CN114645086B

CN114645086B - Neurodegenerative disease marker Prnp and application thereof

Info

Publication number: CN114645086B
Application number: CN202011502000.3A
Authority: CN
Inventors: 陈宇; 屈雪琪; 林力; 陈岳文
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2020-12-17
Filing date: 2020-12-17
Publication date: 2023-10-20
Anticipated expiration: 2040-12-17
Also published as: CN114645086A

Abstract

The invention relates to a neurodegenerative disease marker Prnp and application thereof. The invention specifically discloses a composition for early evaluation of Alzheimer's disease risk, which comprises a composition for detecting prion protein coding gene level in brain neuron synapses of a subject. The invention also discloses application of the composition in Alzheimer disease risk assessment and application of an inhibitor of prion protein encoding genes in preparation of medicines for treating Alzheimer disease.

Description

Neurodegenerative disease marker Prnp and application thereof

Technical Field

The invention belongs to the field of biological detection, and particularly relates to a neurodegenerative disease marker Prnp and application thereof.

Background

Alzheimer's Disease (AD) is a relatively common chronic disease in the elderly, and patients experience memory impairment and ultimately cause dementia. The quality of life of patients is often greatly reduced and the life cannot be self-care, no specific medicine or cure means for the disease exists at present, and the long treatment and nursing of patients can give great burden to family members and society of the patients. At least 5000 tens of thousands of patients worldwide are currently counted by the AD society in 2018, and this number would be expected to reach 1.52 billion by 2050. China, one of the world population cardinality, has become the most important country for patients with senile dementia, and AD has become a medical problem and social problem to be solved urgently.

Since the course of AD is an irreversible process. Thus, the key to AD treatment is early diagnosis, intervening in AD early in the disease and slowing down the progression of the disease. However, there has not been an accurate method for early prediction or diagnosis of AD. The current diagnosis method of AD is mainly combined diagnosis and mainly comprises the following steps: neuropsychological assessment, cognitive impairment testing; PET scanning of senile plaques and Tau proteins of the brain; brain nuclear Magnetic Resonance (MRI) and cerebrospinal fluid (CSF) markers, beta-amyloid, phosphorylated tau detection, etc. [1]. However, since early symptoms of AD are not obvious, when a clear diagnosis is made for the disease, the patient reaches the late stage of the disease, most neurons die, if rapid diagnosis can be made in the early stage of the disease of the patient or potential patients can be found in advance, and targeted treatment or prevention can be performed, the disease course of the patient is retained in the mild intellectual impairment stage (mild cognitive impairment, MCI) to slow down the deterioration, so that the life quality of the patient is ensured and the social burden is lightened. Early clinical diagnosis and subsequent treatment for AD is a key point in addressing AD disorders [2-4]. Early molecular screening techniques for AD at present include positron emission computed tomography (PET) and detection of the level of aβ molecules in cerebrospinal fluid, the former requiring injection of a dose of a radioactive substance into a subject; the latter is very damaging to operate and is prone to surgical infection. The reliability of these diagnostic techniques against early diagnosis of AD is also less stable and therefore difficult to use for early screening of AD. Therefore, the development of new markers for early diagnosis of AD is one of the important directions for diagnosis and treatment of AD in the future, and there is a long way for new markers to be used in clinical applications.

The APP/PSEN1 mouse model (hereinafter referred to as AD mouse model) is one of ideal animal models for simulating AD diseases, and is widely applied to the research of AD pathogenesis [5]. Numerous studies have demonstrated that neuronal synaptic plasticity plays an important role in neurodegenerative diseases (e.g., AD, PD, HD, etc.) in organisms. The invention screens out molecular biomarkers for diagnosing AD early diseases aiming at the expression difference of local translation proteins of synaptic sites, and can realize early discovery, early intervention and early treatment, thereby delaying the course of disease and reducing the death rate.

