KR102105016B1 - Method for Diagnosing Alzheimer's disease Using microRNA-485-3p - Google Patents

Abstract

The present invention relates to a method for providing information for diagnosing Alzheimer's disease or brain disease using miR-485-3p, a composition for diagnosing Alzheimer's disease or brain disease, and a diagnostic kit. According to the present invention, objective data analysis for diagnosis of Alzheimer's disease or brain disease is possible by measuring the expression level of miR-485-3p in the blood, and the risk of patients is minimized by measuring the concentration of amyloid beta 42 in saliva. , Fast and accurate diagnosis is possible. Therefore, it is very useful for the prevention of Alzheimer's disease or brain disease.

Description

Alzheimer's disease diagnosis method using miR-485-3p {Method for Diagnosing Alzheimer's disease Using microRNA-485-3p}

The present invention relates to a method for providing information for diagnosis of Alzheimer's disease or brain disease using miR-485-3p, and more particularly, comprising measuring the expression level of micro RNA miR-485-3p from the collected sample. It relates to a method of providing information for diagnosis of Alzheimer's disease or brain disease. In addition, it relates to a composition and a diagnostic kit for diagnosing Alzheimer's disease or brain disease using miR-485-3p or amyloid beta 42.

Recent treatment stances for Alzheimer's disease have centered on the possibility that Alzheimer's disease is derived from cholinergic signaling and transmission with impaired function in the cerebral cortex and hippocampus (Bartus et al. , Science.217(4558):408-14(1982) and Coyle et al., Science.219(4589):1184-90(1983)).

Since these areas of the brain are linked to memory and intelligence, functional deficiencies in these parts of the brain damage memory and judgment and lead to loss of intellectual abilities. The exact process by which neuronal signaling is impaired is controversial, but senile plaques and neurofibrillary tangles (NFTs) are considered pathologically the main phenomena.

In particular, senile plaque caused by accumulation of amyloid beta (Aβ) is the most characteristic of this disease, and Alzheimer's disease can be confirmed by post-mortem autopsy (Khachaturian, Arch. Neurol. 42(11):1097-105(1985)).

In the case of Alzheimer's disease, drugs and treatments that increase the amount of acetylcholine to suppress cholinergic neurotransmission damage, allow acetylcholine to exist for a long time, or to make acetylcholine more effective in the transmission of nerve cells are available. Therefore, various compounds that increase acetylcholine activity in Alzheimer's disease patients have been used.

Currently, the most effective approach is to inhibit the activity of acetylcholinesterase, which rapidly breaks down acetylcholine at the synapse and blocks the transmission of nerve signals. In fact, these inhibitors (e.g. tacrine, donepezil, galantamine and rivastigmine) are currently marketed as drugs for Alzheimer's disease approved by the FDA, but in many cases these drugs are effective in alleviating the progression of the disease, but are not well applied to cure. have.

In addition, some compounds aim to improve the general health of nerves and maintain normal cell function with age. For example, some drugs, such as NGF and estrogen, play a neuroprotective role that slows nerve degeneration, while others, such as antioxidants, reduce cellular oxidation, reducing the increase in harmful cellular damage resulting from normal aging. Let it.

Alzheimer's disease is serious if the accumulation of amyloid beta peptides increases, and it is thought that reducing the accumulation of amyloid beta in the neuritic space will slow the progression of Alzheimer's disease. In addition, amyloid precursor protein (APP) is thought to proceed in many different forms in combination with intracellular proteolytic enzymes such as α-, β-, and γ-secretases. However, it is not yet possible to control the formation of amyloid beta, since the process of formation of amyloid beta has not been fully elucidated scientifically.

It is not clear how the accumulation of amyloid beta causes abnormal nerve signal transmission, and when APP is abnormally cleaved, a lot of amyloid beta is produced and accumulated in the neuritis space, plaque formation is induced. Thus, many other factors involved in this cleavage response (e.g., inflammatory reactions) increase the phosphorylation of tau protein, and increase the accumulation of NFTs and paired helical filaments (PHFs), which in turn leads to nerves. Increase the damage. All of these factors cause nerve dysfunction and ultimately accelerate the progression of Alzheimer's disease to dementia.

Although the development of a treatment method for reducing the effect of Alzheimer's disease is actively progressing, it is currently providing temporary symptomatic improvement. In conclusion, the current Alzheimer's disease treatment focuses not on reversing the course of the disease, but on improving the symptoms of the disease, and knowing more about the biological knowledge of the disease, but the results of its application to clinical applications are not yet successful. not.

In this regard, U.S. Patent No. 5,532,219 discloses a composition for treating Alzheimer's disease, including 4,4'-diaminodiphenylsulfone, and U.S. Patent No. 5,506,097 is para-amidinophenylmethanesulfonyl fluorine. It discloses a composition for treating Alzheimer's disease comprising lead or everlactone A, and US Patent No. 6,136,861 discloses a composition for treating Alzheimer's disease comprising bicyclo[2.2.1]heptane.

ELAVL2 is an ELAVL like neuron-specific RNA binding protein 2 and is a form of nELAVL2. nELAVL2 is a brain-specific RNA binding protien and is known to be related to neurodegenerative disease. It is known that ELAVL2 is underexpressed as a result of performing high-throughput RNA sequence using brain tissue after post-mortem examination of Alzheimer's disease patients.

Alzheimer's disease is the most common form of dementia, and 75% of patients with dementia are Alzheimer's. In most cases, Alzheimer's disease develops beyond the age of 65, but rarely can develop before that. In the United States, about 3% of people aged 65 to 74, about 19% of people aged 75 to 84, and 50% of people aged 85 or older have the disease. In Korea, according to a recent research report focusing on a rural area, it is reported that about 21% of the population aged 60 or older in rural areas have dementia, and 63% of them are Alzheimer-type dementia. It is a disease of 266,000 people around the world in 2006. By 2050, it is predicted that 1 in 85 will be affected.

There is no cure for Alzheimer's dementia, and the only option is to prescribe symptom relief following diagnosis. In addition, there is no early diagnosis system. In the case of the existing diagnosis, it is proceeded in various ways, but there are many disadvantages. The paperweight method may have errors due to cognitive differences, structural brain imaging is expensive, and nuclear medical brain imaging is disadvantageous in that it uses radioactive isotopes and is expensive. Measurement of tau protein through cerebrospinal fluid analysis has risks due to invasive methods and cerebrospinal fluid extraction.

Accordingly, the present inventors selected markers capable of diagnosing cranial nerve diseases such as Alzheimer's disease, and at the same time, as a result of earnest efforts to develop a more accurate diagnostic method, confirmed that the expression level of miR-485-3p extracted from blood increased, and the present invention. Was completed.

The information described in the background section is only for improving an understanding of the background of the present invention, and thus does not include information forming the prior art known to those of ordinary skill in the art to which the present invention pertains. May not.

An object of the present invention is to provide a method of providing information for early diagnosis of Alzheimer's disease or brain disease by measuring the expression level of miR-485-3p. In addition, it is to provide a diagnostic method, a diagnostic composition and a diagnostic kit for Alzheimer's disease or brain disease.

In order to achieve the above object, the present invention provides a method for providing information and a method for diagnosing Alzheimer's disease or brain disease, including measuring the expression level of miR-485-3p from the collected sample.

The present invention also provides a composition for diagnosing brain diseases such as Alzheimer's disease and a diagnostic kit for measuring the expression level of miR-485-3p or the concentration of amyloid beta 42.

According to the present invention, it is possible to analyze objective data for diagnosis of Alzheimer's disease or brain disease by measuring the expression level of miR-485-3p in blood, and additionally, the risk of the patient is measured by measuring the concentration of amyloid beta 42 in saliva. It is minimized, and quick and accurate diagnosis is possible. Therefore, according to the present invention, it is very useful for the prevention of Alzheimer's disease or brain disease by early diagnosis of Alzheimer's disease or brain disease.

1 is (A) is a result of analyzing the miRNA expression pattern (volcano blot) in the patient group compared to the normal group, (B) is a graph comparing the expression of miR-485-3p in the patient group compared to the normal group.
2 is a 3'-untranslated region (UTR) mRNA of 5xFAD and Seed sequence of miR-485-3p.
Figure 3 is a graph comparing the expression of miR-485-3p in (A) hippocampus and cortex, (B) and (C) is a comparison result of ELAVL2 expression and related protein expression in the hippocampus and cerebral cortex of 5xFAD.
Figure 4 is (A) is a quantitative comparative analysis graph of Aβ 42 in the cerebral cortex of 5xFAD, (B) is a quantitative comparative analysis graph of Aβ 42 in the hippocampus.
5 is a schematic diagram of a magnetic particle collection device. It shows the process of forming a complex of antigens, antibodies, magnetic particles and fluorescent substances.
6 is a result of quantification of Aβ derived from saliva using a magnetic particle collection device.
7 shows that patients with dementia can be distinguished by measuring the concentration of Aβ derived from saliva using a magnetic particle collection device.
8 is a schematic diagram of a process for measuring the level of a nucleic acid expressing amyloid beta (Aβ) 42.
9 is a result of comparing ELAVL2 expression according to AM485-3p transfection in Hippocampal primary cells.
10 is a result of quantitative comparison analysis of ELAVL2-containing related protein and Aβ 42 in 5xFAD treated intranasally with AM485-3p.
11 is a graph comparing cognitive function in 5xFAD treated intranasally with AM485-3p.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

In a specific example of the present invention, it was confirmed that the expression of miR-485-3p was significantly increased in blood obtained from a patient diagnosed with Alzheimer's dementia by a doctor.

