegenerative diseases, comprising the primer composition for detecting the expression levels of neurodegenerative disease markers according to claim 2.
The kit according to claim 4, wherein the kit further comprises any one or a combination of at least two of RNA extraction reagents, reverse transcription reagents or transcriptome detection reagents;

Optionally, the kit also includes primers for detecting housekeeping genes;

Optionally, the housekeeping genes include GAPDH and/or HPRT;

Optionally, the detection primers of the GAPDH include the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4;

Optionally, the detection primers of the HPRT include the nucleic acid sequences shown in SEQ ID NO:5 and SEQ ID NO:6.
A method for using the kit for detecting neurodegenerative diseases as claimed in claim 4 or 5 for purposes of non-disease diagnosis and/or treatment, comprising:

Obtain the total RNA of the brain tissue to be tested, and carry out reverse transcription to obtain cDNA, use the kit for detecting neurodegenerative diseases described in claim 4 or 5 to perform transcriptome sequencing or real-time fluorescent quantitative PCR, and analyze the code of cystatin C Gene expression levels.
An expression inhibitor of neurodegenerative disease markers according to claim 1, comprising any one or at least two of shRNA, siRNA, dsRNA, miRNA or antisense nucleic acid of cystatin C coding gene NM_009976.4 The combination.
The expression inhibitor of neurodegenerative disease markers according to claim 7, wherein the target sequence of the siRNA comprises the nucleic acid sequence shown in SEQ ID NO:13 or SEQ ID NO:14.
An expression vector expressing the expression inhibitor of neurodegenerative disease markers according to claim 7 or 8.
A composition comprising the expression inhibitor of neurodegenerative disease markers according to claim 7 or 8 or the expression vector according to claim 9.