Prion protein (PrP) is a proven protein-impregnating factor encoded in animals by a single genomic gene, the Prion-encoding gene (Polymorphisms of the Prion protein gene, prnp). The Prnp gene C129 and C219 codon polymorphisms have a correlation with the occurrence and development of neurodegenerative diseases. Research has confirmed that PrP encoded by Prnp gene ^C Proteins have high affinity for Abeta and mediate inhibition of Long-term gain effects (Long-term potentiation, LTP, important in inducing synaptic toxicity [6, 7)]. Further studies have found that conditional loss of Prnp can repair chemical synaptic loss, neuronal activity, learning, memory impairment and behavioural cognitive abilities in AD mouse models [8,9]. In the detection of samples from dementia patients, prion proteins caused by mutation of the Prnp gene are frequently found in genetic family history, and are not uncommon in sporadic dementia [10 ]]. Thus, researchers have suggested that gene detection of Prnp is a simple and effective method for dementia patients, whether early-onset AD or AD-based early diagnosis, regardless of family history, taking prion diseases into account.

Because the disease of the AD is hidden, the traditional detection means can hardly judge in the early stage of the AD. Some body fluid marker assays, while theoretically capable of early screening, are low in sensitivity and poorly steerable.

Although there are reports of correlation between Prnp and early AD, whether Prnp can be used as a detection standard for AD is not known.

1.Selkoe,D.J.,Alzheimer disease and aducanumab:adjusting our approach.Nat Rev Neurol, 2019.15(7):p.365-366.

2.Mufson,E.J.,et al.,Mild cognitive impairment:pathology and mechanisms.Acta Neuropathol,2012.123(1):p.13-30.

3.Long,J.M.and D.M.Holtzman,Alzheimer Disease:An Update on Pathobiology and Treatment Strategies.Cell,2019.179(2):p.312-339.

4.Masters,C.L.,et al.,Alzheimer's disease.Nat Rev Dis Primers,2015.1:p.15056.

5.Radde,R.,et al.,Abeta42-driven cerebral amyloidosis in transgenic mice reveals early and robust pathology.EMBO Rep,2006.7(9):p.940-6.

6.Lauren,J.,et al.,Cellular prion protein mediates impairment of synaptic plasticity by amyloid-beta oligomers.Nature,2009.457(7233):p.1128-32.

7.Zhang,J.E.,et al.,Polymorphisms of the prion protein gene(PRNP)in the Tibetan Mastiff. Anim Genet,2009.40(6):p.1001-2.

8.Gimbel,D.A.,et al.,Memory impairment in transgenic Alzheimer mice requires cellular prion protein.J Neurosci,2010.30(18):p.6367-74.

9.Salazar,S.V.,et al.,Conditional Deletion of Prnp Rescues Behavioral and Synaptic Deficits after Disease Onset in Transgenic Alzheimer's Disease.J Neurosci,2017.37(38):p.9207-9221.

10.Kovacs,G.G.,et al.,Genetic prion disease:the EUROCJD experience.Hum Genet,2005. 118(2):p.166-74.

Disclosure of Invention

In one aspect, the invention provides a composition for early assessment of risk of Alzheimer's disease, the composition comprising a composition of prion-encoding gene levels in brain neuronal synapses of a subject.

In the technical scheme of the invention, the prion protein coding gene level refers to a composition of the mRNA level of the prion protein coding gene.

In the technical scheme of the invention, the composition for detecting the mRNA level of the prion protein coding gene is selected from primer and/or probe combinations for detecting NM_001278256.1 gene fragments.

In the technical scheme of the invention, the composition for detecting the miRNA level of the prion protein coding gene is selected from the following primer compositions:

F:accagaacaacttcgtgcac SEQ ID No.1

R:ttctcccgtcgtaataggcc SEQ ID No.2。

in another aspect, the present invention provides a kit comprising the above composition for detecting prion-encoding gene levels.

In the technical scheme of the invention, the kit further comprises a reagent for detecting transcriptome and/or a reagent for quantitative reverse transcription PCR.

In the technical scheme of the invention, the kit also comprises a detection composition of housekeeping genes.

In the technical scheme of the invention, the household gene in the kit is selected from GAPDH and or HPRT.