Accordingly, the present invention relates to a method for providing information for diagnosis of Alzheimer's disease or brain disease, including measuring the expression level of miR-485-3p from a sample collected from one aspect. In addition, it relates to a method for diagnosing Alzheimer's disease or brain disease comprising the step of measuring the expression level of miR-485-3p from the collected sample.

The present invention may be characterized by including the step of extracting the micro RNA miR-485-3p from the sample. The sample may be blood or plasma, but is not limited thereto.

In one embodiment of the present invention, Sod. About 3 ml of blood was collected into a blood tube (Becton Dickinson, Germany) to which citrate (3.2% w/v) was added. Blood was centrifuged at 3,500 rpm for 10 minutes to separate plasma and stored at -80°C until RNA extraction. According to the manufacturer's recommendation, miRNA was extracted using the miRNeasy Serum/Plasma Kit (Qiagen, USA). The miRNA extraction is performed in the following order. Plasma or serum samples are dissolved in QIAzol Lysis Reagent, chloroform is added, and the lysate is separated into an aqueous phase and an organic phase by centrifugation. The RNA portion is divided into the upper aqueous phase, the DNA portion into the middle layer, and the protein into the middle or lower organic phase. The upper aqueous phase is extracted and ethanol is added to provide suitable conditions for binding RNA molecules of about 18 nucleotides or more. Samples are applied to an RNeasy MinElute spin column to bind all RNA to the membrane and efficiently wash away phenols and other contaminants. High-quality RNA is eluted in a small amount of RNase-free water. Since serum and plasma mainly contain small RNA, it is not necessary to separately purify the small RNA and large RNA fractions.

The present invention includes the step of measuring the expression level of micro RNA miR-485-3p.

In the present invention, the expression level of miR-485-3p is selected from the group consisting of rea-time PCR, quantitative PCR primer elongation analysis, nucleic acid chip analysis, sequencing, aptamer-based assay, and gel chromatography by electrophoresis. It may be characterized in that it is measured by a method that is, but is not limited thereto.

In one embodiment of the present invention, the concentration and purity of the extracted RNA were analyzed using Bioanalyzer2100 (Agilent, USA). The extracted RNA was screened using a miRNA array containing 84 different miRNAs known to be associated with the progression of Human Neurological Development and Neurological Disease.

Quantitative PCR assay method can be summarized as follows. Mature miRNA is generally 22nt, noncoding RNA and is responsible for post-transcriptional regulation. The mature miRNA induces polyadenylation by poly(A) polymerase and was synthesized as cDNA with oligo-dT primers. Oligo-dT primers have a 3'degenerate anchor and a universal tag sequence at the 5'end, enabling mature miRNA amplification during real-time PCR. The miScript SYBR Green PCR Kit (Qiagen) was used to quantify the mature miRNA in the real-time PCR process.

In the present invention, when the expression level of miR-485-3p is 5 times more than the normal group, more specifically 9 times or more, it may be characterized as being diagnosed as having Alzheimer's disease or brain disease. The normal group was between 59 and 64 years old, and was selected as those who had no history of Alzheimer's disease or brain disease.

In the present invention, the brain disease may be any one selected from the group consisting of autism spectrum disorder, mental retardation, amyotrophic lateral sclerosis, convulsion, stroke, Parkinson's disease, and spinal cord injury, but is not limited thereto.

The information providing method and diagnosis method according to the present invention may additionally use non-marker clinical information of the seizure disease test subject when diagnosing or prognosing Alzheimer's disease and/or various brain diseases of the test subject for the expression level of the marker. . Such non-marker clinical information of the test subject includes the subject's age, sex, weight, diet, body mass, underlying disease and EEG, seizure type, brain MRI, brain CT, or cerebrospinal fluid test, blood test, saliva test. , But is not limited thereto.

In the present invention, the method of providing information for diagnosing Alzheimer's disease or brain disease may further include measuring the concentration of amyloid beta 42 (Aβ42) from the collected sample.

The sample may be saliva or blood, but is not limited thereto. Using saliva as a sample minimizes the patient's risk and enables quick and accurate diagnosis.

The concentration of amyloid beta 42 may be measured using an antigen-antibody reaction or a nucleic acid aptamer, but is not limited thereto. The antigen-antibody reaction may be well known in the art, including an enzyme-linked immunosorbent assay (ELISA). In the case of measuring the concentration of amyloid beta 42 from the collected saliva, it is not limited thereto, but preferably, refer to Korean Patent Publication 10-2014-0025978 or Korean Patent Publication 10-2013-0140528.

In the present invention, the term'aptamer' refers to a nucleic acid having a specific binding affinity for a target molecule, and in particular, in the present invention, the target molecule is amyloid beta 42.

The specific binding affinity of an aptamer for a target means that the aptamer binds to its target with a generally higher degree of affinity than it binds to other components in the sample. Aptamer refers to a set of one or more such molecules. Different aptamers can have either the same or different numbers of nucleotides. The aptamer may be DNA or RNA or a chemically modified nucleic acid, may include a single-stranded, double-stranded or double-stranded region, and may contain a highly ordered structure. The aptamer may also be a photoaptamer, as long as a photoreactive or chemically reactive functional group is included in the aptamer so that it can be covalently bound to its corresponding target. Any of the aptamer methods described herein may involve the use of two or more aptamers that specifically bind to the same target molecule.

Aptamers can be identified using any known method, including SELEX. Once identified, the aptamer can be prepared or synthesized according to any known method including chemical synthesis methods and enzyme synthesis methods.

The terms "SELEX" and "SELEX process" refer to (1) selection of aptamers that interact with target molecules in a preferred manner, for example, binding with high affinity to proteins, and (2) selection of the selected nucleic acids. It is used interchangeably herein to generally refer to a combination of amplification. The SELEX process can be used to identify an aptamer having high affinity for a specific target or biomarker. SELEX generally prepares a mixture of nucleic acids, binds the mixture of candidates to a desired target molecule to form an affinity complex, separates the affinity complex from the unbound candidate nucleic acid, and separates from the affinity complex. It includes isolating and isolating nucleic acids, purifying nucleic acids, and amplifying specific aptamer sequences. The process may include multiple rounds to further improve the affinity of the selected aptamer. The process may include an amplification step at one or more points in the process (eg US 5,475,096: Nucleic Acid ligands). The SELEX process can be used to generate aptamers that covalently bind to its target as well as aptamers that non-covalently bind to its target (e.g., US 5,705,337: Systematic Evolution of Nucleic Acid Ligands by Exponential Enrichment: Chemi-SELEX). The SELEX process can be used to identify high-affinity aptamers containing altered nucleotides that impart improved properties on the aptamer, for example improving in vivo stability or enhancing transport properties. have. Examples of such modifications include chemical substitutions in ribose and/or phosphate and/or base position. The aptamer identified in the SELEX process is US Patent No. 5,660,985 ("High Affinity Nucleic Acid Ligands Containing Modified Nucleotides"), which describes an oligonucleotide containing a nucleotide derivative chemically modified at the 5'- and 2'-positions of pyridine. It is described in. With reference to the above, US 5,580,737 is one or more modified to 2'-amino (2'-NH2), 2'-fluoro (2'-F) and/or 2'-O-methyl (2'-OMe). A highly specific aptamer comprising the above nucleotides is described. In addition, reference may be made to US 2009/0098549 (SELEX and PHOTOSELEX), which describes nucleic acid libraries having physical and chemical properties extended from SELEX and optical SELEX and their uses. SELEX can also be used to identify aptamers with desirable off-rate properties. Reference may be made to US 2009/0004667 (Method for Generating Aptamers with Improved Off-Rates), which describes an improved SELEX method for generating an aptamer capable of binding to a target molecule.

The aptamer is immobilized on a solid support prior to contacting the sample. However, under certain circumstances, immobilization of the aptamer prior to contact with the sample may not provide an optimal assay. For example, pre-immobilization of the aptamer may lead to inefficient mixing of the aptamer with the target molecule on the surface of the solid support over a long reaction time, so Long cultivation period is required for efficient binding. In addition, if the photoaptamer is used in the assay and depends on the material used as a solid support, the solid support will tend to scatter or absorb the light used to achieve the formation of covalent bonds between the photoaptamer and its target molecule. I can. Moreover, since, depending on the method used, the surface of the solid support can also be exposed to and affected by any labeling reagent, detection of a target molecule bound to its aptamer affects the imprecision. Easy to receive Finally, immobilization of the aptamer on a solid support generally includes an aptamer-manufacturing step (i.e., immobilization) prior to exposure of the aptamer to the sample, which manufacturing step affects the activity or functionality of the aptamer. I can go crazy.