In the technical scheme of the invention, the detection primer composition of the housekeeping gene is as follows:

the primer composition for detecting GAPDH is:

F：TCAACAGCAACTCCCACTCTTCCA SEQ ID No.3

R:ACCCTGTTGCTGTAGCCGTATTCA SEQ ID No.4；

the primer composition for detecting HPRT is as follows:

F:GGAGTCCTGTTGATGTTGCCAGTA SEQ ID No.5

R:GGGACGCAGCAACTGACATTTCTA SEQ ID No.6。

in a further aspect, the invention provides the use of a composition or kit for detecting RNA levels as described above for the preparation of a reagent for detecting a risk assessment of alzheimer's disease.

In the technical scheme of the invention, the Alzheimer's disease risk assessment is Alzheimer's disease early risk assessment.

In the technical scheme of the invention, the early risk assessment of Alzheimer's disease is carried out before the occurrence of amyloid in a subject.

In yet another aspect, the present invention provides a method of predicting risk of Alzheimer's disease, the method comprising the steps of:

1) Obtaining a subject's brain nerve synapse;

2) Detecting the expression level of a prion-encoding gene in the brain synapse.

In the present invention, the method for predicting the risk of Alzheimer's disease further comprises the step of comparing the expression level of the prion-encoding gene in the brain synapse of the subject with a negative control or with a normal range of values.

In the present embodiment, the method of detection in step 2) is selected from the group consisting of using transcriptome detection and or quantitative reverse transcription PCR.

In the technical scheme of the invention, the composition or the kit disclosed by the invention is adopted in the step 2).

In the technical scheme of the invention, the risk of Alzheimer's disease is considered when the expression level of the prion protein coding gene in the brain nerve synapse is higher than a negative control or normal value range.

In the technical scheme of the invention, the method for predicting the risk of Alzheimer's disease is a method for predicting the risk of Alzheimer's disease in early stage, wherein the early stage refers to the condition that amyloid is not present in the brain of a subject.

In yet another aspect, the invention provides a medicament for reducing the risk of developing Alzheimer's disease comprising an inhibitor of a prion-encoding gene.

In the technical scheme of the invention, the inhibitor of the prion protein encoding gene is used for inhibiting the transcription, translation and expression of the prion protein encoding gene.

In a further aspect, the invention provides the use of an inhibitor of a prion-encoding gene in the manufacture of a medicament for the treatment of alzheimer's disease.

In yet another aspect, the invention provides the use of an inhibitor of a prion-encoding gene in the manufacture of a medicament for repairing neuronal synapses and or increasing neuronal dendritic spine density or volume.

In the technical scheme of the invention, the inhibitor of the prion protein encoding gene is selected from shRNA, siRNA, dsRNA, miRNA, antisense nucleic acid, siRNA targeting sequence or iRNA targeting sequence of the prion protein encoding gene; or can express or form the shRNA, siRNA, dsRNA, miRNA antisense nucleic acid construct, and the siRNA sequence is shown as SEQ ID No.13 or SEQ ID No. 14.

In yet another aspect, the invention provides the use of a neuronal cell upregulated by a prion protein encoding gene in the manufacture of a medicament for screening for repair of neuronal synapses and or dendritic spines.

Advantageous effects

1) The invention discovers Prnp gene, and compared with the traditional detection means, the gene diagnosis is more timely, more specific, more convenient and higher in sensitivity.

2) Can realize early diagnosis of AD, thereby providing guiding basis for early intervention of AD, and further delaying AD symptoms and prolonging the life of patients.

Drawings

FIG. 1 is a volcanic diagram of a neurodegenerative disease-related gene obtained by RNA-seq analysis of brain tissue synapses, the volcanic diagram reveals the differential gene distribution between the wild type of the littermate and AD mice in the SD component, and A is the gene difference between the wild type of the littermate and AD mice at 3 months of age; panel B shows the genetic differences between 6 month old littermate wild type and AD mice.