The aptamer may be configured to facilitate the separation of the assay component from the aptamer biomarker complex (or the photoaptamer biomarker covalently bonded complex), and to enable isolation of the aptamer for detection and/or quantification. In one embodiment, this construct may comprise a cleavable or releasable component within the aptamer sequence. In other implementations, additional functionality, such as labeled or detectable components, spacer components, or specific binding tags or immobilization components can be introduced into the aptamer. For example, the aptamer may include a tag connected to the aptamer through a cleavable moiety, a label, a spacer component separating the label, and a releaseable portion.

The nucleic acid aptamer is not limited thereto, but DNA, RNA, anti-miR, antisense molecule, fire fighting RNA molecule (siRNA), small hairpin RNA molecule (shRNA), 2'-O-modified oligonucleotide , Phosphorothioate-backbone deoxyribonucleotide, phosphorothioate-backbone ribonucleotide, decoy oligonucleotide, peptide nucleic acid (PNA) oligonucleotide or LNA (locked nucleic acid) oligonucleotide. It can be characterized.

In an embodiment of the present invention, a structural feature in which a quencher is released and fluorescence is expressed at the same time when binding with amyloid beta 42 using a sequence that specifically binds to amyloid beta 42 and a sequence that binds itself inside a nucleic acid. Synthetic multi-nucleic acid. Since the size of the multinucleic acid is smaller than that of an antibody, it has excellent specificity and selectivity, and it is possible to provide a diagnostic method with high diagnostic ease because sampling and mass analysis are possible within 1 hour.

In the present invention, when the concentration of amyloid beta 42 is 0 or more and less than 500 pg/ml, it is normal, 500 pg/ml or more and less than 1 ng/ml, mild cognitive impairment (MCI), or 1 ng/ml or more, the patient is diagnosed as a severe patient. can do.

In one embodiment of the present invention, by quantifying amyloid beta 42 in more than 100 dementia patients through a previous study, it succeeded in distinguishing between mild cognitive impairment and moderate dementia (consistent with the diagnosis of a clinician by more than 90%).

In one embodiment of the present invention, it was confirmed that the increase pattern of miR-485-3p significantly affects the expression amount of APP known as an amyloid beta precursor.

In another aspect, the present invention relates to a composition for diagnosing Alzheimer's disease or brain disease, including a primer capable of amplifying miR-485-3p or a probe capable of hybridizing with miR-485-3p.

In the present invention, the primer is constructed to have approximately complementarity with each strand of miR-485-3p to be amplified, and contains an appropriate G or C nucleotide. This means that the primer has sufficient complementarity to hybridize with the corresponding nucleic acid strand under the conditions of performing the polymerization reaction. The primers of the present invention are used in an amplification process, and the amplification process is an enzymatic continuous reaction that increases in an exponential number while passing through a reaction step having many target locus, such as PCR. Typically, one primer (antisense primer) has homology to the negative (-) strand of the locus, and the other primer (sense primer) has homology to the positive (+) strand. When the primer is annealed to the denatured nucleic acid, the chain is elongated by enzymes and reactants such as DNA polymerase I (Klenow) and nucleotides, and as a result, + and-strands containing the target locus sequence are newly synthesized. When the newly synthesized target locus is also used as a template and the cycles of denaturation, primer annealing, and chain extension are repeated, exponential synthesis of the target locus sequence proceeds. The product of the continuous reaction is an independent double-stranded nucleic acid having an end corresponding to the end of the specific primer used in the reaction.

The amplification reaction is preferably a PCR commonly used in the art. However, alternative methods such as real-time PCR or linear amplification using isothermal enzymes can also be used, and multiplex amplification reactions can also be used.

In the present invention, the probe is labeled so as to be detectable, for example, a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelate, or an enzyme. Appropriately labeling such a probe is a technique well known in the art, and can be performed through a conventional method. As the probe, a probe that specifically binds to a known nucleic acid biomarker for diagnosis of a disease may be used, and a disease may be diagnosed by checking whether a specific biomarker or a fragment thereof is contained through the binding with such a probe.

In the present invention, the sequence of miR-485-3p may be characterized in that it is derived from mammals, for example, derived from humans, mice, or rats.

In one embodiment of the present invention, the sequence of miR-485-3p is human-derived, and the mature sequence (5' GUCAUACACGGCUCUCCUCUCU 3'(SEQ ID NO: 1)), as well as the precursor sequence (5'- ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCU- 3'CUUUUUAGUCUCUCCU-Sequence It includes the number 2)).

Accordingly, in the present invention, the primer or probe may be characterized in that it includes a sequence complementary to all or part of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, but is not limited thereto.

In the present invention, the composition for diagnosing Alzheimer's disease or brain disease may further include an antibody or nucleic acid aptamer that specifically binds to amyloid beta 42. The antibody or nucleic acid aptamer is for detecting amyloid beta 42, and can be used in any form for detection of amyloid beta 42 from a sample.

In another aspect, the present invention relates to a kit for diagnosing Alzheimer's disease or brain disease, including the composition for diagnosing Alzheimer's disease or brain disease.

The diagnostic kit of the present invention may be used for diagnosis of Alzheimer's disease and/or various brain diseases, and most preferably may be used for diagnosis of Alzheimer's disease.

In addition to the above-described components, the kit of the present invention may further include other components. For example, when the kit of the present invention is applied to a PCR amplification process, it may optionally include reagents necessary for PCR amplification, such as a buffer, DNA polymerase, DNA polymerase cofactor, and dNTP, and are limited thereto. It is not. The kit of the present invention may be manufactured in a number of separate packaging or compartments including the reagent components described above.

In addition, the kit according to the present invention may be a microarray, preferably a gene amplification kit. When the kit is a microarray, the probe is immobilized on the solid surface of the microarray. When the kit of the present invention is a gene amplification kit, a primer is included. The probe or primer specifically recognizes miR-485-3p according to the present invention and has a sequence complementary to the sequence. The term'complementary' as used herein refers to having a degree of complementarity to selectively hybridize to the nucleotide sequence under predetermined hybridization or annealing conditions, as defined above, and the probe or primer of the present invention is completely In addition to being complementary, as long as it can selectively hybridize to the nucleotide sequence, it may have one or more mismatched nucleotide sequences. The nucleotide sequence of the miRNA of the present invention to be referenced when making a primer or probe can be identified in miRBase, and a primer or probe can be designed with reference to this sequence.

A composition comprising a substance capable of inhibiting the activity of miR-485-3p according to the present invention and a pharmaceutically acceptable carrier may be provided as a pharmaceutical composition for preventing or treating Alzheimer's disease or brain disease.

Based on the finding that the reduction of ELAVL2 expression by miR-485-3p of the present invention is associated with Alzheimer's disease, it includes a substance capable of inhibiting the activity of miR-485-3p and a pharmaceutically acceptable carrier. It provides a pharmaceutical composition for the treatment or prevention of Alzheimer's disease disease.

At this time, the "miR" is known as a regulator involved in the transcriptional step after gene expression by mainly inhibiting translation of the target RNA or promoting degradation, and refers to a non-coding RNA consisting of 21 to 23 deoxyribonucleotides.

In addition, the mature sequence of the miR can be obtained from the miR database (http://www.mirbase.org). As of August 2012, according to the miR database (19th edition, miRBase), 25,141 mature miRs from 193 species have been registered.

In the present invention, miR-485-3p is not limited thereto, but is expressed in the brain, particularly in the hippocampus and cortex, binds to the 3'untranslated region of ELAVL2 mRNA encoding ELAVL2 protein, and inhibits its expression, Decreases the concentration of ELAVL2 protein in the brain.

In the present invention, inhibition of miR-485-3p activity refers to inhibiting or interfering with the intracellular function or function of miR-485-3p, and typically miR-485-3p is its target, for example, ELAVL2 protein. Directly inhibiting the binding to the mRNA molecule encoding for, or directly inhibiting the function of miR-485-3p using a small molecule inhibitor, an antibody, or a fragment of an antibody, or an inhibitor or small interfering RNA (siRNA) molecule. Includes those controlled indirectly by using.

Furthermore, interfering or inhibiting the activity of miR-485-3p includes directly or indirectly inhibiting the activity of the precursor sequence (SEQ ID NO: 2) and the mature sequence (SEQ ID NO: 1). In addition, inhibition of miR-485-3p activity involves lowering its intracellular concentration by inhibiting the transcription of miR-485-3p.

The substance capable of inhibiting the activity of miR-485-3p includes any substance capable of inhibiting its expression and/or activity, and such substances include, for example, compounds (low molecular weight, high molecular weight), antagomere, antisense Molecules, small hairpin RNA molecules (shRNA), fire fighting RNA molecules (siRNA), seed target LNA (Locked Nucleic Acid) oligonucleotides, decooligonucleotides, aptamers, ribozymes, or antibodies that recognize DNA:RNA hybrids can do.

The antisense oligonucleotide encompasses a nucleic acid-based molecule capable of forming a duplex with a miRNA since it has a sequence complementary to all or a part of the seed sequence of a target miRNA, particularly miRNA. Thus, the antisense oligonucleotide can be represented as a complementary nucleic acid-based inhibitor.

In addition, the antisense oligonucleotide includes various molecules, such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomere, 2'-O-modified oligonucleotide, phosphorothioate-backbone deoxyribonucleotide, As a phosphorothioate-backbone ribonucleotide, a peptide nucleic acid (PNA) oligonucleotide or a locked nucleic acid (LNA) oligonucleotide, it is preferably a ribonucleic acid.

The ribonucleic acid includes a double-stranded small hairpin RNA molecule (shRNA), a fire fighting RNA molecule (siRNA), and a ribozyme.

Compared to conventional oligonucleotides, the LNA has a locked form by subjecting additional modifications between the 2'to 4'carbons of the ribose sugar site to secure thermal stability.

The peptide nucleic acids (PNA) contain a peptide-based backbone instead of a sugar-phosphate backbone. The 2'-O-modified oligonucleotide is preferably a 2'-O-alkyl oligonucleotide, more preferably a 2'-O-C1-3 alkyl oligonucleotide, and most preferably a 2'-O-methyl oligonucleotide. It is a nucleotide.

The antisense oligonucleotides include antisense oligonucleotides, antagomeres, and inhibitory RNA molecules in a narrow sense.

The antagomere is a single-stranded chemically modified oligonucleotide and is used for the silence of endogenous microRNAs. Antagomere contains a sequence that is not complementary at the Arganoute 2 (Ago 2) cleavage site, or has a base such as 2'methoxy group, 3'cholesterol group, phosphorothioate so that Ago2 cleavage is inhibited. It has been modified and has a sequence complementary to the target sequence.

In the present invention, the antagomere has a sequence that is at least partially or completely complementary to miR-485-3p. In an embodiment of the present invention, antagomere includes one or more modifications (eg, 2′-O-methyl-sugar modification, or 3′ cholesterol modification). In another embodiment the antagomere comprises one or more phosphorocioate linkages and at least partially has a phosphorothioate backbone.

In the present invention, the length of an antagomere suitable for inhibiting the expression of miR-485-3p is 7-50 nucleotides, in particular 10-40 nucleotides, particularly 15-30 nucleotides, even more particularly 15-25 nucleotides, particularly 16 To 19nt, but is not limited thereto.

The term'complementary' as used in the present invention means that the antisense oligonucleotide is sufficiently complementary to selectively hybridize to the miR-485-3p target under predetermined hybridization or annealing conditions, preferably physiological conditions. It is meant to encompass both partially substantially complementary and completely complementary, preferably completely complementary. Substantially complementary means complementarity to the extent that it is not completely complementary, but produces a sufficient effect to interfere with the effect of the present invention by binding to the target sequence, that is, the activity of miR-485-3p.

The'nucleic acid' includes oligonucleotides, DNA, RNA, and polynucleotides, analogs and derivatives thereof, and includes, for example, peptide nucleic acids (PNA) or mixtures thereof. In addition, the nucleic acid may be single or double stranded, and may encode a molecule including mRNA, microRNA, siRNA, or polypeptide.

In an embodiment of the present invention, a substance capable of inhibiting the activity of miR-485-3p is complementarily bound to all or part of the precursor and/or mature sequence of miR-485-3p, particularly the seed sequence, and its activity It is an antisense oligonucleotide capable of inhibiting. The inhibition of this activity is to inhibit the transcription of miR-485-3p and/or the binding of miR-485-3p to the target mRNA. In the antisense oligonucleotide according to the present invention, the nucleotide constituting it or the backbone (skeleton) connecting the nucleotides may or may not include one or more of the following modifications. That is, in the antisense oligonucleotide, at least one nucleotide constituting it is LNA, or a sugar of at least one nucleotide constituting it is 2'-O-methylated and medoxylethyl, or at least one phosphorothioate in its backbone may be included. have.

In an embodiment of the present invention, the antisense oligonucleotide or nucleic acid molecule includes a sequence complementary to all or part of the seed sequence of miR-485-3p. The seed sequence is a sequence conserved in various species that are very important for the recognition of target molecules of miRNA (Krenz, M. et al., J. Am. Coll. Cardiol. 44:2390-2397 (2004); H. Kiriazis, et al., Annu. Rev. Physiol. 62:321 (2000)). Since miRNA binds to the target through the seed sequence, when the interaction of the seed sequence with the target is inhibited, translation of the target mRNA can be effectively inhibited.

In an embodiment of the present invention, a sequence entirely or partially complementary to the nucleotide sequence from the 1st or 2nd to the 7th or 8th nucleotide sequence of SEQ ID NO: 1, for example, the antisense oligonucleotide of the present invention is 5'-GUGUAUGAC-3' (SEQ ID NO: 3), 5'-UGUAUGAC-3' (SEQ ID NO: 4), 5'-GUGUAUGA-3' (SEQ ID NO: 5), 5'-UGUAUGA-3' (SEQ ID NO: 6 ) Or 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 7), and each of the one or more nucleotides constituting the oligonucleotide is 2'-O-methylated or medoxylethylated, or each of the one or more nucleotides is LNA Or, one or more of the chemical bonds constituting the backbone may be phosphorthioate, but may not include the above modification.

The present invention is based on the discovery that miR-485-3p is involved in the onset of Alzheimer's disease and various brain diseases by excessively inhibiting the expression of ELAVL2.

The decrease in ELAVL2 expression level is known to be associated with Alzheimer's disease, autism spectrum disorder, mental retardation, and amyotrophic lateral sclerosis. In particular, the protein level of ELAVL2 decreases in substances such as kainic acid, NMDA, quisulate, AMPA, glutamate, which cause excitotoxicity, and causes cranial nerve cell death, causing impaired brain function, convulsions, stroke, Parkinson's disease, spinal cord. It is known to cause various brain diseases such as injury (Kaminska, B. et al., Acta Biochim Pol. 44:781-789).

Therefore, the recovery of ELAVL2 protein through inhibition of miR-485-3p activity of the present invention is a variety of brains such as Alzheimer's disease and/or autism spectrum disorder, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, spinal cord injury, etc. It can be used in the treatment of diseases.

In an embodiment of the present invention, the pharmaceutical composition containing a substance capable of inhibiting the activity of miR-485-3p is used for the treatment of Alzheimer's disease, and the brain disease includes Alzheimer's disease, autism spectrum disorder, and mental Retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, and spinal cord injury.

The terms "treatment", "mitigation" or "improvement" as used in the present invention mean any action that improves or beneficially alters the symptoms of related diseases by administration of the present composition. Those of ordinary skill in the art to which the present application pertains will be able to know the exact criteria of the disease and determine the degree of improvement, improvement, and treatment by referring to data presented by the Korean Medical Association.

The term'prevention' as used in the present invention means any action that suppresses or delays the onset of related diseases. In the present invention, it will be apparent to those skilled in the art that the pharmaceutical composition can prevent related diseases if administered before initial symptoms or appearance.

In the present invention, the pharmaceutical composition contains at least one active ingredient that exhibits the same, similar or synergistic function for the treatment of related diseases other than a substance capable of inhibiting the activity of miR-485-3p of the present invention, or miR-485 It may further contain a substance capable of inhibiting the activity of -3p and a compound that maintains/increases the solubility and/or absorption of the active ingredient. Also, optionally, an immunomodulatory agent and/or a chemotherapeutic agent may be further included.

The pharmaceutical composition may further include one or more pharmaceutically acceptable diluents, carriers and/or adjuvants in addition to the above-mentioned active ingredients. Pharmaceutically acceptable carriers can be used by mixing saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and one or more of these ingredients, and if necessary, antioxidants. , Buffers, bacteriostatic agents, and other conventional additives may be added.

In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to form injection formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules, or tablets. Thus, a target organ-specific antibody or other ligand may be used in combination with the carrier.

Further, it can be preferably formulated according to each disease or ingredient by an appropriate method in the relevant technical field or using a method disclosed in Remington's Pharmaceutical Science (latest edition), Mack Publishing Company, Easton PA. . For example, it may be formulated as a suspension, liposome formulation, emulsion, tablet, capsule, gel, syrup, or suppository.

The method of administering the pharmaceutical composition according to the present invention is not particularly limited, and a known method of administering an inhibitor can be applied, and parenteral administration (e.g., intranasal, intravenous, subcutaneous, intraperitoneal administration) according to the desired method. Or topically) or orally, and administration by intranasal injection is preferred in order to obtain a rapid therapeutic effect.

In addition, the pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. The'pharmaceutically or therapeutically effective amount' means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type, severity, and activity of the drug of the patient, Sensitivity to drugs, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field.

The pharmaceutical composition may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and this can be easily determined by a person skilled in the art.