FIG. 2 is a thermal diagram showing the expression of a gene associated with neurodegenerative disease obtained by RNA-seq analysis of brain tissue synapses. Is the result of differential expression of genes related to AD diseases in the result of transcriptome sequencing. Wherein the representation with the grid filled marks is up-regulated, the unlabeled representation is down-regulated, different gray scales represent different degrees of difference, and the gray scale is about deeper to represent the higher degree of difference.

FIG. 3 is a data categorization analysis. The figure shows that a gene whose expression variation is greater than 2 or more is found in a gene FDR (false discovery rate) < 0.01. Through classification, 12 genes with obvious differences are enriched in energy metabolism related pathways; it was found that there is a significant association with the signaling pathway of AD disease, where the core gene is Prnp.

In the figure, 1 is amyloid beta protein binding, 2 is negative regulation of dendritic spines, 3 is copper ion binding, 4 is regulation of age-related behavioral decline, 5 is regulation of calcium ion entry through cell membranes, 6 is protein binding, 7 is detoxification of copper ions, 8 is glial cell protection, 9 is myelin sheath, and 10 is regulation of chemical synapses.

FIG. 4 shows the differential expression of Prnp between wild-type and AD-type components in mouse cortex and Synaptosomes (SD) distributed after verification by qPCR. Panel A shows the skin and hippocampal Prnp expression in 3 month old mice; panel B shows Prnp expression in SD fractions of 3-month-old and 6-month-old mice.

FIG. 5 is a graph showing that shPrnp calcium turnover in primary neurons and shPrnp calcium turnover in primary cell neurons of the rat hippocampus for 14 days can repair dendritic spines and synaptosome densities.

Detailed Description

The following detailed description of the present invention will be made in detail to make the above objects, features and advantages of the present invention more apparent, but should not be construed to limit the scope of the present invention.

Materials, apparatus and methods

The AD mice used are derived from Jackson laboratories, bred and raised in SFP animal houses of Shenzhen advanced technology institute of China academy of sciences, and the operation accords with the ethical and experimental specifications of animals; dissecting and the like related surgical instruments were purchased from Yu Ruiwo de; ultracentrifuge and associated rotor and centrifuge tube are purchased from Beckman company; gradient centrifugation agent was from Thermo Fisher Scientific company; TRIzol ^TM Reagent is from the company Invitrogen; the RNA-seq service and the primary data processing service are provided by Novogene company; phosphate Buffer (PBS) and the like are manufactured by Gibco corporation; SYBR Green and the corresponding qPCR detection instrument are from Thermo Fisher Scientific.

Example 1 tissue sample collection

3 month old (3M) and 6 month old (6M) littermate Wild Type (WT) and transgenic AD mice (AD) were anesthetized with isoflurane (gas), and after weaning, the heads were rapidly sacrificed with scissors, placed on ice, and cerebral cortex and hippocampal tissue of the mice were rapidly isolated. And the isolated tissue was washed twice with DPBS containing 4U/mL of the protease inhibitor and the RNase inhibitor to obtain a cerebral cortex tissue sample.

EXAMPLE 2 isolation and purification of brain Synapses (SD)

a) Placing the extracted brain tissue on ice, removing pia mater and vascular tissue in tissue homogenate balance liquid containing protease inhibitor and RNase inhibitor, homogenizing 2mL of cerebral cortex in the same tissue homogenate balance liquid, and filtering the tissue homogenate liquid by using a tissue filter with the thickness of 40 μm to remove large tissue fragments;

b) Centrifuging the filtered tissue homogenate at 10000g for 10 min at 4deg.C, collecting precipitate, and performing gradient centrifugation to separate brain synapse;

c) Subsequently, the pellet was suspended in 35% OptiPrep tissue homogenate equilibrated solution and then placed in 9%, 12.5%, 15%, 25% and 35% OptiPrep gradient centrifuge tubes for gradient centrifugation at 10000g at 4 ℃ for 24 minutes, taking care to collect a suspension between 9% -12.5% interface, i.e. a suspension containing brain synaptosomes;

d) And centrifuging the collected brain synaptosome suspension at 6000g at 4 ℃ for 30min again to obtain precipitate, namely brain Synapse (SD).

EXAMPLE 3RNA extraction

Extraction of total RNA from brain tissue (cortex and Hippocampus) and synapses by Trizon method, detailed method is referred to TRIzol from Invitrogen corporation ^TM The Reagent is used as follows:

a) Preparing a reagent: chloroform, isopropanol, 75% ethanol, RNase-free water or 0.5% SDS (solutions all were prepared with DEPC treated water).

b) The operation steps are as follows:

i. homogenizing: the tissue or cell is ground in liquid nitrogen, 1mL TRIzol is added to every 50-100 mg of tissue, and the homogenization treatment is carried out by a homogenizer. The sample volume should not exceed 10% of the TRIzol volume.

Placing the homogenized sample at room temperature (15-30 ℃) for 5 minutes to completely separate the nucleic acid protein complex.

0.2mL chloroform was added per 1mL TRIzol, vigorously shaken for 15 seconds, and left at room temperature for 3 minutes.

Centrifugation at 10000 Xg for 15 min at 2-8deg.C. The samples were divided into three layers: the bottom layer is a yellow organic phase, and the upper layer is a colorless aqueous phase and an intermediate layer. RNA is predominantly in the aqueous phase, which is approximately 60% of the TRIzol reagent used.

Transferring the aqueous phase to a new tube, where the organic phase is preserved if DNA and protein are to be separated, after further manipulation. RNA in the aqueous phase was precipitated with isopropanol. 0.5mL of isopropanol was added per 1mL of LTRIzol and left at room temperature for 10 minutes.

vi.10000 Xg of the solution is centrifuged for 10 minutes at 2-8 ℃ and no RNA precipitate is observed before centrifugation, and colloidal precipitate appears on the side and bottom of the tube after centrifugation. The supernatant was removed.

Washing the RNA precipitate with 75% ethanol. At least 1mL of 75% ethanol was added per 1mL of TRIzol used. Centrifuging at 2-8deg.C for 5 min at a temperature of no more than 7500 Xg, and discarding supernatant.

Drying at room temperature or vacuum drying the RNA precipitate for about 5-10 minutes without vacuum centrifugation, which would result in a significant decrease in RNA solubility. 25-200. Mu.L of RNase-free water or 0.5% SDS was added, the mixture was sucked several times with a gun head, and the mixture was left at 55-60℃for 10 minutes to solubilize RNA. For example, RNA is used for the cleavage reaction without using SDS solution. RNA can also be solubilized with 100 parts of deionized formamide and stored at-70 ℃.

EXAMPLE 4cDNA Synthesis, transcriptome sequencing and quantitative PCR detection

cDNA synthesis was performed using the reverse transcription kit K1632 from ThermoFisher. The RNA of different sources obtained in example 3 was reverse transcribed into cDNA, and the synthesized cDNA was subjected to quantitative RT-PCR detection and transcriptome sequencing. Housekeeping genes employed are GAPDH and HPRT.

The Prnp gene amplification sequence is NM_001278256.1;

prnp gene amplification primer F accagaacaacttcgtgcac SEQ ID No.1

R:ttctcccgtcgtaataggcc SEQ ID No.2

The GAPDH gene amplification sequence is NM_008084.3;

the GAPDH gene amplification primer is F: TCAACAGCAACTCCCACTCTTCCA SEQ ID No.3

R:ACCCTGTTGCTGTAGCCGTATTCA SEQ ID No.4

The HPRT gene amplified sequence is NM_013556.2;

the HPRT gene amplification primer is F: GGAGTCCTGTTGATGTTGCCAGTA SEQ ID No.5

R:GGGACGCAGCAACTGACATTTCTA SEQ ID No.6

cDNA from brain neuronal synapse samples were amplified and high throughput sequenced by RNA-seq, data analysis using bioinformatics, mapping including volcanic mapping, heat mapping, and gene enrichment analysis (GO analysis). In GO analysis, the difference between wild type mice and AD mice is analyzed and compared, FDR (false discovery rate) <0.01 genes are screened, gene enrichment analysis is carried out on genes with the relative expression difference of more than 2 times, and 12 genes with obvious difference are enriched in the energy metabolism related channels and are obviously associated with neurodegenerative diseases.