The dosage ranges vary greatly depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and disease severity, and the appropriate dosage is, for example, accumulated in the patient's body. It may vary depending on the amount of drug and/or the specific degree of efficacy of the polynucleotide used. In general, it can be calculated based on the EC50 measured to be effective in an in vivo animal model and in vitro, for example, 0.01 μg to 1 g per 1 kg of body weight, and a unit period of daily, weekly, monthly or yearly, unit It may be administered in divided doses from once to several times per period, or may be administered continuously for a long period of time using an infusion pump. The number of repeated administrations is determined in consideration of the amount of time the drug stays in the body and the concentration of the drug in the body. Even after treatment according to the course of the disease treatment, a pharmaceutical composition may be administered for recurrence.

In an embodiment of the present invention, comprising the step of contacting miR-485-3p with a test substance and determining the activity of miR-485-3p contacted with the test substance, wherein the contacted miR-485-3p When the activity decreases compared to the activity of miR-485-3p of the control group not in contact with the test substance, it is selected as a candidate substance, and a screening method for a substance for the treatment or prevention of Alzheimer's disease or brain disease is presented.

The miR-485-3p is provided in the form of a cell expressing it, and the activity is analyzed by the expression of miR-485-3p. For example, after contacting a cell expressing miR-485-3p according to the present invention with a test substance, the change in the expression level of miR-485-3p was compared with a control cell before or without contact, and the expression level was Those with fluctuations, especially reductions, are selected as candidates. The measurement of the expression level of miR-485-3p may be performed using a known method such as Northern blot, RT-PCR, a hybridization method using a microarray, and the like.

The miR-485-3p is provided in the form of a cell expressing it, and the activity is between the miR-485-3p and the 3'-UTR of its target ELAVL2 protein (ELAV like neuron-specific RNA binding protein 2). Determined by interaction analysis. For example, after contacting a cell expressing miR-485-3p according to the present invention with a test substance, the degree of interaction between 3'-UTR of ELAVL2 protein and miR-485-3p before contact or non-contact control cells Compared with, those with fluctuations, especially reductions in interactions, are selected as candidates. Methods for detecting RNA-RNA interactions used in the method according to the present invention are known in the art, for example those described in RNA Walk (Lusting et al., Nucleic Acids Res. 2010; 38(1):e5). Reference) or Yeat two hybrid system (Piganeau et al., RNA 2006; 12: 177-184), etc., and RNA: A Laboratory Manual (Cold Spring Harbor Laboratory Press 2011) can be referred.

The type of cells used in the screening method and the amount and type of test substance vary depending on the specific experimental method used and the type of test substance, and those skilled in the art will be able to select an appropriate cell type, amount, and/or condition. . As a result of the experiment, a substance that causes a decrease in the activity of miR-485-3p in the presence of the test substance is selected as a candidate substance compared to the control group not in contact with the test substance. About 99% or less reduction, about 95% or less reduction, about 90% reduction, about 85% reduction, about 80% reduction, about 75% reduction, about 70% reduction, about 65% or less reduction, about 60% or less compared to the control It means a decrease, a decrease of about 55%, a decrease of about 50% or less, a decrease of about 45% or less, a decrease of about 40% or less, a decrease of about 30% or less, a decrease of about 20% or less, but does not exclude a range outside the range.

The'test substance' means a substance expected to inhibit the activity of miR-485-3p as described above, and a low molecular weight compound, a high molecular weight compound, a mixture of compounds (eg, natural extracts or cell or tissue cultures) , Or biopharmaceuticals (eg, proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzyme and DNAzyme), or sugars and lipids, but are not limited thereto. The test substance may be a polypeptide having two or more amino acid residues, such as 6, 10, 12, 20 or less, or more than 20 such as 50 amino acid residues. The test substance can be obtained from a library of synthetic or natural compounds, and methods of obtaining a library of such compounds are known in the art. Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA) and Available from MycoSearch (USA). Test substances can be obtained by various combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, and deconvolution. It can be obtained by the required synthetic library method, the "1-bead 1-compound" library method, and the synthetic library method using affinity chromatography selection. Synthesis methods for molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, etc.

For the purpose of screening a drug for treating Alzheimer's disease and/or various brain diseases according to the present invention, a compound having a therapeutic effect of a low molecular weight may be used. For example, a compound having a weight of about 1000 Da such as 400 Da, 600 Da or 800 Da may be used. Depending on the purpose, these compounds may constitute a part of the compound library, and the number of compounds constituting the library varies from tens to millions. Such compound libraries include peptides, peptoids and other cyclic or linear oligomeric compounds, and low molecular weight compounds based on templates such as benzodiazepines, hydantoin, biaryl, carbocycle and polycycle compounds (such as naphthalene, phenothi Azine, acridine, steroids, etc.), carbohydrate and amino acid derivatives, dihydropyridine, benzhydryl and heterocycles (such as triazine, indole, thiazolidine, etc.), but this is only exemplary. It is not limited to this.

In addition, cells or biomolecules can be used for screening. The biomolecules refer to proteins, nucleic acids, carbohydrates, lipids, or substances produced in vivo and in vitro using a cellular system. Biomolecules may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, polynucleotides, peptides, antibodies, or other proteins or biological organic substances found in plasma.

In an embodiment of the present invention, detecting the expression of the miR-485-3p marker from the specimen; And correlating the expression level of the detected marker with the diagnosis or prognosis of Alzheimer's disease and/or various brain diseases of the test subject, providing information necessary for diagnosis or prognosis of Alzheimer's disease and/or various brain diseases. In order to do so, a method of detecting the marker is presented.

In the present invention, the associating step is to compare the expression level of the determined marker with the detection result for each of the markers determined in the control, the expression level of miR-485-3p is increased compared to the control group. .

The expression level of the marker may additionally be used for non-marker clinical information of the seizure disease test subject when diagnosing or prognosing Alzheimer's disease and/or various brain diseases of the test subject. Such non-marker clinical information of the test subject includes the subject's age, sex, weight, diet, body mass, underlying disease and EEG, seizure type, brain MRI, brain CT, or cerebrospinal fluid test, blood test, saliva test. It is not limited to this.

In an embodiment of the present invention, miR-485-3p is based on the discovery that it is involved in the development of Alzheimer's disease and/or various brain diseases by excessively inhibiting the expression of the ELAVL2 protein, and in another embodiment, in cells or tissues of a subject. In particular, it provides a method for treating or preventing Alzheimer's disease and/or brain disease through inhibition of miR-485-3p activity in brain cells or brain tissues or brain.

Alzheimer's disease of a subject, comprising administering a therapeutically or prophylactically effective amount of an inhibitor of miR-485-3p activity to a subject in need of treatment or prevention of Alzheimer's disease and/or brain disease in an embodiment of the present invention, and or Provides a method of treating or preventing brain disease.

Further, in the embodiment of the present invention, a substance capable of inhibiting the activity of miR-485-3p for use in the treatment or prevention of brain diseases is provided, and at this time, a substance capable of inhibiting the activity of miR-485-3p is particularly It is transmitted to the brain.

In addition, for the miR-485-3p activity inhibitor used, miR-485-3p activity control or suppression, administration method, types of diseases that can be treated, etc., reference may be made to those described above.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example 1: Analysis of miRNA expression pattern using miRNA qPCR array in plasma of Alzheimer's patient

(1) patient and sample preparation

Table 1 shows characteristics of patients used in the study, and Sod. About 3 ml of blood was collected in a blood tube (Becton Dickinson, Germany) to which citrate (3.2% w/v) was added. Healthy adults matching the age of 4 (±4 years) were included as a normal group. .

Sex and age of normal and patient groups Group Sample No gender age Normal N1 female 78 Normal N2 male 72 Normal N3 female 74 Normal N4 male 79 Patient group S1 female 72 Patient group S2 female 82 Patient group S3 female 84 Patient group S4 male 75

Blood was centrifuged at 3,500 rpm for 10 minutes to separate plasma and stored at -80°C until RNA extraction. According to the manufacturer's recommendation, miRNA was extracted using the miRNAeasy Serum/Plasma kit (Qiagen, USA). The concentration and purity of the extracted RNA were analyzed using Bioanalyzer2100 (Agilent, USA). Eight groups were used for the study because they met the quality criteria. (2) miRNA qPCR array

Table 2 shows the miRNA qPCR array RNA extracted as a gene list used in the analysis was screened using a miRNA array containing 84 different miRNAs known to be associated with the progression of Human Neurological Development and Neurological Disease.

miRNA qPCR array Gene list used for analysis No. Mature miRNA list No. Mature miRNA list One hsa-let-7b-5p 43 hsa-miR-298 2 hsa-let-7c-5p 44 hsa-miR-29a-3p 3 hsa-let-7d-5p 45 hsa-miR-29b-3p 4 hsa-let-7e-5p 46 hsa-miR-29c-3p 5 hsa-let-7i-5p 47 hsa-miR-302a-5p 6 hsa-miR-101-3p 48 hsa-miR-302b-5p 7 hsa-miR-105-5p 49 hsa-miR-30d-5p 8 hsa-miR-106b-5p 50 hsa-miR-320a 9 hsa-miR-107 51 hsa-miR-328-3p 10 hsa-miR-124-3p 52 hsa-miR-337-3p 11 hsa-miR-125b-5p 53 hsa-miR-338-3p 12 hsa-miR-126-5p 54 hsa-miR-339-5p 13 hsa-miR-128-3p 55 hsa-miR-342-3p 14 hsa-miR-130a-3p 56 hsa-miR-346 15 hsa-miR-132-3p 57 hsa-miR-34a-5p 16 hsa-miR-133b 58 hsa-miR-376b-3p 17 hsa-miR-134-5p 59 hsa-miR-381-3p 18 hsa-miR-135b-5p 60 hsa-miR-409-3p 19 hsa-miR-138-5p 61 hsa-miR-431-5p 20 hsa-miR-139-5p 62 hsa-miR-432-5p 21 hsa-miR-140-5p 63 hsa-miR-433-3p 22 hsa-miR-146a-5p 64 hsa-miR-455-5p 23 hsa-miR-146b-5p 65 hsa-miR-484 24 hsa-miR-148b-3p 66 hsa-miR-485-3p 25 hsa-miR-151a-3p 67 hsa-miR-485-5p 26 hsa-miR-152-3p 68 hsa-miR-487a-3p 27 hsa-miR-15a-5p 69 hsa-miR-488-3p 28 hsa-miR-15b-5p 70 hsa-miR-489-3p 29 hsa-miR-181a-5p 71 hsa-miR-499a-5p 30 hsa-miR-181d-5p 72 hsa-miR-509-3p 31 hsa-miR-191-5p 73 hsa-miR-511-5p 32 hsa-miR-193b-3p 74 hsa-miR-512-3p 33 hsa-miR-195-5p 75 hsa-miR-518b 34 hsa-miR-19b-3p 76 hsa-miR-539-5p 35 hsa-miR-203a-3p 77 hsa-miR-652-3p 36 hsa-miR-20a-5p 78 hsa-miR-7-5p 37 hsa-miR-212-3p 79 hsa-miR-9-5p 38 hsa-miR-22-3p 80 hsa-miR-9-3p 39 hsa-miR-24-3p 81 hsa-miR-92a-3p 40 hsa-miR-26b-5p 82 hsa-miR-93-5p 41 hsa-miR-27a-3p 83 hsa-miR-95-3p 42 hsa-miR-28-5p 84 hsa-miR-98-5p

Quantitative PCR assay method can be summarized as follows. Mature miRNA is generally 22nt, noncoding RNA and is responsible for post-transcriptional regulation. The mature miRNA induces polyadenylation by poly(A) polymerase and was synthesized as cDNA with oligo-dT primers. Oligo-dT primers have a 3'degenerate anchor and a universal tag sequence at the 5'end, enabling mature miRNA amplification during real-time PCR. The miScript SYBR Green PCR Kit (Qiagen) was used to quantify mature miRNA in the real-time PCR process. (3) MiRNA expression pattern analysis through Volcano plot

1(A) is a miRNA expression pattern analysis (volcano blot) in the patient group compared to the normal group, and 84 miRNA expression patterns in the patient group compared to the normal group were analyzed.

The x-axis represents the fold change and the y-axis represents the p-value of -log10. Horizontal black lines indicate p value of 0.05 or less. Volcano blot analysis results hsa-miR-105-5p, hsa-miR-98-5p, hsa-miR-15a-5p, hsa-miR-134-5p, hsa-miR-409-3p, hsa-miR-19b- 3p, hsa-miR-92a-3p, hsa-miR-28-5p, hsa-miR-30d-5p, hsa-miR-212-3p, hsa-miR-93-5p, hsa-miR-342-3p, hsa-miR-381-3p, hsa-miR-431-5p, hsa-miR-130a-3p, hsa-miR-146b-5p, hsa-miR-29a-3p, hsa-miR-132-3p, hsa- miR-376b-3p, hsa-miR-22-3p, hsa-miR-509-3p, hsa-miR-139-5p, hsa-miR-499a-5p, hsa-miR-203a-3p, hsa-miR- 95-3p, hsa-miR-128-3p, hsa-miR-487a-3p, hsa-miR-485-3p, hsa-miR-195-5p, hsa-miR-433-3p, hsa-miR-133b, hsa-miR-191-5p, hsa-miR-489-3p, hsa-miR-432-5p, hsa-miR-29c-3p, hsa-miR-485-5p, hsa-miR-652-3p, hsa- miR-126-5p, hsa-miR-328-3p, hsa-let-7b-5p, hsa-miR-539-5p, hsa-miR-106b-5p, hsa-miR-101-3p, hsa-miR- 302a-5p, hsa-miR-484, hsa-miR-518b, hsa-miR-148b-3p, hsa-miR-181d-5p, hsa-miR-7-5p, hsa-miR-512-3p, hsa- miR-151a-3p, hsa-miR-15b-5p, hsa-let-7e-5p, hsa-miR-135b-5p, hsa-miR-181a-5p, hsa-miR-138-5p, hsa-miR- 34a-5p, hsa-miR-346, hsa-miR-511-5p, hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-487 a-3p, hsa-miR-489-3p, hsa-miR-499a-5p, hsa-miR-509-3p, hsa-miR-511-5p, hsa-miR-512-3p, hsa-miR-518b, hsa-miR-539-5p, hsa-miR-652-3p, hsa-miR-7-5p, hsa-miR-92a-3p, hsa-miR-93-5p hsa-miR-95-3p, hsa-miR It was confirmed that the expression of -98-5p was elevated in the patient group. However, the regulation of miRNA except hsa-miR-485-3p was not statistically significant. In the case of hsa-485-3p, the p-value was 0.00439, indicating a significant increase in Alzheimer's patients compared to the normal group. When the normal group was viewed as 1, severe dementia showed a difference of about 9 times, that is, between 1 and 9 times, it can be classified as mild cognitive impairment (FIG. 1(B)). Therefore, hsa-miR-485-3p may be an expected index for diagnosing Alzheimer's disease.

Example 2: Human miRNA target gene prediction and the same miRNA target gene preservation and anti-mmu-miR-485-3p synthesis in mice

To analyze the base sequence and target position of hsa-miR-485-3p, target prediction software (miRDB) was used to determine that the 3 terminal untranslated region (UTR) of human-derived ELAVL2 was the target of hsa-miR-485-3p. Confirmed. It was confirmed that the seed sequence identified here was also preserved in the untranslated region of the 3 terminal ELAVL2 derived from mmu-miR-485-3p and mouse.

2 is a list showing ELAVL2 3'-untranslated region (UTR) mRNA known as a target of hsa-miR485-3p, and shows the target ELAVL2 3'-untranslated region (UTR) mRNA of miR-485-3p. The 5'seed sequence (ELAVL2) of miR-485-3p is shown in red. Table 3 shows the nucleotide sequence of has-miR-485-3p, and a functional study was conducted by synthesizing the sequence to investigate the physiological function of miR-485-3p using the Alzheimer's disease model.

base sequence of has-miR-485-3p Gene Sequence(5'->3') Sequence number hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU One

Table 4 shows the base sequence and target position analysis of mmu-miR485-3p, using target prediction software (TargetScan, PicTar, and microT) to 3'-untranslated region (UTR) and mmu-miR-485- of mouse ELAVL2. It was confirmed that the target sequence of 3p was preserved. It was confirmed that the 3'-untranslated site (UTR) of mouse ELAVL2 was a target of mmu-miR-485-3p.

Base sequence and target position analysis of mmu-miR485-3p Gene Sequence(5'->3') Sequence number mmu-miR-485-3p AGUCAUACACGGCUCUCCUCUC 8 Target gene Gene name 3P-seq tags + 5 Total sites Representative miRNA ELAVL2 ELAV like neuron-specific RNA binding protein 2 78 3 mmu-miR-485-3p

For mmu-miR-485-3p overexpressed in the Alzheimer's mouse model, a target gene related to Alzheimer's and brain diseases, a specific sequence antagomir, 2`-O-methylated and phosphorothioate-modified antisense oligonucleotides were synthesized.

Example 3: Analysis of miR-485-3p expression in the hippocampus and cerebral cortex of 5xFAD mice (RT-qPCR)

(1) Research method

The 5xFAD transgenic mouse is an animal model of Alzheimer's disease in which the accumulation of intraneuronal Aβ42 is severe from 6 weeks by overexpressing mutant APP and PSEN1.

According to the results of Example 1, RT-qPCR was performed to confirm the expression of miR-485-3p in the dementia animal model. Ten months old 5xFAD transgenic mice and wild type (WT) mice were deeply anesthetized and sacrificed with a single head. The brain was immediately excised and the hippocampus and cerebral cortex were excised from the residual brain structure. Total miRNA was isolated from the hippocampus using the PAXgene Tissue miRNA Kit (Qiagen, USA) according to the manufacturer's method. cDNA was synthesized using the miScript II RT Kit (Qiagen, USA), and qPCR was performed using the mmu_miR-485-3p miScript Primer Assay and miScript SYBR Green PCR Kit. The miRNA level was quantified by normalizing according to snoRNA202 (mouse control).