RNA derived from brain neuron synapse samples, cerebral cortex tissues and hippocampus tissues was validated for differences in Prnp gene expression in wild-type mice and AD mice using qRT-PCR for different time periods.

The data are processed by using GraphPad Prism software, and the statistical method adopts T test, and has statistical significance by taking P <0.05 as the difference.

EXAMPLE 6 Primary neuronal calcium phosphate transfection experiments

The brain tissue of AD mice was used for primary culture of neurons in vitro.

Calcium phosphate transfection experiments slides of cultured neurons on the inner surface of 24 well plates were placed in equilibrated 1.5mL DMEM, 7.5% CO ₂ Starvation was performed in the incubator for 1 hour. During the preparation of plasmid and calcium transfer reagent, the required amount of plasmid and 5 mu L of 2M CaCl ₂ Added to water to prepare a 50. Mu.L system. 50 μl of 2×HBS (pH=7.05) was added dropwise with vortexing CaCl ₂ In the plasmid mixture, the mixture was allowed to stand in a dark environment for about 20 minutes to form a transfection solution. The transfection solution is evenly dripped into the slide in the hole, 7.5 percent CO is added ₂ The incubator stands for about 15 minutes (apparent calcium phosphate crystals are large)Small). Then washing with 1mL DMEM for 2 times, placing the slide into neuron maintenance culture solution, and returning to 5% CO ₂ The culture was carried out in an incubator for 1 hour, and half-change was performed.

Wherein, the experiment is divided into 4 groups, and plasmids are respectively selected from pSUPER vector plasmid (blank group), pSUPER vector plasmid transfected with scr-Prnp (negative control), SUPER vector plasmid transfected with shPrnp#1p and pSUPER vector plasmid transfected with shPrnp#2.

The plasmid construction method is to adopt shRNA primer and pSUPER carrier plasmid to incubate and connect, and obtain plasmid for generating siRNA in transfected cells.

The primers used for each set of plasmids were as follows:

shPrnp 1#：

F:GATCTCCcctgtgatcctcctcatctTTCAAGAGAagatgaggaggatcacaggTTTTTGGAAC SEQ ID No.7

R:TCGAGTTCCAAAAAcctgtgatcctcctcatctTCTCTTGAAagatgaggaggatcacaggGGA SEQ ID No.8

shPrnp 2#

F:GATCTCCtcctcatctccttcctcatTTCAAGAGAatgaggaaggagatgaggaTTTTTGGAAC SEQ ID No.9

R:TCGAGTTCCAAAAAtcctcatctccttcctcatTCTCTTGAAatgaggaaggagatgaggaGGA SEQ ID No.10

scr-Prnp.

F:GATCTCCgttcctgccctctctactaTTCAAGAGAtagtagagagggcaggaacTTTTTGGAAC SEQ ID No.11

R:TCGAGTTCCAAAAAgttcctgccctctctactaTCTCTTGAAtagtagagagggcaggaacGGA SEQ ID No.12

the siRNA targeting sequence sequences obtained by sequencing shPrnp1# and shPrnp2# are respectively as follows:

RRNP siRNA 1#:CCTGTGATCCTCCTCATCT SEQ ID No.13

PRNP siRNA 2#:TCCTCATCTCCTTCCTCAT SEQ ID No.14

analysis of results

Analysis of brain neuronal Synapses (SD) was targeted by RNA-seq detection, and the experimental results are shown in FIGS. 1-3.

Among them, analysis of volcanic (fig. 1) and thermal (fig. 2) charts revealed that AD mice Prnp expression was significantly increased compared to the wild-type group and AD group with littermates in SD of 3-month old mice and 6-month old mice. Comparing the expression differences between the 3-month-old and 6-month-old AD mice, it was found that the differential expression was more pronounced with the increase of time.