(2) Research results

3(A) is a result of comparing the expression of miR-485-3p in hippocampus and cortex, and RT-PCR was performed to confirm the expression pattern of miR-485-3p in the hippocampus and cerebral cortex of 5xFAD. As a result, the expression of miR-485-3p was increased in the hippocampus of 5xFAD compared to WT. Therefore, it is shown that the expression of miR-485-3p is elevated in Alzheimer's dementia, together with the study results of Example 1. Accordingly, we tried to identify neuronal target mRNA or protein that miR-485-3p can affect.

Example 4: Confirmation of expression of related protein including ELAVL2 and amyloid beta 42 protein in hippocampus and cerebral cortex of 5xFAD mice

(1) Research method

According to the results of Example 3, it was attempted to confirm the expression of the related protein including ELAVL2 and the amyloid beta 42 protein in the hippocampus and cerebral cortex of 5xFAD. Anesthetized mice (9 months) were sacrificed with a single head and the brain was immediately excised. A homogenate of the brain region (hippocampus, cerebral cortex) was prepared to prepare an antibody against ELAVL2 (abcam, USA), cFOS antibody (cell signaling, USA), APP antibody (cell signaling, USA), amyloid beta antibody (cell signaling, USA) ) Was used to perform western blot. The immunoreactive protein was visualized with a chemiluminescent reagent (GE health care, UK) and measured and quantified using a chemical image analyzer (Fusion SL). To quantify the amyloid beta 42 protein in the hippocampus and cerebral cortex, it was quantified using a mouse/rat amyloid beta (1-42) ELISA kit (IBL), and for details, refer to the manufacturer's instructions.

(2) Research results

1) Confirmation of ELAVL2 expression in hippocampus and cerebral cortex

3(B) and 3(C) are results of comparison of ELAVL2 expression and related protein expression in the hippocampus and cerebral cortex of 5xFAD. ELAVL2, ELAV-like RNA-binding proteins, are known to regulate neuronal functions such as neuronal excitation or synaptic transmission, which are directly related to cognitive and behavioral functions. In addition, ELAVL2, as a neural-specific RNA-binding protein, is responsible for post-transcriptional gene regulation by recognizing the GAAA motif of RNA. As the target, cFOS, a transcription factor that affects the expression level of a protein, is known. In addition, cFOS is known to affect the expression of APP proteins known as amyloid beta precursors in brain cells. It was confirmed that the increase pattern of miR-485-3p significantly affected the APP expression level in a series of processes.

2) Comparison of Aβ42 expression in cerebral cortex and hippocampus

4 is a result of quantitative comparative analysis of Aβ42 in 5xFAD, and Aβ42 expression in the cerebral cortex and hippocampus of 5xFAD was compared and analyzed. In 5xFAD, it was confirmed that Aβ42 significantly increased compared to WT in both the cerebral cortex (FIG. 4(A)) and hippocampus (FIG. 4(B)). These results suggest that regulating miR-485-3p could be a way to reduce amyloid beta, which is known to cause Alzheimer's disease.

Example 5: Measurement of the concentration of amyloid beta (Aβ) 42 isolated from saliva

(1) Research method

Since amyloid beta is measured in saliva substantially close to the brain, the accuracy is superior to that of blood, and early diagnosis is possible by quantifying a small amount of amyloid beta. In addition, higher accuracy (99% or more) can be secured by double-checking with auxiliary means (blood, miRNA).

Using a sequence that specifically binds to amyloid beta 42 and a sequence that binds to itself inside the nucleic acid, a multi-nucleic acid having structural characteristics in which a quencher is released and fluorescence is expressed when combined with amyloid beta 42 was synthesized. Since the size of the multinucleic acid is smaller than that of the antibody, it has excellent specificity and selectivity, and it is possible to provide a diagnostic method with high diagnostic ease because sampling and mass analysis are possible within 1 hour. Amyloid beta 42 in saliva was quantified using a platform technology (magnetoimmunoassay system) capable of collecting a very small amount of biomarkers into a mono layer (FIG. 5). It can reproduce the gathering of certain nanoparticles in a certain area. The aggregate of the saliva-derived amyloid beta and the magnetic particle complex is within 300 μm in diameter, and the number of magnetic particles in the aggregate is ~1.0 X 10 ⁴ (Fig. 6(a)). The region-of-interest (ROI) of the photomultiplier tube (PMT) analysis was 100 × 100 μm ² , and the fluorescent substance was measured three times by PMT, and the average value of each sample was calculated (FIG. 6(b)).

100 patients in the normal group and 100 patients from mild cognitive impairment to severe dementia were recruited, and the age range is from the early 30s to the late 80s. Patients who may have other diseases that may affect dementia were excluded.

(2) Research results

A very small amount of amyloid beta was measured in saliva, and amyloid beta that did not come out by ELISA was reproduced. As a result of comparative experiment with ELISA on the market for research, it was not detected in normal people in their 30s.

The magnetoimmunoassay system according to this embodiment can simply detect salivary amyloid beta peptide at a concentration of ~ 20 pg/ml, which is somewhat higher than that of a commercial ELISA system. According to the protocol of the ELISA system used for reference, the lowest measurable concentration of the standard amyloid beta peptide is 7.4 pg/ml, because the curve-pit for measurement does not satisfy the exact linearity for the very low concentration range. It can be a bit vague.

As a result of measuring saliva-derived amyloid beta 42 for each dementia patient, normal, mild cognitive impairment (MCI), and severe patients could be distinguished. That is, normal (0 ~ 500 pg / ml), mild cognitive impairment (500 pg ~ 1 ng / ml), severe (1 ng / ml ~) amyloid beta concentration was confirmed (Fig. 7). In addition, by quantifying amyloid beta in more than 100 patients with dementia, they succeeded in distinguishing between mild cognitive impairment and moderate dementia (more than 90% consistent with the diagnosis of a clinician).

Example 6: Hippocampal primary cell line construction and in vitro transfection

(1) Research method

Primary cells extracted from hippocampus and cerebral cortical tissues harvested from 5xFAD embryos were cultured. Reference was made to a previous study, a method of fabrication and culture (Seibenhener, M.L & Woonten M.W, Isolation and culture of Hippocampal Neurons from Prenatal Mice, Jove, 2012). In Vitro Transfection Using Lipofectamine 2000, primary cells were transfected with 50 nM of miR-485-3p duplex (or scrambled miRNA duplex; Bioneer, Daejon, South Korea) and 50 nM of Antagomir (AM) 485-3p. Cell homogenates obtained from 48 hours after transfection were prepared, and western blot was performed using ELAVL2 antibody (abcam, UK). The immunoreactive protein was visualized with a chemiluminescent reagent (GE health care, UK) and measured and quantified using a chemical image analyzer (Fusion SL). Amyloid beta 42 protein was measured using a mouse/rat amyloid beta (1-42) assay kit (IBL) by referring to the manufacturer's instructions.

(2) Research results

ELAVL2 expression according to AM485-3p transfection in hippocampal primary cells was compared (FIG. 9). It was confirmed that ELAVL2 was expressed in primary cells of 5xFAD hippocampus, and the expression of ELAVL2 was increased compared to control in cells transfected with AM485-3p. This means that miR-485-3p inhibits the expression of ElAVL2 and proved this in AM-treated cells. Since ELAVL2 is an important factor influencing cognitive function by participating in neuronal excitation, the development of drugs or compositions such as miR-485-3p inhibitors that elevate ELAVL2 may be a key strategy in preventing/treating Alzheimer's disease.

Example 7: Quantitative comparative analysis of related protein including ELAVL2 and amyloid beta 42 protein in 5xFAD treated intranasally with AM485-3p

(1) Research method

Inhibition of miR-485-3p was induced by intranasal administration of sequence-specific entagomere or scramble-sequence entagomere. Intranasal administration of entagomere was performed according to the method of targeting the brain without anesthetizing the mouse. (Leah R.T., et al. (2013) Intranasal Administration of CNS Therapeutics to Awake Mice. J Vis Exp. 2013; (74): 4440). After completing the adaptation step described in the thesis, fix the mouse for intranasal suction (Intranasal grip), position the abdomen upward, and place a pipette in front of one nasal cavity. Aspirate 6 µl with a pipette 2 times, and aspirate it in drop form (1 drop = 3 µl). After maintaining the posture for 15 seconds, inhale the same in the right nasal cavity. After 2 minutes, the same procedure was repeated and a total of 24 µl was aspirated (AM485 (2'-O-Methylated)-5'-gagaggagagccguguaugacu-3'; 24 µl of 0.1% v/v diethylpyrrocarbonate-treated) 5 nmol in distilled water; Bioneer, Korea). Control mice were administered an equal volume of Vehicle. After 12 weeks (once a week) from the time point of nasal administration (7 months), the anesthetized mouse was sacrificed with a single head, and the brain was immediately excised. A homogenate of the brain region (hippocampus, and cortex) was prepared, and it was prepared with an antibody against ELAVL2 (abcam, USA), cFOS antibody (cell signaling, USA), APP antibody (cell signaling, USA), amyloid beta antibody (cell signaling, USA) was used to perform western blot. The immunoreactive protein was visualized with a chemiluminescent reagent (GE health care, UK) and measured and quantified using a chemical image analyzer (Fusion SL). Amyloid beta 42 protein was measured using a mouse/rat amyloid beta (1-42) assay kit (IBL) by referring to the manufacturer's instructions.