Through gene function enrichment analysis (GO analysis) on genes with significant transcriptome gene expression, the Prnp gene functions are mainly enriched in: binding of aβ recognition, modulation of dendritic spines, metal ion recognition transport, age-related neurodegenerative disease modulation, and the like (fig. 3). Therefore, prnp can be a candidate biomarker for early diagnosis of neurodegenerative diseases.

The qRT-PCR results are shown in FIG. 4, and the experimental results show that (FIG. 4A) there is no significant difference in the expression level of Prnp in the cerebral cortex tissues of 3 month old wild type mice and AD mice. In contrast, the results of the hippocampal tissue comparison between the 3-month-old wild-type mice and the AD mice, and the cerebral cortex tissue and the hippocampal tissue comparison between the 6-month-old wild-type mice and the AD mice showed that the expression level of Prnp of the AD mice was significantly reduced relative to that of the wild-type mice. While the results for brain nerve synapses showed that the Prnp expression level in the synapses of 3 month old AD mice was significantly higher than that of wild-type mice, while 6 month old mice did not show this difference (fig. 4B).

From the experimental results, different detection methods and different detection sources can influence the early diagnosis of Alzheimer's disease, and the comprehensive RNA-seq result and qPCR result show the same trend for the early detection result of the neuron dendrite, namely, the Prnp expression amount in the neuron dendrite is obviously improved in the early development of Alzheimer's disease. For the AD mouse model, no amyloid plaques have yet appeared in the brains of 3 month old mice, whereas amyloid plaques have appeared in the brains of 6 month old mice. Whereas both qPCR results and RNA-seq results showed that Prnp expression levels had been shown to have significant differences before amyloid plaques appeared. It is demonstrated that Prnp expression in neuronal synapses can be used as a marker for early Alzheimer's disease for early screening and detection of Alzheimer's disease.

The primary neuron calcium phosphate transfection experiment result is shown in fig. 5, and the experiment result shows that the shPrnp calcium transfection is carried out on the neurons on 14 days, so that the expression of the Prnp in the neurons on 14 days is knocked down, and the density, the size and the like of dendritic spines and synapses in the neurons can be repaired (fig. 5). Dendritic spines are protruding structures on neuronal dendrites that are the primary structure of postsynaptic components in the synaptic structure. Dendritic spine is the most direct anatomical structure of synaptic connection and delivery, and its dynamic changes in formation and degradation are widely recognized as a hallmark of synaptic plasticity. There are studies showing that AD mice have significantly less dendritic spines and synapses than wild-type mice and that a decrease in dendritic spines and synapses occurs before amyloid plaques appear, i.e., this feature occurs in the early stages of alzheimer. The experimental results of the invention prove that the increased expression of Prnp gene can cause synaptic loss and smaller volume of dendritic spines, and the increase of volume and number of dendritic spines and synapses is realized by knocking down Prnp gene. From the results of calcium phosphate transfection experiments, it was found that Prnp gene in early brain neurons of Alzheimer's disease was highly expressed and could be used as a marker of early Alzheimer's disease, which was consistent with qPCR results and RNA-seq results.

In addition, the results of primary neuronal calcium phosphate transfection experiments also revealed the use of the Prnp gene as a target for early treatment. Knocking down Prnp can repair the density and size of dendritic spines and synapses in neurons, etc. Whereas dendritic spines and synapses in neurons have been shown to be associated with synapses or dendritic spines morphology changes associated with alzheimer's disease, an important factor in causing neurodegenerative diseases. According to the invention, the RRNP siRNA 1# and 2# are used for inhibiting the expression of Prnp genes, so that the volumes of dendritic spines and synapses in neurons are increased, the number is increased, the reduction of Prnp expression can increase the synaptic plasticity, and the density and thickness of the dendritic spines are improved, so that the RRNP siRNA is used for repairing neurons and slowing down the neurodegenerative disease process, and improving or treating the neurodegenerative disease. Therefore, the experimental results show the reparative effect of the Prnp gene expression inhibitor on the density and thickness of dendritic spines and synapses, thereby indicating the improvement and treatment effect of neurodegenerative diseases.

SEQUENCE LISTING

<110> Shenzhen advanced technology research institute

<120> a neurodegenerative disease marker Prnp and uses thereof

<130> CP120011058C

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> artificial sequence

<400> 1

accagaacaa cttcgtgcac 20

<210> 2

<211> 20

<212> DNA

<213> artificial sequence

<400> 2

ttctcccgtc gtaataggcc 20

<210> 3

<211> 24

<212> DNA

<213> artificial sequence

<400> 3

tcaacagcaa ctcccactct tcca 24

<210> 4

<211> 24

<212> DNA

<213> artificial sequence

<400> 4

accctgttgc tgtagccgta ttca 24

<210> 5

<211> 24

<212> DNA

<213> artificial sequence

<400> 5

ggagtcctgt tgatgttgcc agta 24

<210> 6

<211> 24

<212> DNA

<213> artificial sequence

<400> 6

gggacgcagc aactgacatt tcta 24

<210> 7

<211> 64

<212> DNA

<213> artificial sequence

<400> 7

gatctcccct gtgatcctcc tcatctttca agagaagatg aggaggatca caggtttttg 60

gaac 64

<210> 8

<211> 64

<212> DNA

<213> artificial sequence

<400> 8

tcgagttcca aaaacctgtg atcctcctca tcttctcttg aaagatgagg aggatcacag 60

ggga 64

<210> 9

<211> 64

<212> DNA

<213> artificial sequence

<400> 9

gatctcctcc tcatctcctt cctcatttca agagaatgag gaaggagatg aggatttttg 60

gaac 64

<210> 10

<211> 64

<212> DNA

<213> artificial sequence

<400> 10

tcgagttcca aaaatcctca tctccttcct cattctcttg aaatgaggaa ggagatgagg 60

agga 64

<210> 11

<211> 64

<212> DNA

<213> artificial sequence

<400> 11

gatctccgtt cctgccctct ctactattca agagatagta gagagggcag gaactttttg 60

gaac 64

<210> 12

<211> 64

<212> DNA

<213> artificial sequence

<400> 12

tcgagttcca aaaagttcct gccctctcta ctatctcttg aatagtagag agggcaggaa 60

cgga 64

<210> 13

<211> 19

<212> DNA

<213> artificial sequence

<400> 13

cctgtgatcc tcctcatct 19

<210> 14

<211> 19

<212> DNA

<213> artificial sequence

<400> 14

tcctcatctc cttcctcat 19

Claims

1. Use of a composition for early assessment of risk of alzheimer's disease in the preparation of a reagent for detecting risk assessment of alzheimer's disease;

the Alzheimer's disease risk assessment is Alzheimer's disease early risk assessment;

compositions for early assessment of risk of Alzheimer's disease include compositions for detecting prion-encoding gene levels in brain neuronal synapses in a subject;

the composition for detecting prion-encoding gene levels in brain neuronal synapses in a subject comprises a primer and/or probe combination selected from the group consisting of detecting NM_001278256.1 gene fragments.

2. The use according to claim 1, wherein the primers are SEQ ID No.1 and SEQ ID No.2:

F:accagaacaacttcgtgcac SEQ ID No.1

R:ttctcccgtcgtaataggcc SEQ ID No.2。

3. use of a kit for early assessment of risk of alzheimer's disease in the preparation of a reagent for detecting risk assessment of alzheimer's disease;

the kit comprises a composition for early assessment of risk of Alzheimer's disease;

the composition for early assessing the risk of Alzheimer's disease comprises a composition for detecting the level of a prion-encoding gene in a brain neuronal synapse of a subject;

4. The use according to claim 3, wherein the primers are SEQ ID No.1 and SEQ ID No.2:

F:accagaacaacttcgtgcac SEQ ID No.1

R:ttctcccgtcgtaataggcc SEQ ID No.2。