(2) Research results

In the 5xFAD treated intranasally with AM485-3p, ELAVL2-containing related protein and amyloid beta 42 protein were quantitatively compared and analyzed (FIG. 10). Since the treatment of AM485-3p in the mouse primary cell line in Example 6 induced ELAVL2 changes, it was attempted to confirm the role of AM485-3p in vivo by nasal treatment with AM485-3p in 5xFAD. The expression of ELAVL2 in the AM485-3p group was increased compared to the control group. Upon recovery of ELAVL2, the expression of cFOS, a transcription factor involved in the expression of APP, was normalized, which reduced the expression of APP, which led to a decrease in the amyloid beta 42 protein (FIGS. 10(A) and (B)). This suggests that the development of drugs or compositions such as miR-485-3p inhibitors is a key strategy for preventing/treating Alzheimer's disease. In addition, since it was confirmed that the treatment of AM485-3p affects the inhibition of the production of Aβ42 in the animal model (FIG. 10(C)), it seems that the related inhibitor or drug treatment can relieve the pathologic symptoms of Alzheimer's dementia.

Example 8: Comparison of cognitive function in 5xFAD treated intranasally with AM485-3p in 5xFAD mice

(1) Research method

Y-maze and passive avoidance tests were performed to check whether 5xFAD treated with AM485-3p nasal cavity improved cognitive function.

1) Y-maze test

The Y-maze experiment device consists of a Y-shaped labyrinth made of black acrylic plates (10 cm wide, 41 cm long, 25 cm high), and each labyrinth is arranged at an angle of 120° to each other. have. After each maze is designated as areas A, B, and C, the experimental animal is carefully placed in one area and allowed to move freely for 8 minutes, and then the number and sequence of entering each maze are measured to determine the spontaneous alteration (%). Evaluated. When entering three different areas sequentially, it was recognized as 1 point (actual alteration, that is, in the order of ABC, BCA, CAB, etc.). If it did not enter consecutively, it was not counted as a score. Therefore,% spontaneous alteration was calculated by the following formula.

% spontaneous alteration = total number of alterations/(total number of entries-2) x 100

2) Passive avoidance test

The passive avoidance test, widely used for measuring learning and memory, is a method of measuring the working memory ability of rodents. The passive avoidance test device is a shuttle box divided into two rooms, and a bright light bulb is installed in one room to create a bright environment that the experimental animals dislike, and the experiment animal is comfortable by preventing light from entering the other room. Made you feel. After the 2 hours of stressing was over, the passive avoidance reaction was tested (training test). Aluminum rods are placed on the floor of a dark room at regular intervals, which can apply an electric shock to the animal's paws. Experimental animals tend to enter a dark room, so when they are placed in a bright room and enter a dark room, an electric shock (5V, 0.5 mA, 10 sec) is given to the animal to remember it. Immediately thereafter, 24 hours later, without electric shock, the latency time of entering the dark room was measured up to 90 seconds (retention tests 1, 2, 3).

(2) Research results

The cognitive function was compared in 5xFAD treated intranasally with AM485-3p (FIG. 11). As a result of the behavioral experiment, both change behavioral power (Spontaneous alteration, Fig. 11(A)) and retention time (Latency time, Fig. 11(B)) decreased in 5xFAD compared to WT. Since the main symptoms of Alzheimer's dementia are represented by behavioral disorders and poor memory, the behavioral disorders of 5xFAD appear to be due to excessive accumulation of amyloid beta and pathology. However, in the group treated with AM485-3p nasal treatment, both change behavior and retention time were significantly increased compared to 5xFAD. This means that the treatment of AM485-3p can improve the main symptoms of Alzheimer's by resolving pathological symptoms such as behavioral disorders and memory loss, which appear as miR-485-3p promotes the production of amyloid beta 42 protein. Therefore, it is suggested that the preparation of a drug or composition that modulates miR-485-3p may be a new strategy to improve behavioral disorder and cognitive function, which are the main symptoms of Alzheimer's dementia.

Example 9: Statistical Analysis

Two groups were compared using Student's-t test, and three or more groups were compared using Krushall-Wallis analysis of variance. When the P-value obtained in the Krushall-Wallis test was <0.05, the Mann-Whitney U test was used to perform a post-hoc comparison between groups. A two-tailed P-value of 0.05 or less was considered statistically significant.

As described above, specific parts of the present invention have been described in detail, and it will be apparent to those of ordinary skill in the art that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> BIORCHESTRA Ltd. <120> Method for Diagnosing Alzheimer's disease Using microRNA-485-3p <130> P17-B152 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 1 gucauacacg gcucuccucu cu 22 <210> 2 <211> 73 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 2 acuuggagag aggcuggccg ugaugaauuc gauucaucaa agcgagucau acacggcucu 60 ccucucuuuu agu 73 <210> 3 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 3 guguaugac 9 <210> 4 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 4 uguaugac 8 <210> 5 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 5 guguauga 8 <210> 6 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 6 uguauga 7 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 7 agagaggaga gccguguaug ac 22 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> mmu-miR-485-3p <400> 8 agucauacac ggcucuccuc uc 22

Claims (14)

A pharmaceutical composition for preventing or treating Alzheimer's disease, comprising a substance capable of inhibiting the activity of miR-485-3p and a pharmaceutically acceptable carrier.
The Alzheimer's disease according to claim 1, wherein the substance capable of inhibiting the activity of miR-485-3p is a compound, antisense oligonucleotide, decoy oligonucleotide, aptamer, ribozyme, or a fragment of an antibody or antibody. Pharmaceutical composition for the prevention or treatment of.
[3] The pharmaceutical composition for preventing or treating Alzheimer's disease according to claim 2, wherein the substance capable of inhibiting the activity of miR-485-3p is an antisense oligonucleotide.
The antisense oligonucleotide according to claim 3, wherein the antisense oligonucleotide is ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomere, 2'-O-modified oligonucleotide, phosphorothioate-backbone deoxyribonucleotide, phosphorothioate- A pharmaceutical composition for the prevention or treatment of Alzheimer's disease, characterized in that the backbone ribonucleotide, peptide nucleic acid (PNA) oligonucleotide or locked nucleic acid (LNA) oligonucleotide.
[5] The pharmaceutical composition for preventing or treating Alzheimer's disease according to claim 4, wherein the antisense oligonucleotide is Antagomere.
Measuring the expression level of miR-485-3p from the collected blood or plasma and confirming that the expression level of the miR-485-3p is increased by 5 times or more compared to the normal group for diagnosis of Alzheimer's disease How to provide information.
The method of claim 6, wherein the expression level of the miR-485-3p is increased by 9 times or more compared to the normal group.
A screening method of a candidate substance for preventing or treating Alzheimer's disease comprising the following steps:
a) contacting miR-485-3p with the test substance;
b) determining the activity of miR-485-3p in contact with the test substance; And
c) When the activity of miR-485-3p in contact with the test substance is reduced compared to the activity of miR-485-3p in the control group not in contact with the test substance, selecting it as a candidate substance.
The method of claim 8, wherein the decrease in the activity of the miR-485-3p is a decrease in the expression level of the miR-485-3p.
The method of claim 8, wherein the decrease in the activity of the miR-485-3p decreases the interaction between the miR-485-3p and the 3'-UTR of the gene encoding the ELAVL2 protein (ELAV like neuron-specific RNA binding protein 2). Screening method characterized in that.
The antisense oligonucleotide according to any one of claims 3 to 5, wherein the antisense oligonucleotide comprises a sequence that is partially or completely complementary to the nucleotide sequence of the 1st or 2nd to 7th or 8th of the nucleotide sequence of SEQ ID NO: 1. Pharmaceutical composition for the prevention or treatment of Alzheimer's disease, characterized in that it comprises.
The pharmaceutical composition for the prevention or treatment of Alzheimer's disease according to any one of claims 3 to 5, wherein the antisense oligonucleotide comprises a sequence of SEQ ID NO: 3, 4, 5, 6 or 7.
The method of claim 11, wherein the antisense oligonucleotide is a pharmaceutical composition for the prevention or treatment of Alzheimer's disease, characterized in that it comprises the sequence of SEQ ID NO: 7.
The antisense oligonucleotide according to any one of claims 3 to 5, wherein the antisense oligonucleotide is 2'-O- methylated or medoxylethylated with one or more nucleotides constituting the oligonucleotide, or each of the one or more nucleotides is LNA. Or, one or more of the chemical bonds constituting the backbone of the nucleotide is a pharmaceutical composition for the prevention or treatment of Alzheimer's disease, characterized in that phosphothioate.

Images